wt mice Search Results


96
ATCC mouse colon carcinoma
Mouse Colon Carcinoma, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse colon carcinoma/product/ATCC
Average 96 stars, based on 1 article reviews
mouse colon carcinoma - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Inotiv female balb c
L. major –i.p. recruited C57BL/6 <t>and</t> <t>BALB/c</t> neutrophils were purified by MACS and incubated with medium, L. major (5∶1 parasite∶neutrophil ratio), IFNγ, or both. (A) Sixteen hours later, neutrophil CCL3, CCL4 and CCL5 mRNA levels were assessed by real-time quantitative RT-PCR, and (B) 24 hours after initiation of culture, chemokine content was measured in cell-free culture supernatants by ELISA. Data are the mean triplicate measurement ± SEM of neutrophil mRNA or chemokine content in the supernatants. *: p<0.05 compared to neutrophils cultured with medium only. (C) Supernatants from inflammatory neutrophils cultured in presence or in absence of L. major were tested for their chemotactic activity towards bone marrow-derived DCs in a transwell cell migration assay. The number of DCs that migrated toward neutrophil supernatant is represented. (D) DC migration was similarly assessed in response to neutrophil supernatants depleted of CCL3. *: p<0.05 as compared to values measured in response to supernatant of neutrophil incubated with medium alone. Data are expressed as mean number ± SEM of DC that migrated towards neutrophil supernatant (n = 3 per group). The results of a representative experiment out of three are shown.
Female Balb C, supplied by Inotiv, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/female balb c/product/Inotiv
Average 96 stars, based on 1 article reviews
female balb c - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

95
ATCC mouse embryonic fibroblasts mefs
L. major –i.p. recruited C57BL/6 <t>and</t> <t>BALB/c</t> neutrophils were purified by MACS and incubated with medium, L. major (5∶1 parasite∶neutrophil ratio), IFNγ, or both. (A) Sixteen hours later, neutrophil CCL3, CCL4 and CCL5 mRNA levels were assessed by real-time quantitative RT-PCR, and (B) 24 hours after initiation of culture, chemokine content was measured in cell-free culture supernatants by ELISA. Data are the mean triplicate measurement ± SEM of neutrophil mRNA or chemokine content in the supernatants. *: p<0.05 compared to neutrophils cultured with medium only. (C) Supernatants from inflammatory neutrophils cultured in presence or in absence of L. major were tested for their chemotactic activity towards bone marrow-derived DCs in a transwell cell migration assay. The number of DCs that migrated toward neutrophil supernatant is represented. (D) DC migration was similarly assessed in response to neutrophil supernatants depleted of CCL3. *: p<0.05 as compared to values measured in response to supernatant of neutrophil incubated with medium alone. Data are expressed as mean number ± SEM of DC that migrated towards neutrophil supernatant (n = 3 per group). The results of a representative experiment out of three are shown.
Mouse Embryonic Fibroblasts Mefs, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse embryonic fibroblasts mefs/product/ATCC
Average 95 stars, based on 1 article reviews
mouse embryonic fibroblasts mefs - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

95
ATCC mouse embryonic fibroblast 3t3 fibroblasts
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
Mouse Embryonic Fibroblast 3t3 Fibroblasts, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse embryonic fibroblast 3t3 fibroblasts/product/ATCC
Average 95 stars, based on 1 article reviews
mouse embryonic fibroblast 3t3 fibroblasts - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

91
Addgene inc gst rab35
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
Gst Rab35, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gst rab35/product/Addgene inc
Average 91 stars, based on 1 article reviews
gst rab35 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

93
Addgene inc t myod dprip
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
T Myod Dprip, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t myod dprip/product/Addgene inc
Average 93 stars, based on 1 article reviews
t myod dprip - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

92
Addgene inc aoi wt cas9
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
Aoi Wt Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aoi wt cas9/product/Addgene inc
Average 92 stars, based on 1 article reviews
aoi wt cas9 - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
ATCC sv40 mef immortalized mouse embryonic fibroblasts
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
Sv40 Mef Immortalized Mouse Embryonic Fibroblasts, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sv40 mef immortalized mouse embryonic fibroblasts/product/ATCC
Average 93 stars, based on 1 article reviews
sv40 mef immortalized mouse embryonic fibroblasts - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
OriGene pcmv wt1
In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .
Pcmv Wt1, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmv wt1/product/OriGene
Average 91 stars, based on 1 article reviews
pcmv wt1 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

