assistant_photoSave product to folder
X
Create new folder
95 / 100 Bioz Stars | pLVX-DsRed-Monomer-N1 Vector Takara Bio ![]() ![]() | Visit Supplier | ||||
Catalog#: 632152 Techniques Plasmid Preparation, Sequencing, Software, Clone Assay, Construct (see more) Article Snippets ".. were marked as CAF‐A and CAF‐B after immunofluorescence assay by infected pLVX-DsRed-N1-Monomer vector (Clontech/Takara Bio USA, Inc.)." (see more) | × | |||||
95 / 100 Bioz Stars | pLVX-DsRed-Monomer-N1 Vector Takara Bio ![]() ![]() | star_border | Visit Supplier | |||
Catalog#: 632152 Techniques Plasmid Preparation, Sequencing, Software, Clone Assay, Construct (see more) Article Snippets ".. were marked as CAF‐A and CAF‐B after immunofluorescence assay by infected pLVX-DsRed-N1-Monomer vector (Clontech/Takara Bio USA, Inc.)." (see more) | × | |||||
95 / 100 Bioz Stars | pDsRed-Monomer-Hyg-N1 Vector Takara Bio ![]() ![]() | star_border | Visit Supplier | |||
Catalog#: 632494 Techniques Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Construct (see more) Article Snippets ".. ber 13, 2018 by guest http://jvi.asm .org/ D ow nloaded from 8 pDsRed-Monomer-hyg-N1 vector (Clontech, Palo Alto, CA, USA)." (see more) | × | |||||
95 / 100 Bioz Stars | pDsRed-Monomer-N1 Vector Takara Bio ![]() ![]() | star_border | Visit Supplier | |||
Catalog#: 632465 Techniques Plasmid Preparation, Clone Assay, Construct, Expressing, Amplification (see more) Article Snippets ".. extraction kits were purchased from Aidlab (China). pCMV-Myc, pRK5-flag, pDsRed-monomer-N1, and pEGFP-C1 vectors were obtained from Clontech." (see more) | × | |||||
95 / 100 Bioz Stars | pRetroQ-DsRed Monomer-N1 Vector Takara Bio ![]() ![]() | star_border | Visit Supplier | |||
Catalog#: 632507 Techniques Plasmid Preparation, Amplification, Luciferase, Reporter Assay (see more) Article Snippets "One example of a γ-retroviral vector useful in the disclosed compositions and methods is a pRetroQ vector (e.g., pRetroQ-DsRed Monomer-N1 Vector, Cat. No. 632507, Takara Bio)." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-Monomer-N1 Thermo Fisher Scientific / Invitrogen ![]() ![]() | star_border | Visit Supplier | |||
Article Snippets "The cDNAs were cloned into the pCR2.1-Topo vector (Invitrogen), sequenced, and subcloned into the following vectors: pEGFP-N1, pEGFP-C1 or -C3, pDsRed-Monomer-N1, pCMV-Myc (all obtained from CLONTECH Laboratories, Inc.), pQ-C-His, and pVenus. pVenus was produced .." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-Monomer-N1 Becton Dickinson / BD Biosciences ![]() | star_border | Visit Supplier | |||
Article Snippets "An open reading frame (ORF) encoding histone H2B ( Morrow et al., 2005 ) was cloned into pDsRed-Monomer-N1 to create a histone-H2B-dsRed ORF (BD Biosciences)." (see more) | × | |||||
91 / 100 Bioz Stars | PDsRed-Monomer-N1 vector Becton Dickinson / BD Biosciences ![]() | star_border | Visit Supplier | |||
Article Snippets "Monomeric EGFP was created by introducing an altered codon A206K into the EGFP sequence of the ®Clontech vector pEGFP-N1 (gift from J. Sieber, Göttingen), and monomeric DsRed was inserted after amplification of DsRed from the pDsRed-Monomer-N1 vector from ®BD biosciences." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-Monomer-N1 vector Becton Dickinson / BD Biosciences ![]() | star_border | Visit Supplier | |||
Article Snippets "NSP4 from rotavirus strain SA11 was cloned into pDsRed-Monomer-N1 vector (BD Biosciences Clontech, Palo Alto, CA) using a strategy identical to that described for cloning NSP4 .." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-Monomer-Hyg-N1 vector Becton Dickinson / BD Biosciences ![]() | star_border | Visit Supplier | |||
Article Snippets ".. as previously described , which was generated by modifying the commercially available pDsRed-Monomer-Hyg-N1 vector (BD Biosciences Clontech, Mountain View, CA, USA)." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-Monomer-Hyg-N1 plasmid Becton Dickinson ![]() | star_border | Visit Supplier | |||
Article Snippets "The lyLMP-1 coding sequence of clone lyLMP-1 was subcloned into the pDsRed-Monomer-Hyg-N1 plasmid (BD Biosciences-Clontech, Mountain View, Calif.)." (see more) | × | |||||
88 / 100 Bioz Stars | PLVX-EF1α-DsRed-monomer-N1 BioVector NTCC ![]() | star_border | Visit Supplier | |||
Article Snippets ".. primers: 5′-GGGAGACCCAAGCTGGCTAGC ATGGACAACACCGAGGACGTCAT3′, reverse: 5′-GTTTTCATTGACCATGGTACC CTGGGAGCCGGAGTGGCG from pLVX-EF1α-DsRed-monomer-N1 (Biovector NTCC Inc., Beijing, China)." (see more) | × | |||||
85 / 100 Bioz Stars | PDsRed-monomer-Hyg-N1 Becton Dickinson / BD Biosciences ![]() | star_border | Visit Supplier | |||
Article Snippets "Abstract: Results: The novel MPZ mutation, c.367G A, is associated with a late-onset demyelinating CMT phenotype with autosomal dominant inheritance.. The median motor nerve conduction velocities of patients in this family ranged from 15.7 to ..." (see more) | × | |||||