90
|
Shanghai GenePharma
p53 depletion small interference rna (sirna) sequence target p53 P53 Depletion Small Interference Rna (Sirna) Sequence Target P53, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/p53+depletion+small+interference+rna++sirna++sequence+target+p53/ppr0413229-58-8-13 Average 90 stars, based on 1 article reviews
p53 depletion small interference rna (sirna) sequence target p53 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
shorthairpin rna (shrna) sequences targeting krt17 Shorthairpin Rna (Shrna) Sequences Targeting Krt17, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/short+hairpin+rna++shrna++sequences+targeting+krt17/ppr0559103-60-0-9 Average 90 stars, based on 1 article reviews
shorthairpin rna (shrna) sequences targeting krt17 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
small interfering rnas targeting the snord16 rna sequence Small Interfering Rnas Targeting The Snord16 Rna Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/small+interfering+rnas+targeting+the+snord16+rna+sequence/pm32704240-38-11-19 Average 90 stars, based on 1 article reviews
small interfering rnas targeting the snord16 rna sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
co 2 independent media containing 2%cds and 4% glosensor reagent (promega) Co 2 Independent Media Containing 2%Cds And 4% Glosensor Reagent (Promega), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/internal+control+rna+plasmids+containing+the+rt+qpcr+target+sequences+for+hev+enotype+3+and+4/pmc03786410-78-11-13 Average 90 stars, based on 1 article reviews
co 2 independent media containing 2%cds and 4% glosensor reagent (promega) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/rnase1+crispr+guide+rna++target+sequence++tgccaagggctcatgcacga+/pm38307859-283-32-48 Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
tandem repeats of the rna target sequence Tandem Repeats Of The Rna Target Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/tandem+repeats+of+the+rna+target+sequence/pm34138527-229-5-27 Average 90 stars, based on 1 article reviews
tandem repeats of the rna target sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
lentivirus lv-wip1 Lentivirus Lv Wip1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/three+predesigned+small+interfering+rna++sirna++sequences+targeting+the+wip1/pm31676238-132-12-23 Average 90 stars, based on 1 article reviews
lentivirus lv-wip1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
mouse non-targeting grna (guide rna) sequence Mouse Non Targeting Grna (Guide Rna) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/mouse+non+targeting+grna++guide+rna++sequence/pm33197448-108-8-28 Average 90 stars, based on 1 article reviews
mouse non-targeting grna (guide rna) sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
ToolGen Incorporated
single guide rna (sgrna) including the sequence targeting the neu2 gene Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/single+guide+rna++sgrna++including+the+sequence+targeting+the+neu2+gene/pmc08881595-32-7-20 Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
TriLink
target sequence rna Target Sequence Rna, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/target+sequence+rna/10__1016_slash_j__bmc__2015__07__018-23-21-34 Average 90 stars, based on 1 article reviews
target sequence rna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
guide rna (grna) sequences targeting the exon regions of the human il15ra gene Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/guide+rna++grna++sequences+targeting+the+exon+regions+of+the+human+il15ra+gene/pmc11986442-68-6-17 Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
sequence-specific small interfering rna (sirna) targeting rat crhr1 Sequence Specific Small Interfering Rna (Sirna) Targeting Rat Crhr1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rna+target+sequencing/sequence+specific+small+interfering+rna++sirna++targeting+rat+crhr1/pm29126185-115-1-14 Average 90 stars, based on 1 article reviews
sequence-specific small interfering rna (sirna) targeting rat crhr1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |