Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 2. Endothelial Ybx1 deletion impairs CD31hiEMCNhi endothelium formation and bone formation. (A and B) RT-qPCR analysis of Ybx1 expression in CD31hiEMCNhi ECs (A) and BMSCs (B) from EC-specific Ybx1-knockout female mice (Ybx1iΔEC) and their littermate controls (Ybx1fl/fl). (C) FACS analysis dot plot of CD31hiEMCNhi ECs in each group. (D) Quantification of type H (left) and L (right) ECs from in each group. (E and F) Representative images (E) and quantitation (F) of CD31 (green) and EMCN (red) immunostained, 4-week-old Ybx1iΔEC and Ybx1fl/fl femora. (G) ELISA analysis of estradiol levels in each group. (H) Representative images (left) and quantitation (right) of VEGFA (red) immunostained in each group. (I and J) Representative μCT imag- es (I) and quantitative μCT analysis (J) of trabecular bone microarchitecture of 4-week-old Ybx1iΔEC and Ybx1fl/fl mice. (K) Representative images (left) and quantitation (right) of Osterix+ (green) immunostained in each group. (L) Representative images (left) and quantitation (right) of COL1 (green)

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Quantitative RT-PCR, Expressing, Knock-Out, Quantitation Assay, Enzyme-linked Immunosorbent Assay

Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 4. YBX1 depletion leads to decreasing CD31 and EMCN stability in an m5C-dependent manner. (A) Genomic distribution of YBX1 CLIP-Seq peaks. (B) Venn diagram representing the overlap genes between YBX1 CLIP-Seq targets and YBX1-knockdown RNA-Seq targets. (C) Top 2 ranked sequence motifs enriched in YBX1 CLIP-Seq. (D–F) Genomic view of YBX1 binding to CD31, EMCN, and BMP4 loci. The frame area is 3′-UTR. (G) Semiquantitative PCR showed RBP immunoprecipitates using m5C RIP kit. (H and I) RNA pulldown analysis of binding between YBX1 protein and CD31 (or BMP4)–WT (or MUT)–probe. (J) Relative luciferase activity of HEK293T cells transfected with different pGL-4 vectors and pCMV-YBX1. (K–M) RT-qPCR analysis of the BMP4, CD31, and EMCN mRNA degradation rate of HUVECs treated with shYBX1 (blue lines) or shControl (red lines). (N) Western blotting analysis of the relative levels of CD31, BMP4, EMCN, and YBX1 protein expression. n = 3 independent experiments. Data are shown as the mean ± SEM. ***P < 0.001 by 1-way ANOVA. CDS, coding sequences.

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Knockdown, RNA Sequencing, Sequencing, Binding Assay, Luciferase, Activity Assay, Transfection, Quantitative RT-PCR, Western Blot, Expressing

Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 7. PEG-PLGA nanoparticles carrying sciadopitysin enhance angiogenesis-dependent bone formation in aged female mice. (A) Schematic diagram of treating aged female mice with sciadopitysin. (B and C) FACS analysis dot plot (B) and quantification (C) of CD31hiEMCNhi ECs from femora and tibia. (D) Western blotting analysis of YBX1 in CD31hiEMCNhi ECs (upper) and BMSCs (lower) from aged female mice injected with vehicle (PEG-PLGA nanoparticles) and PEG-PLGA nanoparticles carrying sciadopitysin (CD31 modified). (E and F) Representative μCT images (E) and quantitative μCT analysis (F) of trabecular bone microarchitecture of femora. (G and H) Representative images (G) and quantification (H) of calcein double labeling in femora. Scale bar 50 μm. (I–N) Representative images and quantification of H&E staining (I and J), Ocn staining (K and L), and TRAP staining (M and N) in trabecular bone surfaces. Scale bar 100 μm and 50 μm. (O and P) Representative images (O) and quantitation (P) of CD31 (green) and EMCN (red) immunostaining of tibia. (Q and R) Repre- sentative images (Q) and quantitation (R) of VEGFA-immunostained (green) tibia. (S and T) Representative images (S) and quantitation (T) of BMP4-immu- nostained (red) tibia. Femora and tibia were obtained from aged female mice injected with vehicle (PEG-PLGA nanoparticles) and PEG-PLGA nanoparticles carrying sciadopitysin (CD31 modified). Scale bar 100 μm. n = 7 mice in each group. n = 2 independent experiments. Data are shown as the mean ± SEM. **P < 0.01; ***P < 0.001 by Student’s t test.

