7900ht pcr machine Search Results


7900ht fast real time pcr machine  (Quanta Biosciences)
97
Quanta Biosciences 7900ht fast real time pcr machine
7900ht Fast Real Time Pcr Machine, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7900ht+pcr+machine/PerfeCTa+SYBR+Green+FastMix/pmc04835552-184-11-22
Average 97 stars, based on 1 article reviews
7900ht fast real time pcr machine - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
real time 7900ht pcr machine  (Thermo Fisher)
99
Thermo Fisher real time 7900ht pcr machine
Real Time 7900ht Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7900ht+pcr+machine/SUCROSE+EP%2FBP%2FNF+12KG/pmc04267650-54-16-15
Average 99 stars, based on 1 article reviews
real time 7900ht pcr machine - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer  (Cell Signaling Technology Inc)
96
Cell Signaling Technology Inc tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Tgtagaccatgtagttgaggtca 7900 Ht Fast Real Time Pcr Machine 2 2 Sulf2 Protein Expression Analysis Protein Lysis Buffer, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/7900ht+pcr+machine/(10X)/pmc06059806-38-19-40
Average 96 stars, based on 1 article reviews
tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


There is an absence of Sulf2 mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).

Journal: Methods in molecular biology (Clifton, N.J.)

Article Title: Measuring sulfatase expression and invasion in glioblastoma

doi: 10.1007/978-1-4939-1714-3_39

Figure Lengend Snippet: There is an absence of Sulf2 mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).

Article Snippet: Human GAPDH forward primer: CGACAGTCAGCCGCATCTT Human GAPDH reverse primer: CCGTTGACTCCGACCTTCA Mouse GAPDH forward primer: AGGTCGGTGTGAACGGATTTG Mouse GAPDH reverse primer: TGTAGACCATGTAGTTGAGGTCA 7900 HT Fast Real Time PCR machine 2.2 SULF2 protein expression analysis Protein lysis buffer: 1x of 10X Lysis buffer (Cell Signaling Technology, Boston, MA), 1x of 100x Protease Inhibitor Cocktail (Sigma Chemical Company, St. Louis, MO, USA), and 1x of 100X HaltTM Phosphatase Inhibitor Single-Use Cocktail (Thermo Fisher Scientific Inc, Waltham, MA) in milli-Q water.

Techniques: Expressing, Isolation, Quantitative Proteomics, shRNA, Knockdown, Control, High Molecular Weight, Construct