M08452 Search Results


90
Labscientific non-fat milk
Non Fat Milk, supplied by Labscientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non-fat milk/product/Labscientific
Average 90 stars, based on 1 article reviews
non-fat milk - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

92
Boster Bio murine anti sars cov 2 np
Murine Anti Sars Cov 2 Np, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/murine anti sars cov 2 np/product/Boster Bio
Average 92 stars, based on 1 article reviews
murine anti sars cov 2 np - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

N/A
The Cullin 3 Antibody (1A3) from Novus is a Cullin 3 antibody to Cullin 3. This antibody reacts with Human. The Cullin 3 antibody has been validated for the following applications: Western Blot, ELISA, Sandwich
  Buy from Supplier

N/A
Cd34 rat monoclonal antibody clone MEC 14 7 Purified
  Buy from Supplier

N/A
Boster Bio POLA2 mouse monoclonal antibody, clone OTI3F2 (formerly 3F2). Catalog# M08427. Tested in WB. This antibody reacts with Human.
  Buy from Supplier




N/A
Boster Bio Anti-SARS-CoV-2 Reference Antibody (Adintrevimab) (Catalog # M08425-1). Tested in Flow Cytometry, ELISA, FTA. This antibody reacts with Human. Endotoxin: < 0.1052EU/μg,determined by LAL method. Expression system: CHO Cell
  Buy from Supplier


N/A
strong MicroRNA hsa miR 6828 5p strong Accession Number MIMAT0027556 Mature Sequence AGGAAGCAAGAGAACCCUGUGG hsa miR 6828 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
  Buy from Supplier

N/A
ICAM1 mouse monoclonal antibody clone 3H1547 Purified
  Buy from Supplier

Image Search Results