91
Addgene inc mouse pd l1 coding region pd l1
B16-F10 WT and IRF-1 KO cells were treated with mouse IFNγ for 0, 2, 4, 6 and 8 hrs, and collected for the detection of expression of <t>PD-L1.</t> (A-B) The mRNA expression of PD-L1 and ICAM1 were detected using TaqMan real-time PCR. (C) Total protein expression of PD-L1 was examined by immunoblotting. (D) The cell surface expression of PD-L1 was assessed by flow cytometry. (E) 5 × 105 of B16-F10 WT or IRF1-KO cells were intradermally injected into C57BL/6 mice (n=5). Tumor were collected on day 12 of post-injection. The percentage of and geometric mean (MFI) of PD-L1high in CD45− cells (tumor cells) were tested by flow cytometry. In (A) and (B) each data point represents mean and SEM from 3 independent replicates. Representative results from twice repeated experiment are shown in (C - F).
Mouse Pd L1 Coding Region Pd L1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse pd l1 coding region pd l1/product/Addgene inc
Average 91 stars, based on 1 article reviews
mouse pd l1 coding region pd l1 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

93
Addgene inc mouse atf4
Oligonucleotide sequences used in the present study.
Mouse Atf4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse atf4/product/Addgene inc
Average 93 stars, based on 1 article reviews
mouse atf4 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
ATCC k7m2 mouse osteosarcoma
Administration schedules of gemcitabine (G) and L19mTNF-α/melphalan (L-M) as single or combined treatments
K7m2 Mouse Osteosarcoma, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/k7m2 mouse osteosarcoma/product/ATCC
Average 94 stars, based on 1 article reviews
k7m2 mouse osteosarcoma - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

Image Search Results


L. major –i.p. recruited C57BL/6 and BALB/c neutrophils were purified by MACS and incubated with medium, L. major (5∶1 parasite∶neutrophil ratio), IFNγ, or both. (A) Sixteen hours later, neutrophil CCL3, CCL4 and CCL5 mRNA levels were assessed by real-time quantitative RT-PCR, and (B) 24 hours after initiation of culture, chemokine content was measured in cell-free culture supernatants by ELISA. Data are the mean triplicate measurement ± SEM of neutrophil mRNA or chemokine content in the supernatants. *: p<0.05 compared to neutrophils cultured with medium only. (C) Supernatants from inflammatory neutrophils cultured in presence or in absence of L. major were tested for their chemotactic activity towards bone marrow-derived DCs in a transwell cell migration assay. The number of DCs that migrated toward neutrophil supernatant is represented. (D) DC migration was similarly assessed in response to neutrophil supernatants depleted of CCL3. *: p<0.05 as compared to values measured in response to supernatant of neutrophil incubated with medium alone. Data are expressed as mean number ± SEM of DC that migrated towards neutrophil supernatant (n = 3 per group). The results of a representative experiment out of three are shown.

Journal: PLoS Pathogens

Article Title: Neutrophil-Derived CCL3 Is Essential for the Rapid Recruitment of Dendritic Cells to the Site of Leishmania major Inoculation in Resistant Mice

doi: 10.1371/journal.ppat.1000755

Figure Lengend Snippet: L. major –i.p. recruited C57BL/6 and BALB/c neutrophils were purified by MACS and incubated with medium, L. major (5∶1 parasite∶neutrophil ratio), IFNγ, or both. (A) Sixteen hours later, neutrophil CCL3, CCL4 and CCL5 mRNA levels were assessed by real-time quantitative RT-PCR, and (B) 24 hours after initiation of culture, chemokine content was measured in cell-free culture supernatants by ELISA. Data are the mean triplicate measurement ± SEM of neutrophil mRNA or chemokine content in the supernatants. *: p<0.05 compared to neutrophils cultured with medium only. (C) Supernatants from inflammatory neutrophils cultured in presence or in absence of L. major were tested for their chemotactic activity towards bone marrow-derived DCs in a transwell cell migration assay. The number of DCs that migrated toward neutrophil supernatant is represented. (D) DC migration was similarly assessed in response to neutrophil supernatants depleted of CCL3. *: p<0.05 as compared to values measured in response to supernatant of neutrophil incubated with medium alone. Data are expressed as mean number ± SEM of DC that migrated towards neutrophil supernatant (n = 3 per group). The results of a representative experiment out of three are shown.

