Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology

Article Title: GORAB promotes embryonic lung maturation through antagonizing AKT phosphorylation, versican expression and mesenchymal cell migration

doi: 10.1096/fj.201902075R

Figure Lengend Snippet: (A, B) Quantification of type I (aquaporin 5, Aqp5) and type II (prosurfactant associated protein C, proSFTPC) epithelial markers by quantitative RT-PCR (a) and western blotting (B) in control (Gorab+/+) and homozygous Gorab knockout mouse models (Gorab−/−). (C) Immunofluorescence labeling of AQP5 and proSFTPC in lung of Gorab+/+ or Gorab−/− fetuses, and quantification (n > 300 cells per three pairs of littermates). Nuclei are stained with DAPI (blue). (D - G) Evaluation of versican (Vcan) expression in the lung of control (Gorab+/+) and homozygous Gorab knockout mouse models (Gorab−/−) by in situ hybridization (D), immunofluorescence (E), quantitative RT-PCR (F), and western blotting (G). (H) Western blotting of VCAN in primary fibroblasts isolated from E18.5 Gorab+/+ and Gorab−/− fetuses. Data are shown as means ± SD (n ≥ 3 pairs of littermates). ∗∗∗ P < 0.001, NS, not statistically significant vs. corresponding controls. Scale bars, 25 μm (C, E), 50 μm (D).

Article Snippet: Mouse Vcan cDNA (V2) was obtained from Origene (MR225930, Rockville, MD) and transfected (1 μg per well of 12-well plate) to mouse primary lung fibroblasts as described for siRNA.

Techniques: Quantitative RT-PCR, Western Blot, Control, Knock-Out, Immunofluorescence, Labeling, Staining, Expressing, In Situ Hybridization, Isolation

Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology

Article Title: GORAB promotes embryonic lung maturation through antagonizing AKT phosphorylation, versican expression and mesenchymal cell migration

doi: 10.1096/fj.201902075R

Figure Lengend Snippet: (A) Appearance of alveolar-like structure formed by co-culturing A549 epithelial cells with primary fibroblasts isolated from lungs of E18.5 Gorab+/+ or Gorab−/− fetuses for indicated durations. (B) Quantifications of the thickness (left) and height (middle) of cell ridge and the area of pockets (right) at 72 hours of co-culturing. (C) Representative distribution of cells in 72-hour co-cultures by immunofluorescence labeling of A549 (CellTracker dye CMTPX, red) and fibroblasts (vimentin, VIM, green). (D - E) Appearance (D) and quantification (E) of alveolar-like structure formed by co-culturing A549 epithelial cells with primary fibroblasts isolated from the lungs of wild type E18.5 Gorab+/+ fetuses and transfected with Vcan-V2 cDNA or Vector. Mock indicates non-transfected cells. Cells were examined 48 hours after transfection. (F - G) Appearance (F) and quantification (G) of alveolar-like structure formed by co-culturing A549 epithelial cells with primary fibroblasts isolated from the lungs of E18.5 Gorab−/− fetuses and transfected with Vcan siRNA or non-targeting (NT) siRNA. Mock indicates non-transfected cells. Cells were examined 48 hours after transfection. Data are shown as means ± SD (n ≥ 3 independent experiments). Student’s t-test and Bonferroni’s multiple comparison test, one-way ANOVA. ∗ P < 0.05 vs. corresponding controls. Scale bars, 500 μm (A), 100 μm (C), 250 μm (D, F).

Article Snippet: Mouse Vcan cDNA (V2) was obtained from Origene (MR225930, Rockville, MD) and transfected (1 μg per well of 12-well plate) to mouse primary lung fibroblasts as described for siRNA.

Techniques: Isolation, Immunofluorescence, Labeling, Transfection, Plasmid Preparation, Comparison

Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology

Article Title: GORAB promotes embryonic lung maturation through antagonizing AKT phosphorylation, versican expression and mesenchymal cell migration

doi: 10.1096/fj.201902075R

Figure Lengend Snippet: (A) Western blotting of phospho-AKT (p-AKT S473 and S308), PDGF signaling components, and PHLPP2 in the lung of E18.5 control (Gorab+/+) and homozygous Gorab knockout mouse models (Gorab−/−). (B) Western blotting of p-AKT in primary fibroblasts isolated from the lung of E18.5 Gorab+/+ and Gorab−/− fetuses (n ≥ 3 pairs of littermates). (C) Western blotting of p-AKT in primary mesenchymal cells treated with PDGF-AA. (D) H&E staining of distal regions of the lungs biopsied from E18.5 wild type (Pdgfrα+/+) and heterozygous Pdgfrα+/J mutants. (E) Quantifications of the area of alveolar sac (left), the length of alveolar sac chord (middle), and the thickness of alveolar septum (right). (F) Western blotting of p-AKT and VCAN in the lung of E18.5 Pdgfrα+/+ and Pdgfrα+/J mutants. All experiments were performed with a minimum of 3 pairs of littermates. Data are shown as means ± SD (n = 3 mice/group). Scale bars, 50 μm.