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Western Blot, Injection, Modification, Labeling, Staining, Quantitation Assay, Immunostaining

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Protein levels of YBX1 in 10 different types of tumors from the CPTAC database. B mRNA levels of YBX1 in 21 different types of tumors from the TCGA database. C–G Enrichment functional analysis of proteins interacting with YBX1 in ccRCC cell line 786-O through Co-IP pull-down and identified by mass spectrometry. C Mass spectrometry identification schematic. D Gene Ontology Biological Process (GO-BP) enrichment. E KEGG pathway enrichment. F UniPort annotation keywords. G Wiki Pathways enrichment analysis. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A and B. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Functional Assay, Co-Immunoprecipitation Assay, Mass Spectrometry

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Western blot validation of YBX1 protein expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. B qRT-PCR validation of YBX1 mRNA expression upon knockdown and overexpression efficiency in ACHN and 786-O cells. C Lactate production upon YBX1 knockdown in ACHN and 786-O cells. D ATP production detection upon YBX1 knockdown in ACHN and 786-O cells. E Real-time monitoring of extracellular acidification rate (ECAR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. F Quantitative analysis of glycolytic capacity and glycolytic reserve. G Real-time monitoring of oxygen consumption rate (OCR) in ACHN and 786-O cells after YBX1 knockdown, measured using a Seahorse Bioscience Analyzer. H Quantitative analysis of mitochondrial respiratory capacity and respiratory reserve. I Lactate dehydrogenase (LDH) activity detection upon YBX1 knockdown and overexpression in ACHN and 786-O cells. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in B – D , F , H and I . Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Western Blot, Biomarker Discovery, Expressing, Knockdown, Over Expression, Quantitative RT-PCR, Activity Assay

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A , B Effects of YBX1 overexpression on the proliferation of ACHN and 786-O cells. A Colony formation assay. B CCK-8 cell proliferation assay. C, D Effects of YBX1 overexpression on the migration and invasion of ACHN and 786-O cells. C Transwell cell migration assay. D Transwell cell invasion assay. E Detection of bioluminescence intensity of 8 pairs of tumors in nude mice using an in vivo imaging system. F Quantification analysis of bioluminescence intensity at the site of renal orthotopic tumors. G Statistical analysis of in situ tumor weight, expressed as the weight of the left minus the corresponding right kidney of nude mice. H Immunohistochemical staining and quantification to detect protein expression of YBX1, LDHA and Ki-67 in tumor tissues from control and YBX1 knockdown groups in nude mice. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , C , D , F , G and H . Two-way ANOVA with correction for multiple comparisons in B. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Over Expression, Colony Assay, CCK-8 Assay, Proliferation Assay, Migration, Cell Migration Assay, Invasion Assay, In Vivo Imaging, In Situ, Immunohistochemical staining, Staining, Expressing, Control, Knockdown

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A, B Protein expression levels of YBX1 ( A ) and LDHA ( B ) in ccRCC from the CPTAC database. C, D Correlation of gene expression between YBX1 and LDHA in ccRCC from the TCGA database ( C ) and in an Asian population ( D ). E Western blot analysis of YBX1 and LDHA protein expression in tumor (T) and paired adjacent non-tumor (P) tissues from 27 ccRCC patients, showing representative images from 4 pairs of tissues. F Quantification of YBX1 and LDHA proteins in ccRCC and adjacent non-cancerous tissues from 27 cases using Image J software, normalized to β-actin. G Correlation of YBX1 and LDHA protein expression in tumor tissues from 27 ccRCC patients. H-M Immunohistochemical staining to assess the expression of YBX1 and LDHA in 63 pairs of ccRCC and adjacent tissues. H, I Representative immunohistochemical staining images and quantification of IHC staining using Image J software. J Correlation of quantified immunohistochemical staining of YBX1 and LDHA in tumor tissues of 63 ccRCC patients. K-M Levels of YBX1 and LDHA in ccRCC patients stratified by tumor size, T stage and Fuhrman grade. N , O Impact of YBX1 expression on overall survival (OS) ( N ) and recurrence free survival (RFS) ( O ) in ccRCC patients from the TCGA database. ** P < 0.01, *** P < 0.001, **** P < 0.0001. Unpaired two-sided Student’s t -test in A , B , K , L and M . Spearman correlation statistics in C , D , G and J . Paired t -test in F and I. Log-rank test in N and O. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Expressing, Gene Expression, Western Blot, Software, Immunohistochemical staining, Staining, Immunohistochemistry

