rna target sequencing Search Results


90
Shanghai GenePharma p53 depletion small interference rna (sirna) sequence target p53
P53 Depletion Small Interference Rna (Sirna) Sequence Target P53, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/p53+depletion+small+interference+rna++sirna++sequence+target+p53/ppr0413229-58-8-13
Average 90 stars, based on 1 article reviews
p53 depletion small interference rna (sirna) sequence target p53 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma shorthairpin rna (shrna) sequences targeting krt17
Shorthairpin Rna (Shrna) Sequences Targeting Krt17, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/short+hairpin+rna++shrna++sequences+targeting+krt17/ppr0559103-60-0-9
Average 90 stars, based on 1 article reviews
shorthairpin rna (shrna) sequences targeting krt17 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma small interfering rnas targeting the snord16 rna sequence
Small Interfering Rnas Targeting The Snord16 Rna Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/small+interfering+rnas+targeting+the+snord16+rna+sequence/pm32704240-38-11-19
Average 90 stars, based on 1 article reviews
small interfering rnas targeting the snord16 rna sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega co 2 independent media containing 2%cds and 4% glosensor reagent (promega)
Co 2 Independent Media Containing 2%Cds And 4% Glosensor Reagent (Promega), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/internal+control+rna+plasmids+containing+the+rt+qpcr+target+sequences+for+hev+enotype+3+and+4/pmc03786410-78-11-13
Average 90 stars, based on 1 article reviews
co 2 independent media containing 2%cds and 4% glosensor reagent (promega) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/rnase1+crispr+guide+rna++target+sequence++tgccaagggctcatgcacga+/pm38307859-283-32-48
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation tandem repeats of the rna target sequence
Tandem Repeats Of The Rna Target Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/tandem+repeats+of+the+rna+target+sequence/pm34138527-229-5-27
Average 90 stars, based on 1 article reviews
tandem repeats of the rna target sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lentivirus lv-wip1
Lentivirus Lv Wip1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/three+predesigned+small+interfering+rna++sirna++sequences+targeting+the+wip1/pm31676238-132-12-23
Average 90 stars, based on 1 article reviews
lentivirus lv-wip1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation mouse non-targeting grna (guide rna) sequence
Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28
Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated single guide rna (sgrna) including the sequence targeting the neu2 gene
Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/single+guide+rna++sgrna++including+the+sequence+targeting+the+neu2+gene/pmc08881595-32-7-20
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
TriLink target sequence rna
Target Sequence Rna, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/target+sequence+rna/10__1016_slash_j__bmc__2015__07__018-23-21-34
Average 90 stars, based on 1 article reviews
target sequence rna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/guide+rna++grna++sequences+targeting+the+exon+regions+of+the+human+il15ra+gene/pmc11986442-68-6-17
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sequence-specific small interfering rna (sirna) targeting rat crhr1
Sequence Specific Small Interfering Rna (Sirna) Targeting Rat Crhr1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+target+sequencing/sequence+specific+small+interfering+rna++sirna++targeting+rat+crhr1/pm29126185-115-1-14
Average 90 stars, based on 1 article reviews
sequence-specific small interfering rna (sirna) targeting rat crhr1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results