Journal: bioRxiv

Article Title: The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes

doi: 10.1101/2020.11.23.391771

Figure Lengend Snippet: (A) Transcription factor screen overview. Day −1: CRISPR TF library transduction to growing ESCs. Day 0: Zeocin selection begins. Day 5, 8, and 12: collection days and representation analysis. (B) Shannon’s diversity index (H) calculated based on the proportion of individual sgRNAs (pi) in the total number of sgRNAs in the pool (S) for each time point with sgRNA counts. The diversity score decreases as essential, and pluripotency targeting sgRNAs are lost from the population. (C) Log2 fold change of targeting sgRNAs on day 12 compared to the initial library representation. sgRNAs depleted more than the 50 th most depleted non-targeting sgRNA are in orange and enriched more than the 50 th most enriched non-targeting sgRNA are in blue. (D) The number of TF library sgRNAs depleted and mean sgRNAs number with random depletion calculated by 1000 permutation tests for the different number of sgRNA per gene. TFs with more than or equal to 6 depleted sgRNAs are unlikely to be false positives. (E) Venn diagram representation of the number of depleted TFs identified by three different methods: Log-fold change, linear modeling, and MAGeCK. 196 genes were picked as high confidence depleted TFs by all methods. (F) The workflow of secondary screen based on the Oct4::tdTomato Sox2::Gfp pluripotency reporter ESC line. Pluripotent ESCs are depicted as yellow while differentiating cells lose one or both reporter expression. (G) Percentage of cells expressing fluorescent reporters when transfected with a single sgRNA that is either non-targeting, targeting a known pluripotency TF, or candidate TF. 80% of cells infected with non-targeting sgRNA express both reporters. This number decreases in cells infected with sgRNAs targeting known pluripotency TFs and Zbtb10, Zbtb11 , and Zfp131 .

Article Snippet: The cDNA of Zbtb10 was amplified from Origene (MR214195L4) Zbtb10 mouse tagged ORF clone using Zbtb10-fwd (5’ ATGTCGTTCAGTGAGATGAACCG) and Zbtb10-rvs primer (5’ TCCAGAGACATAAACGCCTCC).

Techniques: CRISPR, Transduction, Selection, Expressing, Transfection, Infection

Journal: bioRxiv

Article Title: The BTB transcription factors ZBTB11 and ZFP131 maintain pluripotency by pausing POL II at pro-differentiation genes

doi: 10.1101/2020.11.23.391771

Figure Lengend Snippet: (A) Zbtb10Δ, Zbtb11Δ and Zfp131Δ colony morphology in +2i+LIF and −2i+LIF conditions 3d after doxycycline removal. Zbtb11Δ and Zfp131Δ cells lose typical ESC colony formation ability and adopt morphologies associated with differentiation. Scale bar = 200 μm. (B) Volcano plots of log2 fold change of transcripts expressed in Zbtb10Δ, Zbtb11Δ , and Zfp131Δ cells versus wildtype (wt) cells grown in the absence of doxycycline for 3d in −2i+LIF media (n=2). Significant changes (* p<0.05) marked in color for each genotype. Zbtb11 and Zfp131 mutations in ESCs induce aberrant gene expression. (C) Hierarchical clustering of transcriptomes of wildtype, Zbtb10Δ, Zbtb11Δ , and Zfp131Δ cells grown in the absence of doxycycline for 3d in −2i+LIF and +2i+LIF media. R1 and R2 denote two different replicates. Zbtb11Δ and Zfp131Δ cells have enough transcriptomic differences to cluster away from control and Zbtb10Δ cells in both culture conditions. (D) Principle component analysis of transcriptomes of wildtype, Zbtb10Δ, Zbtb11Δ , and Zfp131Δ cells grown in the absence of doxycycline for 3d in −2i+LIF and +2i+LIF media (n=2). Individual circles and triangles represent a single replicate. Zbtb11 and Zfp131 mutations induce profound transcriptomic changes separating mutant cells from wt and Zbtb10 mutant cells along PC1. (E) GO-enrichment analysis of significantly upregulated genes in Zbtb11Δ (531) and (F) Zfp131Δ (839). Zbtb11 and Zfp131 mutations induce ESCs to express genes with a strong developmental signature.

Article Snippet: The cDNA of Zbtb10 was amplified from Origene (MR214195L4) Zbtb10 mouse tagged ORF clone using Zbtb10-fwd (5’ ATGTCGTTCAGTGAGATGAACCG) and Zbtb10-rvs primer (5’ TCCAGAGACATAAACGCCTCC).