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Identification of LDHA as a potential YBX1-interacting protein by IP/MS analysis. B Protein-protein interaction (PPI) network diagram of YBX1 and LDHA from the GeneMANIA and STRING databases. C Co-IP assay to verify the YBX1-LDHA interaction in ccRCC cell lines. D Immunofluorescence staining to examine the expression of YBX1 and LDHA in ACHN and 786-O cell lines, with confocal microscopy used to observe the co-localization of YBX1 and LDHA. E Molecular docking analysis of the YBX1-LDHA interaction. F Schematic diagram of GFP-tagged YBX1 structural domain peptide fragments. G 786-O cells transfected with GFP-tagged YBX1 or its truncation mutants for 48 h, followed by Co-IP using anti-GFP antibody. H Schematic representation of Flag-tagged LDHA domain protein peptides. I 786-O cells transfected with Flag-tagged LDHA or its truncation mutants for 48 h, followed by Co-IP using anti-Flag antibody. J Assessment of the impact on LDH activity after transfecting YBX1 or its truncated mutants into 786-O cells for 48 h. ** P < 0.01, **** P < 0.0001, ns: no significant difference. One-way ANOVA with correction for multiple comparisons in J. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Protein-Protein interactions, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Expressing, Confocal Microscopy, Transfection, Activity Assay

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A qRT-PCR analysis of LDHA mRNA expression levels in ACHN and 786-O cells following YBX1 knockdown and overexpression. B CUT&Tag peak plots and heatmap showing YBX1 binding intensity in ACHN cells. C Pie chart showing the distribution of YBX1 binding regions. D IGV plot showing the occupancy of YBX1 in the LDHA promoter region. E Motif diagram of YBX1 binding sequences from the JASPAR database. F Molecular docking analysis of YBX1 with four predicted binding sites (BS) in the LDHA promoter sequence. G The LDHA promoter sequence was divided into 3 fragments containing the predicted BS, followed by primer design and ChIP-qPCR to verify YBX1 binding to the LDHA promoter region. H The LDHA promoter sequence was divided into 4 fragments, and the BS-1 site that was mainly bound was mutated, the luciferase-tagged truncated plasmids were designed. After co-transfection of the target and control Renilla plasmids into ccRCC cells, YBX1 binding to the LDHA promoter region was verified using dual-luciferase reporter assays. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in A, G and H. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Quantitative RT-PCR, Expressing, Knockdown, Over Expression, Binding Assay, Sequencing, ChIP-qPCR, Luciferase, Cotransfection, Control

Journal: Cell Death & Disease

Article Title: YBX1 orchestrates LDHA-mediated metabolic reprogramming and NF-κB activation to drive clear cell renal cell carcinoma progression

doi: 10.1038/s41419-025-08261-0

Figure Lengend Snippet: A Western blot analysis of LDHA protein expression levels in ACHN and 786-O cells after YBX1 knockdown and overexpression. B Dual-luciferase reporter assays evaluating the effects of YBX1 and LDHA on glycolysis-related signaling pathways in ccRCC cells co-transfected with target plasmids and control Renilla plasmids. C Western blot analysis of p-p65 (Ser536) and total p65 expression after overexpression of YBX1 and LDHA. D Immunohistochemical staining to detect protein expression of total p65 and p-p65 (Ser536) in tumor tissues from control and YBX1 knockdown groups in nude mice. Representative images and quantification. E, F Western blot ( E ) and qRT-PCR ( F ) analysis of LDHA knockdown efficiency in 786-O cells 72 h post-transfection with si- LDHA . G , H Western blot ( G ) and LDH activity ( H ) analysis of LDHA inhibition in 786-O cells treated with Oxamate (0-80 mM for 48 h). I , J Western blot analysis of p-p65 (Ser536) and total p65 in YBX1-overexpressing cells following LDHA knockdown ( I ) or Oxamate treatment (60 mM for 48 h) ( J ). K-N Lactate production ( K, L ) and cell proliferation ( M , N ) assays in YBX1-overexpressing cells after LDHA knockdown or Oxamate treatment. O Schematic diagram illustrating the YBX1-LDHA-NF-κB mechanism in ccRCC progression. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns: no significant difference. Unpaired two-sided Student’s t -test in B , D , F and H . One-way ANOVA with correction for multiple comparisons in K and L. Two-way ANOVA with correction for multiple comparisons in M and N. Data are presented as mean ± SD.

Article Snippet: After removing the supernatant, 50 μL of Antibody Buffer was added to resuspend the beads-bound cells, followed by the addition of 1 μg of YBX1 antibody (Proteintech, USA) and Rabbit IgG (Cell Signaling Technology, USA), and left to stand overnight at 4 °C.

