β2-ar Search Results


β2 ar  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology β2 ar
β2 Ar, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR/pm30635471-43-27-30
Average 93 stars, based on 1 article reviews
β2 ar - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
anti β 2 ar  (Santa Cruz Biotechnology)
94
Santa Cruz Biotechnology anti β 2 ar
Anti β 2 Ar, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+Antibody/pmc05940012-570-16-19
Average 94 stars, based on 1 article reviews
anti β 2 ar - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
exon1 172 bp intron1 225 bp exon2 125 bp  (Addgene inc)
93
Addgene inc exon1 172 bp intron1 225 bp exon2 125 bp
Exon1 172 Bp Intron1 225 Bp Exon2 125 Bp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/pAAV-gLuc+sp-NanoLuc-HA-%CE%B22AR-NNES-AsLOV2(V416L)+(Plasmid+%23125225)/pm40263328-494-7-25
Average 93 stars, based on 1 article reviews
exon1 172 bp intron1 225 bp exon2 125 bp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
β 2 ar crispr cas9 ko plasmid  (Santa Cruz Biotechnology)
90
Santa Cruz Biotechnology β 2 ar crispr cas9 ko plasmid
β 2 Ar Crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+CRISPR%2FCas9+KO+Plasmid/pmc06763436-215-0-6
Average 90 stars, based on 1 article reviews
β 2 ar crispr cas9 ko plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nontarget control shrna lentiviral particles  (Santa Cruz Biotechnology)
86
Santa Cruz Biotechnology nontarget control shrna lentiviral particles
Nontarget Control Shrna Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+shRNA+(m)+Lentiviral+Particles/pmc04626766-141-3-11
Average 86 stars, based on 1 article reviews
nontarget control shrna lentiviral particles - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
β 2 ar hdr plasmid  (Santa Cruz Biotechnology)
90
Santa Cruz Biotechnology β 2 ar hdr plasmid
β 2 Ar Hdr Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+HDR+Plasmid/pmc06763436-215-14-19
Average 90 stars, based on 1 article reviews
β 2 ar hdr plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
beta2 adrenergic receptor  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology beta2 adrenergic receptor
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
Beta2 Adrenergic Receptor, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+siRNA/pmc05904831-53-4-15
Average 93 stars, based on 1 article reviews
beta2 adrenergic receptor - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
cmv egfp p2a ha β2ar utev1δ  (Addgene inc)
93
Addgene inc cmv egfp p2a ha β2ar utev1δ
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
Cmv Egfp P2a Ha β2ar Utev1δ, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/CMV%3AeGFP-p2A-HA-%CE%B22Ar-uTEV1%CE%94(220-242)+(Plasmid+%23135459)/pmc09715671-331-0-10
Average 93 stars, based on 1 article reviews
cmv egfp p2a ha β2ar utev1δ - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
b2m shrna lentiviral particles  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology b2m shrna lentiviral particles
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
B2m Shrna Lentiviral Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22-AR+shRNA+(h)+Lentiviral+Particles/bio_rxiv__521831-226-31-35
Average 93 stars, based on 1 article reviews
b2m shrna lentiviral particles - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
rabbit anti- β 2 -ar  (Assay Designs Inc)
90
Assay Designs Inc rabbit anti- β 2 -ar
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
Rabbit Anti β 2 Ar, supplied by Assay Designs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/rabbit+anti++%CE%B2+2++ar/pmc09869975-95-11-16
Average 90 stars, based on 1 article reviews
rabbit anti- β 2 -ar - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
β2ar nb.c203  (ActiveState Software Inc)
90
ActiveState Software Inc β2ar nb.c203
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
β2ar Nb.C203, supplied by ActiveState Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B22ar+nb+c203/pm38672440-256-16-17
Average 90 stars, based on 1 article reviews
β2ar nb.c203 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
β 2 ar: 5′ccttcttgctggcaccccat3′ sense 5′ggaagtccaaaactcgcacca3′ antisense  (Biolegio bv)
90
Biolegio bv β 2 ar: 5′ccttcttgctggcaccccat3′ sense 5′ggaagtccaaaactcgcacca3′ antisense
Comparative time-course of changes in intraocular pressure in response to <t>beta2</t> adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).
β 2 Ar: 5′Ccttcttgctggcaccccat3′ Sense 5′Ggaagtccaaaactcgcacca3′ Antisense, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B22-ar/%CE%B2+2+ar++5+ccttcttgctggcaccccat3++sense+5+ggaagtccaaaactcgcacca3++antisense/pmc01573801-139-61-49
Average 90 stars, based on 1 article reviews
β 2 ar: 5′ccttcttgctggcaccccat3′ sense 5′ggaagtccaaaactcgcacca3′ antisense - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Comparative time-course of changes in intraocular pressure in response to beta2 adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).

Journal: Journal of Optometry

Article Title: Beta2 adrenergic receptor silencing change intraocular pressure in New Zealand rabbits

doi: 10.1016/j.optom.2017.08.002

Figure Lengend Snippet: Comparative time-course of changes in intraocular pressure in response to beta2 adrenergic receptor siRNA and scramble siRNA. Effects of scramble siRNA (filled circles) and beta2 adrenergic receptor siRNA (open circles) on intraocular pressure were followed for 216 h. 100% represents the intraocular pressure before the application of siRNAs which corresponded to a IOP of 15.2 ± 1.8 mm Hg. Values represent the mean ± S.E.M. ( n = 8).

Article Snippet: A siRNA targeting the beta2 adrenergic receptor (sc-39866) and siRNA scramble (sc-37007) were purchased from Santa Cruz (Hercules, CA, USA).

Techniques:

Maximal IOP reduction elicited by siRNA against the beta2 adrenergic receptor and anti-glaucomatous drugs. Maximal IOP reduction (% of control) for beta2 adrenergic receptor siRNA tested (250 μg) was compared with the hypotensive action induced by Xalatan, Trusopt and Timoftol. Control (100%) represents the intraocular pressure before the application of any drug (15.2 ± 1.8 mm Hg). Values represent the mean ± S.E.M. ( n = 8).

Journal: Journal of Optometry

Article Title: Beta2 adrenergic receptor silencing change intraocular pressure in New Zealand rabbits

doi: 10.1016/j.optom.2017.08.002

Figure Lengend Snippet: Maximal IOP reduction elicited by siRNA against the beta2 adrenergic receptor and anti-glaucomatous drugs. Maximal IOP reduction (% of control) for beta2 adrenergic receptor siRNA tested (250 μg) was compared with the hypotensive action induced by Xalatan, Trusopt and Timoftol. Control (100%) represents the intraocular pressure before the application of any drug (15.2 ± 1.8 mm Hg). Values represent the mean ± S.E.M. ( n = 8).

Article Snippet: A siRNA targeting the beta2 adrenergic receptor (sc-39866) and siRNA scramble (sc-37007) were purchased from Santa Cruz (Hercules, CA, USA).

Techniques: Control