Article Snippet: Female BALB/c and C57BL/6 mice were purchased from Harlan Olac Ltd. (Bicester, UK).

Techniques: Purification, Incubation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Cell Culture, Activity Assay, Derivative Assay, Cell Migration Assay, Migration

(A) The number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs emigrating from ear explants was measured at 0, 6, 24 and 48 hours post L. major inoculation *: p<0.05 comparing cell number in C57BL/6 versus BALB/c mice. Values from ear explants of six mice per group are expressed as mean values ± SEM . The data are representative of three separate experiments. (B) Gating strategy by flow cytometry of Langerhans and dermal DCs, and monocyte-derived DCs emigrating from L. major -infected C57BL/6 ear explants. For Langerhans and dermal DCs, MHCII and DEC205 positive cells were analyzed on CD11c + gated cells. For monocyte-derived DCs, four colour FACS analysis was performed, CD11b + and LY6C + cells were analyzed on a CCD11c dim and Ly6G − gated cell population. A representative flow cytometry plot is shown.

Journal: PLoS Pathogens

Article Title: Neutrophil-Derived CCL3 Is Essential for the Rapid Recruitment of Dendritic Cells to the Site of Leishmania major Inoculation in Resistant Mice

doi: 10.1371/journal.ppat.1000755

Figure Lengend Snippet: (A) The number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs emigrating from ear explants was measured at 0, 6, 24 and 48 hours post L. major inoculation *: p<0.05 comparing cell number in C57BL/6 versus BALB/c mice. Values from ear explants of six mice per group are expressed as mean values ± SEM . The data are representative of three separate experiments. (B) Gating strategy by flow cytometry of Langerhans and dermal DCs, and monocyte-derived DCs emigrating from L. major -infected C57BL/6 ear explants. For Langerhans and dermal DCs, MHCII and DEC205 positive cells were analyzed on CD11c + gated cells. For monocyte-derived DCs, four colour FACS analysis was performed, CD11b + and LY6C + cells were analyzed on a CCD11c dim and Ly6G − gated cell population. A representative flow cytometry plot is shown.

Article Snippet: Female BALB/c and C57BL/6 mice were purchased from Harlan Olac Ltd. (Bicester, UK).

Techniques: Derivative Assay, Flow Cytometry, Infection

C57BL/6 and BALB/c mice were depleted of neutrophils by an injection i.p. of the NIMP-R14 anti-neutrophil mAb, or injected with a control mAb, 6 hours prior to infection i.d. with L. major stationary promastigotes. The number of (A) Langerhans and dermal DCs and (B) monocyte-derived DCs recruited in the ear dermis at 0h (naïve) or 24h following L. major inoculation was quantified and compared in mice depleted or not of neutrophils. Data are given as mean values ± SEM (n = 6 per group) and are representative of three experiments. * : p<0.05 between mice depleted or not of neutrophils.

Journal: PLoS Pathogens

Article Title: Neutrophil-Derived CCL3 Is Essential for the Rapid Recruitment of Dendritic Cells to the Site of Leishmania major Inoculation in Resistant Mice

doi: 10.1371/journal.ppat.1000755

Figure Lengend Snippet: C57BL/6 and BALB/c mice were depleted of neutrophils by an injection i.p. of the NIMP-R14 anti-neutrophil mAb, or injected with a control mAb, 6 hours prior to infection i.d. with L. major stationary promastigotes. The number of (A) Langerhans and dermal DCs and (B) monocyte-derived DCs recruited in the ear dermis at 0h (naïve) or 24h following L. major inoculation was quantified and compared in mice depleted or not of neutrophils. Data are given as mean values ± SEM (n = 6 per group) and are representative of three experiments. * : p<0.05 between mice depleted or not of neutrophils.

Article Snippet: Female BALB/c and C57BL/6 mice were purchased from Harlan Olac Ltd. (Bicester, UK).

Techniques: Injection, Control, Infection, Derivative Assay

(A) C57BL/6 and BALB/c mice were infected with L. major in the ear dermis. mRNA expression of CCL3, CCL4 and CCL5 at the site of infection was measured 0, 6, 24 and 48 hours post infection by quantitative Real-time PCR and normalized relative to HPRT mRNA levels. Data are represented as the mean ± SEM mRNA transcript levels of individual infected ear (n = 6 per time point). One representative experiment of three is shown. (B) Twenty four hours post-infection, the ear chemokine mRNA level was compared in C57BL/6 mice that were given either the NIMP-R14 neutrophil depleting mAb or a control mAb 6 hours prior to L. major inoculation in the ear. Results are represented as fold increase in mRNA levels relative to levels measured in uninfected mice given a value of 1, and are representative of two experiments.