Techniques: Western Blot, Expressing, Knockdown, Over Expression, Luciferase, Protein-Protein interactions, Transfection, Control, Immunohistochemical staining, Staining, Quantitative RT-PCR, Activity Assay, Inhibition

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 enhances migration and invasion in HCC cells. A. Immunoblotting analysis of YB1, E‐cadherin, N‐cadherin, and ZEB1 in HCCLM3 and MHCC97H cells stably expressing YB1 shRNAs. Vinculin was used as a loading control. B. Immunoblotting analysis of YB1, E‐cadherin, N‐cadherin, and ZEB1 in BEL7402 and SMMC7721 cells stably overexpressing YB1. Vinculin and GAPDH was used as a loading control. C‐D. The cell migration ability was detected with wound healing assay in MHCC97H cells stably expressing YB1 shRNAs (C) and SMMC7721 cells stably overexpressing YB1 (D; magnification, ×100; Scale bar, 100 μm). E‐F. The cell invasion ability was detected with Transwell plates in MHCC97H cells stably expressing YB1 shRNAs (E) and SMMC7721 cells stably overexpressing YB1 (F; magnification, ×100; Scale bar, 100 μm). The most representative results of three independent biological experiments were shown. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001, significant

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Migration, Western Blot, Stable Transfection, Expressing, Control, Wound Healing Assay

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 regulates miR‐205/200b‒ ZEB1 axis by inhibiting miRNA expression. A‐B. The expression levels of miR‐205 and miR‐200b were analyzed in HCCLM3 and MHCC97H cells stably expressing YB1 shRNAs (A) as well as SMMC7721 and BEL7402 cells stably overexpressing YB1 (B) by qPCR analysis. U6 was used as an internal control for qPCR. C. A schematic representation of the luciferase reporter constructs with ZEB1 or SIP1 3′UTR (left panel). The complementary binding sites among ZEB1 3′UTR luciferase reporter, miR‐205‐5p, and miR‐200b‐3p (right panel). D. The regulation of YB1 on the miR‐205/200b‐ ZEB1 axis was identified by luciferase reporter assays, which were performed by cotransfecting ZEB1 3′UTR luciferase reporter with pre‐miR‐205 or pre‐miR‐200b expressing plasmid, YB1 expressing plasmid, and specific miR‐205 or miR‐200b inhibitors into HEK293T cells. E. YB1 regulated miR‐205/200b‐ ZEB1 axis in a dose‐dependent manner. Luciferase activity assays were performed by cotransfecting ZEB1 3′UTR luciferase reporter with YB1 expressing plasmid and pre‐miR‐205 (left panel) or pre‐miR‐200b (right panel) expressing plasmid into HEK293T cells. The most representative results of three independent biological experiments were shown. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Expressing, Stable Transfection, Control, Luciferase, Construct, Binding Assay, Plasmid Preparation, Activity Assay

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 binds to pre‐miR‐205/200b and inhibits miRNA maturation. A‐B. qPCR analysis of pri‐, pre‐ and mature miR‐205 or miR‐200b expression levels in HCCLM3 cells stably expressing YB1 shRNAs (A) as well as in SMMC7721 cells stably overexpressing YB1 (B). C. RIP‐qPCR analysis of pre‐miR‐200b (upper panel) and pre‐miR‐205 (lower panel) enriched by SFB‐tagged YB1 in HEK293T cells. D. Schematic representation of the wild‐type (black) and the mutant (red) loop sequences of pre‐miR‐205. Mature miR‐205‐5p sequence is shown in blue. Arrows indicate Drosha processing sites. E. RIP‐qPCR analysis of the wild‐type and the mutant pre‐miR‐205 enriched by SFB‐tagged YB1 in HEK293T cells. F. RNA pull‐down assays were performed in vitro by incubating the biotin‐labeled wild‐type and the mutant pre‐miR‐205 (left panel) or pre‐miR‐200b (middle panel) with cell lysates from YB1 transiently transfected HEK293T cells. The biotin‐labeled pre‐miRNAs were identified by electrophoresis (right panel). All pre‐miRNAs were transcribed in vitro with an SP6 promoter except that the mutant pre‐miR‐200b was transcribed by a T7 promoter. The most representative results of three independent biological experiments were shown. U6 was used as an internal control for real‐time PCR. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Expressing, Stable Transfection, Mutagenesis, Sequencing, In Vitro, Labeling, Transfection, Electrophoresis, Control, Real-time Polymerase Chain Reaction