Article Snippet: Mouse Vcan cDNA (V2) was obtained from Origene (MR225930, Rockville, MD) and transfected (1 μg per well of 12-well plate) to mouse primary lung fibroblasts as described for siRNA.

Techniques: Western Blot, Control, Knock-Out, Isolation, Staining

Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology

Article Title: GORAB promotes embryonic lung maturation through antagonizing AKT phosphorylation, versican expression and mesenchymal cell migration

doi: 10.1096/fj.201902075R

Figure Lengend Snippet: (A) H&E staining of distal regions of the lungs of wild type (Gorab+/+;PDGFRα+/+), homozygous Gorab mutant (Gorab−/−;PDGFRα+/+), and homozygous Gorab mutant deficient for PDGF receptor α (Gorab−/−;PDGFRα+/EGFP). (B) Quantifications of the area of alveolar sac (left), the length of alveolar sac chord (middle), and the thickness of alveolar septum (right) (n = 3 pairs of littermates). (C) Western blotting of p-AKT and VCAN in lungs described in (A). (D, E) In situ hybridization (D) and immunofluorescence labeling (E) of VCAN in lungs described in (A). Nuclei are stained with hematoxylin (D) or DAPI (E). All experiments were performed with a minimum of 3 pairs of littermates. Data are shown as means ± SD (n = 3 mice/group). Bonferroni’s multiple comparison test, one-way ANOVA. Scale bars, 50 μm (A), 25 μm (D, E).

Article Snippet: Mouse Vcan cDNA (V2) was obtained from Origene (MR225930, Rockville, MD) and transfected (1 μg per well of 12-well plate) to mouse primary lung fibroblasts as described for siRNA.

Techniques: Staining, Mutagenesis, Western Blot, In Situ Hybridization, Immunofluorescence, Labeling, Comparison

Journal: Oncoimmunology

Article Title: Carcinoma origin dictates differential skewing of monocyte function.

doi: 10.4161/onci.20427

Figure Lengend Snippet: Figure 4. Blocking VCAN in colon carcinoma supernatants decreases pro-inflammatory cytokine production in monocytes. (A) VCAN mRNA expres- sion of and (B) VCAN protein secretion by different colon or breast carcinoma cell lines. (C–E) Monocytes were pre-incubated with mixture of colon carcinoma cell supernatants together with 10 μg/ml blocking antibodies against VCAN (gray bars) or isotype IgGs (black bars) for 24 h. Production of (C) IL-6, (D) IL-12p40 or (E) TNFα was measured after stimulation with LPS or LPS/IFNγ for 24 h. *p < 0.05. The experiment was repeated three times with similar results.

Article Snippet: VCAN ELISA was performed according to manufacturer’s protocol (Cusabio Biotech Co., Ltd., CSB-E11884h).

Techniques: Blocking Assay, Incubation

Journal: Oncoimmunology

Article Title: Carcinoma origin dictates differential skewing of monocyte function.

doi: 10.4161/onci.20427

Figure Lengend Snippet: Figure 5. Downregulation of VCAN in colon carcinoma cell lines leads to decreased pro-inflammatory cytokine production in monocytes. (A) VCAN mRNA relative to GAPDH expression and (B) VCAN protein secretion after transduction of the colon carcinoma cell lines HCT116 and HT29 with lentiviral particles containing irrelevant scrambled shRNAs or specific VCAN shRNAs. (C and D) Monocytes were pre-incubated with supernatants of VCAN shRNA (gray bars) or scrambled shRNA (black bars) transduced (C) HCT116 or (D) HT29 cells for 24 or 72 h. Production of IL-6, TNFα and IL-12 was measured after stimulation with LPS or LPS/IFNγ for 24 h. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: VCAN ELISA was performed according to manufacturer’s protocol (Cusabio Biotech Co., Ltd., CSB-E11884h).

