90
|
Bruker Corporation
apex duo 4k ccd diffractometer Apex Duo 4k Ccd Diffractometer, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/apex duo 4k ccd diffractometer/product/Bruker Corporation Average 90 stars, based on 1 article reviews
apex duo 4k ccd diffractometer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
HiMedia Laboratories
rappaport vassiliadis soybean meal broth Rappaport Vassiliadis Soybean Meal Broth, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rappaport vassiliadis soybean meal broth/product/HiMedia Laboratories Average 90 stars, based on 1 article reviews
rappaport vassiliadis soybean meal broth - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
N/A
N/A
|
strong MicroRNA hsa miR 520f 5p strong Accession Number MIMAT0026609 Mature Sequence CCUCUAAAGGGAAGCGCUUUCU hsa miR 520f 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
N/A
|
Boster Bio Anti-SMYD4 Monoclonal Antibody catalog # M14482. Tested in ELISA, WB applications. This antibody reacts with Human.
|
Buy from Supplier |
N/A
|
strong MicroRNA hsa miR 556 5p strong Accession Number MIMAT0003220 Mature Sequence GAUGAGCUCAUUGUAAUAUGAG hsa miR 556 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
N/A
|
Recombinant Mouse GM14482 full length or partial length protein was expressed http www creativebiomart net Recombinant Mouse GM14482 Protein 442092 htm
|
Buy from Supplier |
N/A
|
Gm14486 CRISPRa kit CRISPR gene activation of mouse predicted gene 14486
|
Buy from Supplier |
N/A
|
Gm14486 Mouse 3 unique 27mer siRNA duplexes 2 nmol each
|
Buy from Supplier |