Journal: PLoS Pathogens

Article Title: Neutrophil-Derived CCL3 Is Essential for the Rapid Recruitment of Dendritic Cells to the Site of Leishmania major Inoculation in Resistant Mice

doi: 10.1371/journal.ppat.1000755

Figure Lengend Snippet: (A) C57BL/6 and BALB/c mice were infected with L. major in the ear dermis. mRNA expression of CCL3, CCL4 and CCL5 at the site of infection was measured 0, 6, 24 and 48 hours post infection by quantitative Real-time PCR and normalized relative to HPRT mRNA levels. Data are represented as the mean ± SEM mRNA transcript levels of individual infected ear (n = 6 per time point). One representative experiment of three is shown. (B) Twenty four hours post-infection, the ear chemokine mRNA level was compared in C57BL/6 mice that were given either the NIMP-R14 neutrophil depleting mAb or a control mAb 6 hours prior to L. major inoculation in the ear. Results are represented as fold increase in mRNA levels relative to levels measured in uninfected mice given a value of 1, and are representative of two experiments.

Article Snippet: Female BALB/c and C57BL/6 mice were purchased from Harlan Olac Ltd. (Bicester, UK).

Techniques: Infection, Expressing, Real-time Polymerase Chain Reaction, Control

(A) C57BL/6 and BALB/c mice were injected i.p. with Evasin-1, a chemokine binding protein that neutralizes CCL3. Twenty four hours post L. major inoculation, the number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs, spontaneously emigrating out of ear explants was measured and compared to that obtained from ear explants from mice similarly infected but which were not given Evasin-1. * : p<0.05 between mice treated or not with Evasin-1. (B) 24 hours after infection i.d. with L. major , the number of leukocytes emigrating out of ear skin explants of CCL3 −/− mice was compared to that measured in similarly infected C57BL/6 ear explants. The number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs is presented as the mean ± SEM (n = 4 for Evasin-1 treated mice, and n = 6 for CCL3 −/− mice) and are representative of three experiments. *: p<0.05 between CCL3 −/− and C57BL/6 mice.

Journal: PLoS Pathogens

Article Title: Neutrophil-Derived CCL3 Is Essential for the Rapid Recruitment of Dendritic Cells to the Site of Leishmania major Inoculation in Resistant Mice

doi: 10.1371/journal.ppat.1000755

Figure Lengend Snippet: (A) C57BL/6 and BALB/c mice were injected i.p. with Evasin-1, a chemokine binding protein that neutralizes CCL3. Twenty four hours post L. major inoculation, the number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs, spontaneously emigrating out of ear explants was measured and compared to that obtained from ear explants from mice similarly infected but which were not given Evasin-1. * : p<0.05 between mice treated or not with Evasin-1. (B) 24 hours after infection i.d. with L. major , the number of leukocytes emigrating out of ear skin explants of CCL3 −/− mice was compared to that measured in similarly infected C57BL/6 ear explants. The number of neutrophils, Langerhans and dermal DCs, and monocyte-derived DCs is presented as the mean ± SEM (n = 4 for Evasin-1 treated mice, and n = 6 for CCL3 −/− mice) and are representative of three experiments. *: p<0.05 between CCL3 −/− and C57BL/6 mice.

Article Snippet: Female BALB/c and C57BL/6 mice were purchased from Harlan Olac Ltd. (Bicester, UK).

Techniques: Injection, Binding Assay, Derivative Assay, Infection

In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .

Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques: In Vitro, Activity Assay

Selectivity indices of compounds against cancer cell lines (IC 50 ) using  3T3  or I407 normal cells (IC 50 ) as reference.

Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: Selectivity indices of compounds against cancer cell lines (IC 50 ) using 3T3 or I407 normal cells (IC 50 ) as reference.