Techniques: Expressing, Transduction, Incubation, shRNA

Journal:

Article Title: Up-regulation of stromal versican expression in advanced stage serous ovarian cancer

doi: 10.1016/j.ygyno.2010.05.029

Figure Lengend Snippet: A. Quantitative RT-PCR analysis of VCAN mRNA isoform expression in advanced stage serous ovarian tumor samples. mRNA isolated from tumor epithelium (t) and tumor stroma (s) were analyzed separately. V1 was the most highly expressed isoform in these samples (P= 0.008)

Article Snippet: Q-RT-PCR was performed using the 7300 Real-time PCR System and TaqMan Gene Expression Assay probes (Applied Biosystems, Foster City, CA) for total VCAN(Hs01007940_m1) V0 (Hs 01007944_m1), V1 (.Hs01007937_m1), V2 (Hs01007943_m1), V3 (Hs01007941_m1), cyclophilin ( {"type":"entrez-nucleotide","attrs":{"text":"NM_021130.3","term_id":"114520617","term_text":"NM_021130.3"}} NM_021130.3 ).

Techniques: Quantitative RT-PCR, Expressing, Isolation

Journal:

Article Title: Up-regulation of stromal versican expression in advanced stage serous ovarian cancer

doi: 10.1016/j.ygyno.2010.05.029

Figure Lengend Snippet: A. Kaplan Meier survival analysis. High VCAN expression in tumor stroma (median overall survival, 37.5 mos) versus low VCAN expression in tumor stroma (median overall survival, 79.8 mos). P= 0.001. B. High VCAN expression in tumor stroma (median progression-free survival, 9.5 mos) versus low VCAN expression in tumor stroma (median progression-free survival, 37.5 mos). P= 0.008. Cutoff for high expression of VCAN was 75th percentile.

Article Snippet: Q-RT-PCR was performed using the 7300 Real-time PCR System and TaqMan Gene Expression Assay probes (Applied Biosystems, Foster City, CA) for total VCAN(Hs01007940_m1) V0 (Hs 01007944_m1), V1 (.Hs01007937_m1), V2 (Hs01007943_m1), V3 (Hs01007941_m1), cyclophilin ( {"type":"entrez-nucleotide","attrs":{"text":"NM_021130.3","term_id":"114520617","term_text":"NM_021130.3"}} NM_021130.3 ).

Techniques: Expressing

Journal:

Article Title: Up-regulation of stromal versican expression in advanced stage serous ovarian cancer

doi: 10.1016/j.ygyno.2010.05.029

Figure Lengend Snippet: Scatter plot showing the correlation between tumor stromal VCAN expression and microvessel density (P<0.01, r = .611)

Article Snippet: Q-RT-PCR was performed using the 7300 Real-time PCR System and TaqMan Gene Expression Assay probes (Applied Biosystems, Foster City, CA) for total VCAN(Hs01007940_m1) V0 (Hs 01007944_m1), V1 (.Hs01007937_m1), V2 (Hs01007943_m1), V3 (Hs01007941_m1), cyclophilin ( {"type":"entrez-nucleotide","attrs":{"text":"NM_021130.3","term_id":"114520617","term_text":"NM_021130.3"}} NM_021130.3 ).

Techniques: Expressing

Journal:

Article Title: Up-regulation of stromal versican expression in advanced stage serous ovarian cancer

doi: 10.1016/j.ygyno.2010.05.029

Figure Lengend Snippet: Immunohistochemical staining of (A) CD31 and (B) VCAN in a case with low VCAN expression versus immunohistochemical staining of (C) CD31 and (D) VCAN in a case with high VCAN expression. Bar = 10 μm.

Article Snippet: Q-RT-PCR was performed using the 7300 Real-time PCR System and TaqMan Gene Expression Assay probes (Applied Biosystems, Foster City, CA) for total VCAN(Hs01007940_m1) V0 (Hs 01007944_m1), V1 (.Hs01007937_m1), V2 (Hs01007943_m1), V3 (Hs01007941_m1), cyclophilin ( {"type":"entrez-nucleotide","attrs":{"text":"NM_021130.3","term_id":"114520617","term_text":"NM_021130.3"}} NM_021130.3 ).

Techniques: Immunohistochemical staining, Staining, Expressing

Journal: Journal of Histochemistry and Cytochemistry

Article Title: Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry

doi: 10.1369/0022155415610383

Figure Lengend Snippet: Cumulative Vcan expression by embryonic day. Contribution to the total embryonic gene expression by versican copy number in the lungs, liver, heart, and brain is shown at E11.5, E12.5, E13.5, E14.5, E15.5, and in the adult control. Changes in the amount of mRNA for versican was determined using mRNA collected from embryonic organ homogenates and quantitative real time PCR. A versican standard curve was constructed using the V3 plasmid (mouse) and probes for total versican related to Ct value for 15 ng cDNA to versican copy number. An asterisk (*) shows groups that are significantly different (p<0.05) using a one-way ANOVA with Tukey’s multiple comparison test.