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 suppresses miR‐205/200b maturation by interacting with DGCR8 and Dicer. A. The cytosolic localization of YB1, DGCR8, and Dicer were determined in HCCLM3 cells by immunofluorescence staining. Scale bar, 100 μm. B. The coimmunoprecipitation assays were performed by endogenous YB1 in BEL7402, MHCC97H, and HCCLM3 cells and immunoblotted with antibodies against YB1, DGCR8, Dicer, Akt1, and Smad3. C. Schematic representations of the full‐length and truncated YB1 constructs with A/P, CSD, or A/P‐CSD regions. D‐E. Pull‐down assays were performed with S‐protein beads in HEK293T cells cotransfected with SFB‐tagged full length or truncated YB1 constructs, and Flag‐tagged DGCR8 (D) or Flag‐tagged Dicer (E). F‐G. RNA independent immunoprecipitations were performed in HEK293T cells cotransfected with SFB‐tagged YB1 and Flag‐tagged DGCR8 (F) or Flag‐tagged Dicer (G). The cell lysates were treated with RNase A (1 μg/μL) and then pulled down with S‐protein beads, finally determined by immunoblotting analysis. H‐I. The expression levels of pri‐, pre‐ and mature miR‐205 or miR‐200b were analyzed by qPCR in HEK293T cells transiently cotransfected with Myc‐tagged YB1 and Flag‐tagged DGCR8 (H) or Flag‐tagged Dicer (I). U6 was used as an internal control for real‐time PCR. The most representative results of three independent biological replicates were shown. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Immunofluorescence, Staining, Construct, Western Blot, Expressing, Control, Real-time Polymerase Chain Reaction

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 inhibits miR‐205/200b expression in a Snail‐independent manner. A. The expression levels of pre‐ and mature miR‐205 or miR‐200b were detected by qPCR analysis in YB1 shRNA knockdown MHCC97H cells transiently transfected with si‐ Snail . B. The expression levels of pre‐and mature miR‐205 or miR‐200b were detected by qPCR analysis in YB1 shRNA knockdown HCCLM3 cells transiently transfected with si‐ Snail . C. The expression levels of pre‐ and mature miR‐205 or miR‐200b were detected by qPCR analysis in YB1 knockdown HB611 cells transiently transfected with si‐ Snail . U6 was used as an internal control for real time PCR. Vinculin was used as a loading control. The most representative results of three independent biological replicates were shown. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Expressing, shRNA, Knockdown, Transfection, Control, Real-time Polymerase Chain Reaction

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 interacts with TUTs and influences miR‐205/200b expression. A. Pull‐down experiments were performed with S‐protein beads (upper panel) or Flag‐beads (lower panel) in HEK293T cells cotransfected with exogenous TUT4 and YB1. B. Pull‐down experiments were performed with S‐protein beads (left panel) or Flag‐beads (right panel) in HEK293T cells cotransfected with exogenous TUT1 and YB1. C. Pull‐down experiments were performed in HEK293T cells transiently transfected exogenous TUT1, and immunoblotted with antibodies against YB1 and Flag. D. The coimmunoprecipitation assays were performed by endogenous YB1 (upper panel) or TUT4 (lower panel) in HCC cell lines, and immunoblotted with antibodies against YB1, Akt1, and TUT4 respectively. E‐F. Pull‐down experiments were performed in HEK293T cells cotransfected with SFB‐tagged full‐length or truncated YB1 constructs, and Flag‐tagged TUT4 (E) or Flag‐tagged TUT1 (F). G‐H. RNA independent immunoprecipitations were performed in HEK293T cells cotransfected with exogenous YB1 and TUT4 (G) or TUT1 (H). The cell lysates were treated with RNase A (1 μg/μL) and pulled down by S‐protein beads, finally determined by immunoblotting analysis

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Expressing, Transfection, Construct, Western Blot

