93
|
Larodan
vitamin e Vitamin E, supplied by Larodan, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vitamin e/product/Larodan Average 93 stars, based on 1 article reviews
vitamin e - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
93
|
Toronto Research Chemicals
α tocopherol d6 α Tocopherol D6, supplied by Toronto Research Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α tocopherol d6/product/Toronto Research Chemicals Average 93 stars, based on 1 article reviews
α tocopherol d6 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
93
|
Selleck Chemicals
α tocopherol α Tocopherol, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α tocopherol/product/Selleck Chemicals Average 93 stars, based on 1 article reviews
α tocopherol - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
91
|
Santa Cruz Biotechnology
α tocopherol α Tocopherol, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α tocopherol/product/Santa Cruz Biotechnology Average 91 stars, based on 1 article reviews
α tocopherol - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
91
|
ChromaDex
tocopherol Tocopherol, supplied by ChromaDex, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tocopherol/product/ChromaDex Average 91 stars, based on 1 article reviews
tocopherol - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
90
|
Valiant Co Ltd
dl α tocopherol Dl α Tocopherol, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dl α tocopherol/product/Valiant Co Ltd Average 90 stars, based on 1 article reviews
dl α tocopherol - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
93
|
Thermo Fisher
gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2 Gut Integrity Muc2 Forward Xm 421035 55 Gctacaggatctgcctttgc Muc2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2/product/Thermo Fisher Average 93 stars, based on 1 article reviews
gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
90
|
Santa Cruz Biotechnology
dl α tocopherol Dl α Tocopherol, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dl α tocopherol/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
dl α tocopherol - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Cerilliant Corporation
p 010 1ml  P 010 1ml, supplied by Cerilliant Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p 010 1ml/product/Cerilliant Corporation Average 90 stars, based on 1 article reviews
p 010 1ml - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
94
|
Valiant Co Ltd
α tocopherol acetate α Tocopherol Acetate, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α tocopherol acetate/product/Valiant Co Ltd Average 94 stars, based on 1 article reviews
α tocopherol acetate - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
91
|
BOC Sciences
α tocopherol α Tocopherol, supplied by BOC Sciences, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α tocopherol/product/BOC Sciences Average 91 stars, based on 1 article reviews
α tocopherol - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Methods and Protocols
Article Title: Method of Microglial DNA-RNA Purification from a Single Brain of an Adult Mouse
doi: 10.3390/mps4040086
Figure Lengend Snippet: Detailed information of materials.
Article Snippet: Pentobarbital (1 mg/mL in 1 mL methanol) ,
Techniques: Protease Inhibitor, Cell Culture, Cell Counting, Staining, Modification, Software