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques:

B16-F10 WT and IRF-1 KO cells were treated with mouse IFNγ for 0, 2, 4, 6 and 8 hrs, and collected for the detection of expression of PD-L1. (A-B) The mRNA expression of PD-L1 and ICAM1 were detected using TaqMan real-time PCR. (C) Total protein expression of PD-L1 was examined by immunoblotting. (D) The cell surface expression of PD-L1 was assessed by flow cytometry. (E) 5 × 105 of B16-F10 WT or IRF1-KO cells were intradermally injected into C57BL/6 mice (n=5). Tumor were collected on day 12 of post-injection. The percentage of and geometric mean (MFI) of PD-L1high in CD45− cells (tumor cells) were tested by flow cytometry. In (A) and (B) each data point represents mean and SEM from 3 independent replicates. Representative results from twice repeated experiment are shown in (C - F).

Journal: Cancer immunology research

Article Title: IRF1 inhibits antitumor immunity through the upregulation of PD-L1 in the tumor cell

doi: 10.1158/2326-6066.CIR-18-0711

Figure Lengend Snippet: B16-F10 WT and IRF-1 KO cells were treated with mouse IFNγ for 0, 2, 4, 6 and 8 hrs, and collected for the detection of expression of PD-L1. (A-B) The mRNA expression of PD-L1 and ICAM1 were detected using TaqMan real-time PCR. (C) Total protein expression of PD-L1 was examined by immunoblotting. (D) The cell surface expression of PD-L1 was assessed by flow cytometry. (E) 5 × 105 of B16-F10 WT or IRF1-KO cells were intradermally injected into C57BL/6 mice (n=5). Tumor were collected on day 12 of post-injection. The percentage of and geometric mean (MFI) of PD-L1high in CD45− cells (tumor cells) were tested by flow cytometry. In (A) and (B) each data point represents mean and SEM from 3 independent replicates. Representative results from twice repeated experiment are shown in (C - F).

Article Snippet: Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Flow Cytometry, Injection

B16-F10 WT cells were treated with mouse IFNγ for 4 hrs for positive control. B16-F10 WT, IRF1-KO and IRF1-KO pInducer20-PD-L1 cells were treated with DOX for 48 hrs and collected for the detection of PD-L1expression. (A) Total protein expression of PD-L1 was examined by immunoblotting. (B) The cell surface expression of PD-L1 was assessed by flow cytometry. Representative histogram from twice repeated experiments are shown. (C) 5 × 105 of B16-F10 WT, IRF1-KO or IRF1-KO pInducer20-PD-L1 cells were intradermally injected into C57BL/6 mice (n=5). One group of either B16-F10 IRF1-KO or IRF1-KO pInducer20-PD-L1 cell injected mice were fed with DOX containing food (200 mg/kg) from 3 days before tumor cell injection, then continued being fed with DOX containing food. Tumor growth measurements were taken with all groups of mice.

Journal: Cancer immunology research

Article Title: IRF1 inhibits antitumor immunity through the upregulation of PD-L1 in the tumor cell

doi: 10.1158/2326-6066.CIR-18-0711

Figure Lengend Snippet: B16-F10 WT cells were treated with mouse IFNγ for 4 hrs for positive control. B16-F10 WT, IRF1-KO and IRF1-KO pInducer20-PD-L1 cells were treated with DOX for 48 hrs and collected for the detection of PD-L1expression. (A) Total protein expression of PD-L1 was examined by immunoblotting. (B) The cell surface expression of PD-L1 was assessed by flow cytometry. Representative histogram from twice repeated experiments are shown. (C) 5 × 105 of B16-F10 WT, IRF1-KO or IRF1-KO pInducer20-PD-L1 cells were intradermally injected into C57BL/6 mice (n=5). One group of either B16-F10 IRF1-KO or IRF1-KO pInducer20-PD-L1 cell injected mice were fed with DOX containing food (200 mg/kg) from 3 days before tumor cell injection, then continued being fed with DOX containing food. Tumor growth measurements were taken with all groups of mice.

Article Snippet: Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific).

Techniques: Positive Control, Expressing, Western Blot, Flow Cytometry, Injection

Oligonucleotide sequences used in the present study.