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: YB1 promotes cell invasion and tumor progression by regulating the miR‐205/200b‒ ZEB1 axis. A. Transwell matrigel invasion assays were performed in YB1 shRNA knockdown MHCC97H cells transiently transfected with random control, specific miR‐205‐5p or miR‐200b‐3p inhibitors. Scale bar: 100 μm. B. Representative images of murine lung metastatic tumors derived from MHCC97H cells stably expressing YB1 shRNA or shControl by tail veil injection. C. qPCR analysis of miR‐205 and miR‐200b expression levels in lung metastatic tumors derived from MHCC97H cells stably expressing YB1 shRNA or shControl. D‐E. The expression levels of YB1, ZEB1, E‐cadherin, and N‐cadherin proteins were determined by immunohistochemistry (D; magnification, ×400; scale bar, 50 μm) and immunoblotting analyses (E) in lung metastatic tumors derived from MHCC97H cells stably expressing YB1 shRNA or shControl. F. Box plots comparing YB1 expression levels in 50 matched normal and HCC tissues from the TCGA database. The boxes showed the median and the interquartile ranges and the whiskers indicate the minimum and maximum values. G. Kaplan‐Meier curves about the overall survival time of the HCC patients, stratified by YB1 expression levels where high and low groups referred to patients with the highest 40% (n = 148) or lowest 40% (n = 148) YB1 mRNA expression levels among all 371 HCC patients. Data were obtained from TCGA database. Statistical significance was determined by the log‐rank test. H. Boxplots comparing YB1 mRNA expression levels in the TCGA‐HCC patients from different stages (stage I to III). P values were calculated by Wilcox‐test (two‐tails, unpaired). I. Scatterplots showing the positive correlation between YB1 and ZEB1 mRNA expressions in liver tissues (n = 175) from GTEx database. The correlation was determined by Spearman's test. U6 was used as an internal control for real‐time PCR. Data were presented as mean ± SD. * P < 0.05, ** P < 0.001

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: shRNA, Knockdown, Transfection, Control, Derivative Assay, Stable Transfection, Expressing, Injection, Immunohistochemistry, Western Blot, Real-time Polymerase Chain Reaction

Journal: Cancer Communications

Article Title: YB1 regulates miR‐205/200b‐ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma

doi: 10.1002/cac2.12164

Figure Lengend Snippet: A schematic model for YB1 regulation on miR‐205/200b‒ ZEB1 axis by inhibiting microRNA maturation in hepatocellular carcinoma. This study reveals a novel mechanism that YB1 triggers cell invasion and cancer metastasis by regulating miR‐205/200b‒ ZEB1 axis in a Snail‐independent manner. YB1 inhibits miR‐205/200b maturation through interacting with microprocessor DGCR8 and Dicer as well as precursor miR‐205/200b. The downregulation of miR‐205/200b enhances ZEB1 expression, leading to increased cell migration and invasion in HCC cells. Furthermore, YB1 regulates miR‐205/200b expression in concert with terminal uridylyltransferases (TUT4/TUT1). YB1 may restrain the activation of TUTs on group II miRNAs biogenesis via competitively binding with pre‐miRNAs

Article Snippet: The following antibodies were used: antibodies to YB1 (1:1000; 9744; Cell Signaling Technology), E‐Cadherin (1:1000; 14472; Cell Signaling Technology), N‐Cadherin (1:2000; 22018‐1‐AP; Proteintech), ZEB1 (1:1000; 21544‐1‐AP; Proteintech), Snail (1:1000; 3879; Cell Signaling Technology), Vinculin (1:2000; V4505; Sigma), GAPDH (1:2000; 60004‐1‐Ig; Proteintech), Smad3 (1:1000; 9523; Cell Signaling Technology), Akt1 (1:1000; 4691; Cell Signaling Technology), DGCR8 (1:1000; 10996‐1‐AP; Proteintech), Dicer (1:1000; 20567‐1‐AP; Proteintech), TUT4/ZCCHC11 (1:800; 18980‐1‐AP; Proteintech), β‐Tubulin (1:1000; 10068‐1‐AP; Proteintech), Lamin B1 (1:1000; 12987‐1‐AP; Proteintech), Flag/DDDK tag (1:1000; 20543‐1‐AP; Proteintech), Myc‐tag (1:2000; 60003‐2‐Ig; Proteintech) and tGFP (1:2000; TA150041; Origene).

Techniques: Expressing, Migration, Activation Assay, Binding Assay

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining, Immunostaining, Labeling, Immunoprecipitation, Transfection, Control, Immunodetection

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunofluorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Derivative Assay, Microscopy, Binding Assay, RNA Immunoprecipitation, Sequencing, Staining, Transfection, Cotransfection