Article Snippet: The ABI Gene Expression Assays used are as follows: total versican probe set, Mm00490179 or Mm01283063_m1;18S, Hs99999901_s1; V0 primer (MUV0, custom made), MUV0_F CCAAGTTCCACCCTGACATAAATGT, MUV0_RGGATGACCACTTACAATCATATCACTCA, MUV0_M FAM TCGACCTGTCTTGTTTTC; V1 primer, Mm00490173_m1; V2 primer (MUV2, custom made), MUV2_F CCAAGTTCCACCCTGACATAAATGT, MUV2_R GCATGGGTTTGTTTTGCAGAGATC, MUV2_M FAM CAGAGAAAACAAGACAGGACCT; V3 primer, Rn01493763_m1.

Techniques: Expressing, Real-time Polymerase Chain Reaction, Construct, Plasmid Preparation

Journal: Journal of Histochemistry and Cytochemistry

Article Title: Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry

doi: 10.1369/0022155415610383

Figure Lengend Snippet: Vcan expression and β-GAG accumulation in lungs and brain from E11.5 to E15.5. Versican relative gene expression (A, C) and β-GAG quantitative immunohistochemistry (B, D) in embryonic lungs (A, B) and head (C, D) over five embryonic ages. Changes in versican immunohistochemistry were determined by calculating ratios of versican to total tissue area using the Visiopharm image analysis module. Changes in relative amounts of mRNA for versican were determined using mRNA collected from embryonic organ homogenates and quantitative real time PCR using total versican primer sets. Values are the mean ± SEM. mRNA for versican is expressed as a relative fold increase in mRNA over the adult control. An asterisk (*) shows groups that are significantly different (p≤0.05).

Article Snippet: The ABI Gene Expression Assays used are as follows: total versican probe set, Mm00490179 or Mm01283063_m1;18S, Hs99999901_s1; V0 primer (MUV0, custom made), MUV0_F CCAAGTTCCACCCTGACATAAATGT, MUV0_RGGATGACCACTTACAATCATATCACTCA, MUV0_M FAM TCGACCTGTCTTGTTTTC; V1 primer, Mm00490173_m1; V2 primer (MUV2, custom made), MUV2_F CCAAGTTCCACCCTGACATAAATGT, MUV2_R GCATGGGTTTGTTTTGCAGAGATC, MUV2_M FAM CAGAGAAAACAAGACAGGACCT; V3 primer, Rn01493763_m1.

Techniques: Expressing, Immunohistochemistry, Real-time Polymerase Chain Reaction

Journal: Journal of Histochemistry and Cytochemistry

Article Title: Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry

doi: 10.1369/0022155415610383

Figure Lengend Snippet: Versican accumulation during embryonic development in healthy adult lungs and in lungs of a mouse with Pseudomonas aeruginosa lung infection. (A) Versican accumulation in fetal lung tissue at E14.5 days. (B) Versican accumulation in the lung of a 16-week-old mouse treated with PBS as a vehicle control. (C) Versican accumulation from a 16-week-old mouse infected with live Pseudomonas aeruginosa for 5 days. Brown indicates positive staining for versican β-GAG; blue, hematoxylin counterstain. Br, bronchiole; Di, diaphragm; Ri, rib; PV, postcapillary Vein; TB, terminal bronchiole. Arrows indicate Vcan staining in the alveolar septa; * marks an area of positive staining of the alveolar septa; cells in alveolar space makes it difficult to distinguish these two anatomical compartments. (D) The amount of versican-stained lung tissue as a percentage of total lung tissue in control mice (PBS) and those exposed to live P aeruginosa for up to 5 days. Values are the mean ± SEM (n=3 to 6). asignificantly different from PBS, bsignificantly different from 4 hr, csignificantly different from 24 hr. p<00001 using a one-way ANOVA with Tukey’s multiple comparison test. Scale (A–C) 100 µm; (C inset) 50 µm.

Article Snippet: The ABI Gene Expression Assays used are as follows: total versican probe set, Mm00490179 or Mm01283063_m1;18S, Hs99999901_s1; V0 primer (MUV0, custom made), MUV0_F CCAAGTTCCACCCTGACATAAATGT, MUV0_RGGATGACCACTTACAATCATATCACTCA, MUV0_M FAM TCGACCTGTCTTGTTTTC; V1 primer, Mm00490173_m1; V2 primer (MUV2, custom made), MUV2_F CCAAGTTCCACCCTGACATAAATGT, MUV2_R GCATGGGTTTGTTTTGCAGAGATC, MUV2_M FAM CAGAGAAAACAAGACAGGACCT; V3 primer, Rn01493763_m1.

Techniques: Infection, Staining