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Oligonucleotide sequences used in the present study.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Recombinant, Plasmid Preparation

Cystine and methionine deficiency activates the integrated stress response (ISR). HepG2 and L-O2 cells were exposed to CST/Met (−) for 6 ( a , b ), 12 ( d , f ), 24 ( c , e ), or 24–36 h ( g ). ( a ) Phosphorylation of GCN2 and eIF2α. Equal protein loading was verified by β-actin immunoblotting. ( b ) SUnSET assay. Puromycin-integrated polypeptides of 25–170 kDa were quantified by densitometry (left and right). Equal protein loading was verified by Ponceau S staining (upper middle) and β-actin immunoblotting (lower middle). ( c ) ATF4 expression in cells exposed to CST/Met (−) with or without Fer-1 (10 μM) was normalized to β-actin. ( d ) mRNA levels of ISR target genes were determined by qPCR analysis. ( e – g ) Lipid peroxidation ( e ), PTGS2 mRNA ( f ), and cell viability ( g ) were determined after HepG2 cells were exposed to ISRIB (1 μM) under CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, # p < 0.05, versus CST/Met (−): Con, control; ISRIB, ISR inhibitor; N.S., not significant.

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Cystine and methionine deficiency activates the integrated stress response (ISR). HepG2 and L-O2 cells were exposed to CST/Met (−) for 6 ( a , b ), 12 ( d , f ), 24 ( c , e ), or 24–36 h ( g ). ( a ) Phosphorylation of GCN2 and eIF2α. Equal protein loading was verified by β-actin immunoblotting. ( b ) SUnSET assay. Puromycin-integrated polypeptides of 25–170 kDa were quantified by densitometry (left and right). Equal protein loading was verified by Ponceau S staining (upper middle) and β-actin immunoblotting (lower middle). ( c ) ATF4 expression in cells exposed to CST/Met (−) with or without Fer-1 (10 μM) was normalized to β-actin. ( d ) mRNA levels of ISR target genes were determined by qPCR analysis. ( e – g ) Lipid peroxidation ( e ), PTGS2 mRNA ( f ), and cell viability ( g ) were determined after HepG2 cells were exposed to ISRIB (1 μM) under CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, # p < 0.05, versus CST/Met (−): Con, control; ISRIB, ISR inhibitor; N.S., not significant.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Phospho-proteomics, Western Blot, Staining, Expressing, Control

Cystine and methionine deficiency induces BTG1 by activating ATF4. HepG2 and L-O2 cells were exposed to CST/Met (−) for 1–12 ( a , d ), or 24 h ( b , c , e , f ). ( a ) The level of BTG1 mRNA was determined by qPCR. Fer-1 (10 μM, 12 h) or ISRIB (1 μM, 12 h) was simultaneously applied to HepG2 cells under CST/Met (−) (left). ( b ) BTG1 protein. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( c ) BTG1 transactivation. Schematic illustration of constructed reporter plasmids containing the human and murine BTG1 gene promoter (upper). An ATF4 expression plasmid was co-transfected with hpBTG1-luc, mpBTG1-luc, or mpBTG1-ΔA4RE-luc. pCDNA3.2/V5-DEST was used for mock transfection (lower). ( d – f ) Effect of siATF4 on BTG1 induction. A siRNA targeting human ATF4 ( d , e ) or murine ATF4 ( f ) was transfected into HepG2 cells, and expression of BTG1 ( d , e ) and transactivation ( f ) were determined by qPCR, immunoblot, and reporter gene assays, respectively. ** p < 0.01, * p < 0.05, versus control ( a , b , d , e ) or mock transfection ( c , f ); ## p < 0.01, # p < 0.05, versus HepG2 cells exposed to CST/Met (−) ( a , d , e ) or ATF4-transfected cells ( c , f ); †† p < 0.01, between basal level of ATF4 mRNA ( d ): A4RE, putative ATF4 response element; Con, control.

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Cystine and methionine deficiency induces BTG1 by activating ATF4. HepG2 and L-O2 cells were exposed to CST/Met (−) for 1–12 ( a , d ), or 24 h ( b , c , e , f ). ( a ) The level of BTG1 mRNA was determined by qPCR. Fer-1 (10 μM, 12 h) or ISRIB (1 μM, 12 h) was simultaneously applied to HepG2 cells under CST/Met (−) (left). ( b ) BTG1 protein. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( c ) BTG1 transactivation. Schematic illustration of constructed reporter plasmids containing the human and murine BTG1 gene promoter (upper). An ATF4 expression plasmid was co-transfected with hpBTG1-luc, mpBTG1-luc, or mpBTG1-ΔA4RE-luc. pCDNA3.2/V5-DEST was used for mock transfection (lower). ( d – f ) Effect of siATF4 on BTG1 induction. A siRNA targeting human ATF4 ( d , e ) or murine ATF4 ( f ) was transfected into HepG2 cells, and expression of BTG1 ( d , e ) and transactivation ( f ) were determined by qPCR, immunoblot, and reporter gene assays, respectively. ** p < 0.01, * p < 0.05, versus control ( a , b , d , e ) or mock transfection ( c , f ); ## p < 0.01, # p < 0.05, versus HepG2 cells exposed to CST/Met (−) ( a , d , e ) or ATF4-transfected cells ( c , f ); †† p < 0.01, between basal level of ATF4 mRNA ( d ): A4RE, putative ATF4 response element; Con, control.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Western Blot, Membrane, Construct, Expressing, Plasmid Preparation, Transfection, Control