Journal: Oncogenesis

Article Title: The long non-coding RNA PIK3CD-AS2 promotes lung adenocarcinoma progression via YBX1-mediated suppression of p53 pathway

doi: 10.1038/s41389-020-0217-0

Figure Lengend Snippet: a Localization of PIK3CD-AS2 was evaluated by RNA ISH in A549 and H1299 cells. RNA ISH was performed with Dig-labeled probes (green) and nuclei were labeled with DAPI (blue). Scale bars: 50 μm. b Transcript levels of PIK3CD-AS2, U1 (nuclear marker) and GAPDH (cytoplasmic marker) in the nuclear and cytoplasmic fractions obtained from A549 and H1299 cells were quantified by qRT-PCR. c – g A549 and H1299 cells were transfected with PIK3CD-AS2 siRNA or control siRNA, respectively. Twenty-four hours after transfection, 5 × 10 3 cells per well were seeded in an E-plate and monitored continuously for 90 h using the xCelligence real-time cell analyzer (RTCA; c ). *** P < 0.001 determined by unpaired t -test. Forty-eight hours after transfection, some cells were evaluated by an EdU incorporation assay ( d , e ). Representative images show proliferation of A549 and H1299 cells labeled with EdU (green) and nuclei stained with DAPI (blue). Scale bars: 50 μm. The proportion of EdU-positive cells in A549 and H1299 cells was quantified. Values represent mean ± SD of three independent experiments. Statistical analysis was carried out using unpaired t test. * P < 0.05; *** P < 0.001. Meanwhile, the effect of PIK3CD-AS2 on phases of cell cycle ( f ) and apoptosis ( g ) in A549 and H1299 cells was measured by flow cytometry. Left: representative plots showing the cell cycle distribution or cell apoptosis. Right: percentages of G 0 , G 1 , and S phage, or apoptotic cells were calculated, respectively. Values represent mean ± SD of three independent experiments. Statistical analysis was performed using unpaired t -test. * P < 0.05.

Article Snippet: YBX1 siRNA (sc-38634), p53 siRNA (sc-29435) and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Labeling, Marker, Quantitative RT-PCR, Transfection, Control, Staining, Flow Cytometry

Journal: Oncogenesis

Article Title: The long non-coding RNA PIK3CD-AS2 promotes lung adenocarcinoma progression via YBX1-mediated suppression of p53 pathway

doi: 10.1038/s41389-020-0217-0

Figure Lengend Snippet: a , b 1 × 10 6 A549 cells were transfected with PIK3CD-AS2 siRNA or control, respectively. Forty-eight hours after transfection, total RNA of A549 cells was harvested and analyzed by RNA sequencing (RNA-seq). Heat map depicting differentially expressed genes between si-PIK3CD-AS2 and control cells ( a ). Red: upregulated genes; green: downregulated genes. KEGG pathway enrichment analyses of RNA-seq results in the top 11 pathways according to the P value ( b ). The y-axis and x-axis indicate pathway name and rich score, respectively. c – f A549 cells were transfected with PIK3CD-AS2 siRNA, control siRNA, PIK3CD-AS2 plasmid or control plasmid for 48 h, respectively. p53 downstream target genes were measured by qRT-PCR ( c , d ) and western blot ( e , f ). Data are represented as means ± SD. Statistical analysis was carried out using unpaired t -test. * P < 0.05; ** P < 0.01. g , h Representative images of p53 expression level in xenograft tumors were detected using IHC staining ( g ) and western blot ( h ). Scale bars: 500 μm and 100 μm (insets).

Article Snippet: YBX1 siRNA (sc-38634), p53 siRNA (sc-29435) and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Transfection, Control, RNA Sequencing, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Expressing, Immunohistochemistry

Journal: Oncogenesis

Article Title: The long non-coding RNA PIK3CD-AS2 promotes lung adenocarcinoma progression via YBX1-mediated suppression of p53 pathway

doi: 10.1038/s41389-020-0217-0

Figure Lengend Snippet: a – c A549 cells were transfected with PIK3CD-AS2 siRNA, control siRNA, and p53 siRNA as the rescued group. After 24 h of transfection, cells were seeded as explained in Fig. and monitored by RTCA for 90 h ( a ). *** P < 0.001 determined by unpaired t -test. After 48 h of transfection, cells were harvested and measured for apoptosis ( b ) and cell cycle phase distribution ( c ) using flow cytometry. d – f A549 cells were transfected with PIK3CD-AS2 expression plasmid, control plasmid, and p53 plasmid as the rescued group. Cells proliferation were monitored by RTCA ( d ). *** P < 0.001 determined by unpaired t -test. The apoptosis ( e ) and cell cycle phase distribution ( f ) were assessed by flow cytometry. Values represent mean ± SD of three independent experiments. Statistical analysis was carried out using unpaired t -test. * P < 0.05; *** P < 0.001.

