We use essential cookies to operate our site. With your consent, we may also use non-essential cookies to improve your user experience and to analyze website traffic. Click "Accept" to accept cookies and go directly to the site, click "Reject" to reject all but cookies strictly necessary for the functioning of this site. You can reset your cookie settings at any time by visiting your Bioz "my account" page and selecting the "reset cookie preferences" link.

Accept Reject

All (5)
Takara Bio
Becton Dickinson
BioVector NTCC
Ellman International
Thermo Fisher
 

About 16 products / 124 snippets

95 / 100
Bioz Stars
pLVX-DsRed-Monomer-N1 Vector
Takara Bio  
Catalog#: 632152
Techniques
Plasmid Preparation, Sequencing, Software, Clone Assay, Construct (see more)
Article Snippets
".. were marked as CAF‐A and CAF‐B after immunofluorescence assay by infected pLVX-DsRed-N1-Monomer vector (Clontech/Takara Bio USA, Inc.)."  (see more)
95 / 100
Bioz Stars
pLVX-DsRed-Monomer-N1 Vector
Takara Bio  
star_border
Catalog#: 632152
Techniques
Plasmid Preparation, Sequencing, Software, Clone Assay, Construct (see more)
Article Snippets
".. were marked as CAF‐A and CAF‐B after immunofluorescence assay by infected pLVX-DsRed-N1-Monomer vector (Clontech/Takara Bio USA, Inc.)."  (see more)
95 / 100
Bioz Stars
pDsRed-Monomer-Hyg-N1 Vector
Takara Bio  
star_border
Catalog#: 632494
Techniques
Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Construct (see more)
Article Snippets
".. ber 13, 2018 by guest http://jvi.asm .org/ D ow nloaded from 8 pDsRed-Monomer-hyg-N1 vector (Clontech, Palo Alto, CA, USA)."  (see more)
95 / 100
Bioz Stars
pDsRed-Monomer-N1 Vector
Takara Bio  
star_border
Catalog#: 632465
Techniques
Plasmid Preparation, Clone Assay, Construct, Expressing, Amplification (see more)
Article Snippets
".. extraction kits were purchased from Aidlab (China). pCMV-Myc, pRK5-flag, pDsRed-monomer-N1, and pEGFP-C1 vectors were obtained from Clontech."  (see more)
95 / 100
Bioz Stars
pRetroQ-DsRed Monomer-N1 Vector
Takara Bio  
star_border
Catalog#: 632507
Techniques
Plasmid Preparation, Amplification, Luciferase, Reporter Assay (see more)
Article Snippets
"One example of a γ-retroviral vector useful in the disclosed compositions and methods is a pRetroQ vector (e.g., pRetroQ-DsRed Monomer-N1 Vector, Cat. No. 632507, Takara Bio)."  (see more)
85 / 100
Bioz Stars
PDsRed-Monomer-N1
Thermo Fisher Scientific / Invitrogen  
star_border
Techniques
 
Article Snippets
"The cDNAs were cloned into the pCR2.1-Topo vector (Invitrogen), sequenced, and subcloned into the following vectors: pEGFP-N1, pEGFP-C1 or -C3, pDsRed-Monomer-N1, pCMV-Myc (all obtained from CLONTECH Laboratories, Inc.), pQ-C-His, and pVenus. pVenus was produced .."  (see more)
85 / 100
Bioz Stars
PDsRed-Monomer-N1
Becton Dickinson / BD Biosciences  
star_border
Techniques
 
Article Snippets
"An open reading frame (ORF) encoding histone H2B ( Morrow et al., 2005 ) was cloned into pDsRed-Monomer-N1 to create a histone-H2B-dsRed ORF (BD Biosciences)."  (see more)
91 / 100
Bioz Stars
PDsRed-Monomer-N1 vector
Becton Dickinson / BD Biosciences  
star_border
Techniques
 
Article Snippets
"Monomeric EGFP was created by introducing an altered codon A206K into the EGFP sequence of the ®Clontech vector pEGFP-N1 (gift from J. Sieber, Göttingen), and monomeric DsRed was inserted after amplification of DsRed from the pDsRed-Monomer-N1 vector from ®BD biosciences."  (see more)
85 / 100
Bioz Stars
PDsRed-Monomer-N1 vector
Becton Dickinson / BD Biosciences  
star_border
Techniques
 
Article Snippets
"NSP4 from rotavirus strain SA11 was cloned into pDsRed-Monomer-N1 vector (BD Biosciences Clontech, Palo Alto, CA) using a strategy identical to that described for cloning NSP4 .."  (see more)
85 / 100
Bioz Stars
PDsRed-Monomer-Hyg-N1 vector
Becton Dickinson / BD Biosciences  
star_border
Techniques
 
Article Snippets
".. as previously described , which was generated by modifying the commercially available pDsRed-Monomer-Hyg-N1 vector (BD Biosciences Clontech, Mountain View, CA, USA)."  (see more)
85 / 100
Bioz Stars
PDsRed-Monomer-Hyg-N1 plasmid
Becton Dickinson  
star_border
Techniques
 
Article Snippets
"The lyLMP-1 coding sequence of clone lyLMP-1 was subcloned into the pDsRed-Monomer-Hyg-N1 plasmid (BD Biosciences-Clontech, Mountain View, Calif.)."  (see more)
88 / 100
Bioz Stars
PLVX-EF1α-DsRed-monomer-N1
BioVector NTCC  
star_border
Techniques
 
Article Snippets
".. primers: 5′-GGGAGACCCAAGCTGGCTAGC ATGGACAACACCGAGGACGTCAT3′, reverse: 5′-GTTTTCATTGACCATGGTACC CTGGGAGCCGGAGTGGCG from pLVX-EF1α-DsRed-monomer-N1 (Biovector NTCC Inc., Beijing, China)."  (see more)
85 / 100
Bioz Stars
PDsRed-monomer-Hyg-N1
Becton Dickinson / BD Biosciences  
star_border
Techniques
 
Article Snippets
"Abstract: Results: The novel MPZ mutation, c.367G A, is associated with a late-onset demyelinating CMT phenotype with autosomal dominant inheritance.. The median motor nerve conduction velocities of patients in this family ranged from 15.7 to ..."  (see more)