Putative  ATF4  response elements in BTG1 promoter.

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Putative ATF4 response elements in BTG1 promoter.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Binding Assay, Sequencing

BTG1 induces ferroptosis under cystine and methionine deficiency. WT and BTG1 KO HAP1 cells were exposed to CST/Met (−) for 1 ( a —lower), 12 ( c , e ), 24 ( a —upper, and b , d ), or 0–24 h ( f ). ( a ) Fluorescence intensity was measured after incubating HAP1 cells with CST/Met (−) and DCFH-DA (lower). The phenotype of BTG1 KO HAP1 cells was verified by BTG1 immunoblotting. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( b ) Effect of BTG1 KO on CST/Met (−)-inducible expression of ATF4. ( c ) mRNA levels of ISR target genes in HAP1 cells. ( d – f ) Lipid peroxidation ( d ), PTGS2 mRNA level ( e ), and necrotic cell death ( f ) in HAP1 cells exposed to CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, between HAP1 cells exposed to CST/Met (−); N.S., not significant.

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: BTG1 induces ferroptosis under cystine and methionine deficiency. WT and BTG1 KO HAP1 cells were exposed to CST/Met (−) for 1 ( a —lower), 12 ( c , e ), 24 ( a —upper, and b , d ), or 0–24 h ( f ). ( a ) Fluorescence intensity was measured after incubating HAP1 cells with CST/Met (−) and DCFH-DA (lower). The phenotype of BTG1 KO HAP1 cells was verified by BTG1 immunoblotting. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( b ) Effect of BTG1 KO on CST/Met (−)-inducible expression of ATF4. ( c ) mRNA levels of ISR target genes in HAP1 cells. ( d – f ) Lipid peroxidation ( d ), PTGS2 mRNA level ( e ), and necrotic cell death ( f ) in HAP1 cells exposed to CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, between HAP1 cells exposed to CST/Met (−); N.S., not significant.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Fluorescence, Western Blot, Membrane, Expressing, Control

Administration schedules of gemcitabine (G) and L19mTNF-α/melphalan (L-M) as single or combined treatments

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Administration schedules of gemcitabine (G) and L19mTNF-α/melphalan (L-M) as single or combined treatments

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: In Vivo

Therapeutic efficacy of the different schedules of drugs administration. Tumor-free survival curves (%) versus time (days) of WEHI-164 (A and B) and K7M2 (C and D) tumor-bearing mice subjected to G-G (black triangles), L-M (black circles), G-L-M-G (black asterisks), or L-M-G-G (black squares) administration schedules. Data are illustrative of at least 10 mice per treatment group.

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Therapeutic efficacy of the different schedules of drugs administration. Tumor-free survival curves (%) versus time (days) of WEHI-164 (A and B) and K7M2 (C and D) tumor-bearing mice subjected to G-G (black triangles), L-M (black circles), G-L-M-G (black asterisks), or L-M-G-G (black squares) administration schedules. Data are illustrative of at least 10 mice per treatment group.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: Drug discovery