Article Snippet: YBX1 siRNA (sc-38634), p53 siRNA (sc-29435) and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Transfection, Control, Flow Cytometry, Expressing, Plasmid Preparation

Journal: Oncogenesis

Article Title: The long non-coding RNA PIK3CD-AS2 promotes lung adenocarcinoma progression via YBX1-mediated suppression of p53 pathway

doi: 10.1038/s41389-020-0217-0

Figure Lengend Snippet: a Total lysate from A549 cells was used as a positive control, or pulled down with biotin-labeled PIK3CD-AS2. As a negative control, the cell lysate was incubated with a PIK3CD-AS2 antisense sequence. Representative image of silver-stained PAGE gel showing separated proteins. b Y-box binding protein 1 (YBX1) screened by mass spectrometry (peptide coverage value is 5) was validated using western blot. c qRT-PCR analysis of RNA enrichment in the RIP assay using the YBX1 antibody in A549 cells. Agarose gel of qRT-PCR products for PIK3CD-AS2 (Top). The size of PCR products was ~75 base pair. YBX1 was detected by western blot (Middle). mRNA levels in immunoprecipitated samples, corrected for mRNA levels in input (Bottom). GAPDH was used as negative control for YBX1 binding. d , e GSEA enrichment plots ( d ) and heat map ( e ) of differentially expressed genes (data shown in Fig. ) belonging to the YBX1 targets with si-PIK3CD-AS2 treatment. The bar-code plot indicates the position of genes on the expression data rank-sorted by its association with PIK3CD-AS2, with red and blue colors indicating overexpression and underexpression in the mRNA. f , g A549 cells were treated as explained in Fig. and harvested for YBX1 expression analysis by qRT-PCR ( f ) and western blot ( g ). Values represent mean ± SD of three independent experiments. h – j A549 cells were transfected with PIK3CD-AS2 siRNA or control. Forty-eight hours after transfection, some of cells were treated with cycloheximide (CHX; 10 µg/mL) for 0, 1.5, 3, 4.5 or 6 h, and then measured by western blot ( h ). Graph shows protein quantification normalized to β-actin (mean ± SD). * P < 0.05 was determined by unpaired t -test. Some of cells were left alone or treated with MG132 (30 µM) for 6 h, and then analyzed for YBX1 expression by western blot ( i ), and the ubiquitination levels of endogenous YBX1 using immunoprecipitation assay ( j ). k , l Total protein lysate from A549 cells was extracted for immunoprecipitation using anti-YBX1 antibody ( k ) or anti-p53 antibody ( l ). m – o A549 cells were transfected with PIK3CD-AS2 siRNA, PIK3CD-AS2 plasmid or control, respectively. Some cells were also cotransfected with YBX1 siRNA or YBX1 plasmid. After 24 h of transfection, some cells were seeded as explained in Fig. and monitored by RTCA for 90 h ( m , n ). *** P < 0.001 determined by unpaired t -test. After 48 h of transfection, the expression of p53 pathway molecules was assessed by western blot ( o ).

Article Snippet: YBX1 siRNA (sc-38634), p53 siRNA (sc-29435) and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Positive Control, Labeling, Negative Control, Incubation, Sequencing, Staining, Binding Assay, Mass Spectrometry, Western Blot, Quantitative RT-PCR, Agarose Gel Electrophoresis, Immunoprecipitation, Expressing, Over Expression, Transfection, Control, Ubiquitin Proteomics, Plasmid Preparation

Journal: Oncogenesis

Article Title: The long non-coding RNA PIK3CD-AS2 promotes lung adenocarcinoma progression via YBX1-mediated suppression of p53 pathway

doi: 10.1038/s41389-020-0217-0

Figure Lengend Snippet: Tumors of PDTX models derived from p53 wild-type samples of six patients were intratumorally injected with LNA-PIK3CD-AS2 or scramble control twice weekly for four weeks. The mice were killed and analyzed four weeks after LNA administration. a Representative images of mice (top) and xenograft tumors (bottom) were shown. n = 6. b , c Tumor volume ( b ), and tumor weights ( c ) were quantitative analyzed. Data are shown as means ± SD. Statistical analysis was performed using unpaired t -test. * P < 0.05; ** P < 0.01. d , e Xenograft tumor sections were measured for H&E staining and the expression of Ki67, TUNEL ( d ), YBX1, p-YBX1 and p53 ( e ). f Kaplan–Meier analysis of disease-free survival curve of p53 wild-type LUAD patients in TCGA datasets based on PIK3CD-AS2 expression (log rank test, P = 0.011).

Article Snippet: YBX1 siRNA (sc-38634), p53 siRNA (sc-29435) and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Derivative Assay, Injection, Control, Staining, Expressing, TUNEL Assay