Techniques: Gene Expression, Control, Mutagenesis

Journal: BMC gastroenterology

Article Title: ZBTB10 as a potential prognosis biomarker and correlates with the tumor immune microenvironment in stomach adenocarcinoma.

doi: 10.1186/s12876-025-04047-y

Figure Lengend Snippet: Fig. 3 The clinical characteristics of ZBTB10 expression in STAD tissues. Box-plot showing the ZBTB10 mRNA median expression level correlated with tumor grade (A), pathological stages (B), lymph node metastases (C), patient’s ages(D), TP53 mutation status (E), and H.pylori infection status (F) respectively. The median expression of ZBTB10 was analyzed using the Mann–Whitney U test for two-group comparisons and the Kruskal–Wallis (K-W) test for multiple independent groups respectively. *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: The membranes were then blocked with 5% non-fat milk at room temperature for 1 h, followed by incubation with primary antibodies against ZBTB10 (1:1000, Proteintech, China) and GAPDH (1:1000, Abcam) overnight at 4 °C.

Techniques: Expressing, Mutagenesis, Infection, MANN-WHITNEY

Journal: BMC gastroenterology

Article Title: ZBTB10 as a potential prognosis biomarker and correlates with the tumor immune microenvironment in stomach adenocarcinoma.

doi: 10.1186/s12876-025-04047-y

Figure Lengend Snippet: Fig. 6 Correlation of ZBTB10 expression with immune characteristics. (A) Radar map displayed the association between ZBTB10 median expression and tumor mutational burden (TMB). (B) The radar map displayed the association between ZBTB10 median expression and microsatellite instability (MSI). (C) Comparison of immune score and stromal score based on ZBTB10 median expression. (D) 22 types of tumor-infiltrating immune cells were analyzed based on ZBTB10 median expression using the CIBERSORT algorithm. *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: The membranes were then blocked with 5% non-fat milk at room temperature for 1 h, followed by incubation with primary antibodies against ZBTB10 (1:1000, Proteintech, China) and GAPDH (1:1000, Abcam) overnight at 4 °C.

Techniques: Expressing, Comparison

Journal: BMC gastroenterology

Article Title: ZBTB10 as a potential prognosis biomarker and correlates with the tumor immune microenvironment in stomach adenocarcinoma.

doi: 10.1186/s12876-025-04047-y

Figure Lengend Snippet: Fig. 7 The association of ZBTB10 expression with tumor immune microenvironment. (A) ZBTB10 median expression correlated with tumor-infiltrating lymphocytes. (B) ZBTB10 median expression correlated with immune stimulators. (C) ZBTB10 median expression correlated with immune inhibitors. (D) The correlation analysis of the top four targeting immunosuppressive and immuneactivative markers with ZBTB10 median expression in STAD. *P < 0.05, **P < 0.01, ***P < 0.001

Article Snippet: The membranes were then blocked with 5% non-fat milk at room temperature for 1 h, followed by incubation with primary antibodies against ZBTB10 (1:1000, Proteintech, China) and GAPDH (1:1000, Abcam) overnight at 4 °C.

Techniques: Expressing

Journal: BMC gastroenterology

Article Title: ZBTB10 as a potential prognosis biomarker and correlates with the tumor immune microenvironment in stomach adenocarcinoma.

doi: 10.1186/s12876-025-04047-y

Figure Lengend Snippet: Fig. 10 Multiplex immunohistochemistry (mIHC) staining for identification. Representative mIHC images of STAD tissues and adjacent normal tissues, a staining panel was developed to visualize CD45, EpCAM, ZBTB10 and DAPI simultaneously. CD45: leukocyte marker. EpCAM: epithelial cell marker. Scale bar 200 µm

Article Snippet: The membranes were then blocked with 5% non-fat milk at room temperature for 1 h, followed by incubation with primary antibodies against ZBTB10 (1:1000, Proteintech, China) and GAPDH (1:1000, Abcam) overnight at 4 °C.

Techniques: Multiplex Assay, Immunohistochemistry, Staining, Marker

Journal: FEBS Open Bio

Article Title: CFTR interacts with Hsp90 and regulates the phosphorylation of AKT and ERK1/2 in colorectal cancer cells

doi: 10.1002/2211-5463.12641

Figure Lengend Snippet: Knockdown of CFTR. (A) Western blot analysis of the effects of shRNA on CFTR expression in Caco2 and HRT18 cells. Actin was used as a loading control. Quantification of western blotting results is shown in the bottom panel. Data were expressed as means ± standard deviations. Differences in measured variables between two groups were analyzed using Student's t ‐tests. ** P < 0.01 ( n = 3). (B) Immunofluorescence staining of CFTR in Caco2 shRNAnc and Cacao2 shRNAcftr cells. Scale bar = 20 μm.

Article Snippet: Lentiviral transduction particles encoding short hairpin RNA (shRNA) against CFTR were purchased from Jima Inc. (Shanghai, China).

Techniques: Knockdown, Western Blot, shRNA, Expressing, Control, Immunofluorescence, Staining