Immune population involved in WEHI-164 and K7M2 tumor eradication in in vivo -depleted mice. Tumor-free survival curves (%) versus time (days) of the WEHI-164 and K7M2 tumor-bearing mice subjected to G-G treatment, in vivo depleted with antibodies direct with CD4 + or CD8 + T cells as described in the Materials and Methods section. The tumor-free survival of groups of five WEHI-164 (A) and K7M2 (B) tumor-bearing mice subjected to G-G treatment (open squares), co-CD4-depleted (black triangles), co-CD8-depleted (black asterisks), or untreated tumor-bearing mice (black diamonds) is indicated. Specific cytolytic activity of the immune splenocytes after WEHI-164 and K7M2 tumor cure and persistence of antitumor memory. Specific lysis (%) of WEHI-164 (C) and K7M2 (D) cells by different E:T ratio of splenocytes from WEHI-164- and K7M2-cured mice at 6 months after G-G (open squares) or L-M-G-G (black diamonds) treatment and after s.c. tumor challenge. The specific lysis is totally inhibited by anti-MHC class I antibodies (open diamonds) and unaffected by anti-MHC class II antibodies (black asterisks). Results are representative of three independent 51 Chromium-release experiments with similar results. (E) The ability of WEHI-164- and K7M2-cured mice subjected to G-G and L-M-G-G treatments to reject the first tumor challenge at different times post cure. The number of challenged mice is indicated in round brackets.

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Immune population involved in WEHI-164 and K7M2 tumor eradication in in vivo -depleted mice. Tumor-free survival curves (%) versus time (days) of the WEHI-164 and K7M2 tumor-bearing mice subjected to G-G treatment, in vivo depleted with antibodies direct with CD4 + or CD8 + T cells as described in the Materials and Methods section. The tumor-free survival of groups of five WEHI-164 (A) and K7M2 (B) tumor-bearing mice subjected to G-G treatment (open squares), co-CD4-depleted (black triangles), co-CD8-depleted (black asterisks), or untreated tumor-bearing mice (black diamonds) is indicated. Specific cytolytic activity of the immune splenocytes after WEHI-164 and K7M2 tumor cure and persistence of antitumor memory. Specific lysis (%) of WEHI-164 (C) and K7M2 (D) cells by different E:T ratio of splenocytes from WEHI-164- and K7M2-cured mice at 6 months after G-G (open squares) or L-M-G-G (black diamonds) treatment and after s.c. tumor challenge. The specific lysis is totally inhibited by anti-MHC class I antibodies (open diamonds) and unaffected by anti-MHC class II antibodies (black asterisks). Results are representative of three independent 51 Chromium-release experiments with similar results. (E) The ability of WEHI-164- and K7M2-cured mice subjected to G-G and L-M-G-G treatments to reject the first tumor challenge at different times post cure. The number of challenged mice is indicated in round brackets.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: In Vivo, Activity Assay, Lysis

Immunohistochemical assessment of tumor infiltrates. Immunohistochemical assessment of CD4 + T cells, CD8 + T cells, and Gr-1 + CD11b + MDSCs in untreated or treated WEHI-164 (A–C) and K7M2 (D–F) tumor-bearing mice 3 days after the conclusion of all therapeutic protocols. Untreated group of mice received PBS only. Results are expressed as cell number (mean ± SD) per high-magnification microscopic field (HMMF). Data are representative of at least three mice per each treatment group. *** P ≤ 0.001; ** P ≤ 0.01; * P ≤ 0.05.

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Immunohistochemical assessment of tumor infiltrates. Immunohistochemical assessment of CD4 + T cells, CD8 + T cells, and Gr-1 + CD11b + MDSCs in untreated or treated WEHI-164 (A–C) and K7M2 (D–F) tumor-bearing mice 3 days after the conclusion of all therapeutic protocols. Untreated group of mice received PBS only. Results are expressed as cell number (mean ± SD) per high-magnification microscopic field (HMMF). Data are representative of at least three mice per each treatment group. *** P ≤ 0.001; ** P ≤ 0.01; * P ≤ 0.05.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: Immunohistochemical staining

Tumor volume assessment after the different therapeutic treatments. Three days after the term of the all therapeutic protocols, the tumor volumes of WEHI-164 and K7M2 untreated and treated tumor-bearing mice were compared. Untreated mice received PBS only. Tumor volumes (cm 3 ) are expressed as mean ± SD. Data are illustrative of least 10 mice per each treatment group.

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Tumor volume assessment after the different therapeutic treatments. Three days after the term of the all therapeutic protocols, the tumor volumes of WEHI-164 and K7M2 untreated and treated tumor-bearing mice were compared. Untreated mice received PBS only. Tumor volumes (cm 3 ) are expressed as mean ± SD. Data are illustrative of least 10 mice per each treatment group.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques:

Flow-cytometric assessment of regulatory T cells

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Flow-cytometric assessment of regulatory T cells

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: