Journal: bioRxiv

Article Title: Interdependent regulation of trabecular meshwork cell physiology and intraocular pressure by KALRN and TMCO1

doi: 10.1101/2025.09.19.677310

Figure Lengend Snippet: (A) KALRN-depleted TM cells transfected with c-Myc–tagged KALRN-7 or KALRN-12 (TM219) showed successful isoform expression (green: c-Myc, red: KALRN). Scale bar, 50μm. (B) ZO-1 immunostaining (green) decreased at cell-cell junctions in KALRN-7 and KALRN-12 restored cells (c-Myc–positive cells, red). Scale bars, 50μm. (C) Quantification confirmed reduction in cell area after re-expression of KALRN-7 and −12 isoforms (n=30-50 cells per group; Kruskal–Wallis test; Mean areas: si-Control: 1868 pixel², si-KALRN: 7242 pixel², si-KALRN + plasmid KALRN-7 (pK7): 3716 pixel², si-KALRN + plasmid KALRN-12 (pK12): 4603 pixel²). (D) Chi-square analysis showed the changed junctional ZO-1 patterns in the cells with re-expression of KALRN-7 and −12 isoforms. TM219; si-KALRN=76 cells; si-KALRN + pK7=18 cells; si-KALRN + pK12=10 cells. (E-H) FLIM–FRET analysis showed reduced Rac1 activity and increased RhoA activation in KALRN-depleted cells (TM219). In Rac1 biosensor–expressing cells, warmer colours (shorter lifetimes) indicate higher activity. KALRN depletion reduced Rac1 activity in the basal half of the cells, as shown by cooler colour shifts. RhoA activity increased at the basal side, indicated by warmer colours (Kruskal-Wallis tests; Rac1, n=13 per group; RhoA, n=10 per group). (I) Inhibition of Rac using NSC23766 in TM cells reproduced features of KALRN loss, including decreased pp-MLC2 staining (red), thicker F-actin filaments (green), and increased ZO-1 staining at cell-cell junction area. TM219. Scale bar, 50μm. (J) Rac inhibition increased cell area (TM219; control: n=76 cells, NSC: n=55 cells from 5 images; Mann–Whitney test). (K) Percentage of TM cells with ZO-1 type II distribution were elevated following Rac inhibition (n=4 images, TM219; unpaired t-test).

Article Snippet: The RhoA biosensor expression plasmid pCAGGS-Raichu-RhoA-CR (Addgene plasmid # 40258; http://n2t.net/addgene:40258 ; RRID:Addgene 40258) and pcDNA3-Clover (Addgene plasmid # 40259; http://n2t.net/addgene:40259 ; RRID: Addgene_40259) were gifts from Michael Lin . pCAGGS-Raichu-Rac1-CR was constructed by replacing the sequence between Clover and mRuby2 in pCAGGS-Raichu-RhoA-CR with the corresponding sequence of pCAGGS-Raichu-Rac1 (kindly provided by Michiyuki Matsuda; Department of Pathology and Biology of Diseases, Kyoto University, Japan).

Techniques: Transfection, Expressing, Immunostaining, Control, Plasmid Preparation, Activity Assay, Activation Assay, Inhibition, Staining, MANN-WHITNEY

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A, Schematic overview of transcoelomic metastasis in ovarian cancer. Ascites-derived ovarian cancer cell lines (OVCAR3, OVCA433 and SKOV3 cells) were grown in tissue-culture treated dishes to mimic adherent (A) tumor cells. Cells were transitioned into anchorage independent condition (a-i) using ultra-low attachment plates for 2 hrs (a-i 2hrs), where they reside as single cells in suspension to mimic early disseminating cells, or for 24 hrs (a-i 24hrs), where cells form multicellular aggregates (MCAs). Venn diagram shows overlap of differentially expressed genes (n=4, log₂FC > 1, adjusted P < 0.05) across all three cell lines at 2hrs a-i. B, Heat map representing individual genes comprising the detachment-induced signature identified in (panel A) ranked based on significance in OVCAR3 cell line. C, Functional annotation of the conserved upregulated detachment-sensitive gene set highlighting RHOV as the sole Rho GTPase within the signature. D, Volcano plots of differentially expressed genes at 2 hrs in a-i showing that RHOV ranks among the top-most upregulated genes in all cell lines. E, RHOV is upregulated in ascites-derived tumor cells isolated from three high grade serous ovarian cancer patients when cultured under a-i conditions. F, RHOV is enriched in metastatic lesions in 4/5 high grade serous ovarian cancer patients compared to matched primary tumors and normal tissue (N-FT=Normal Fallopian Tube, Tumor-OV=Tumor Ovary and Tumor-OM=Tumor Omentum).

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: Derivative Assay, Suspension, Functional Assay, Isolation, Cell Culture

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A, Schematic of orthotopic intra-bursal xenograft model. Luciferase-labeled OVCAR3 cells were injected into the left ovary-bursa of NSG mice. B, Representative bioluminescence images of mice post-intra-bursal tumor cells injection. OVCAR3 WT tumors disseminate widely where RHOV-KO tumors remain confined to the ovary. C, Quantification of total peritoneal bioluminescence from (B), (n=5 mice/group, two way ANOVA, P < 0.0001). D, Quantification of peritoneal tumors in OVCAR3-WT vs RHOV-KO mice (n=5; Unpaired t-test P value shown). E, Representative gross (left) and bioluminescence (right) images of post-necropsy ovary and omental tumors. Mice injected with OVCAR3 RHOV-KO cells show no signal at omental metastatic sites. F, Quantification of ovary and omental bioluminescence signal from (E), demonstrating reduced primary tumor burden from RHOV-KO OVCAR3 cells as well as a complete absence of metastasis to the omentum (n=5; Ovary: Unpaired t-test P-value shown, Omentum: Mann Whitney test P-value shown). G, SKOV3 cells were injected directly into the peritoneal cavity in an a-i state to mimic transcoelomic metastasis of pre-disseminated cells. H, Representative in vivo bioluminescence images of NSG mice following intraperitoneal injection with luciferase-labeled SKOV3 WT or RHOV-KO cells. I, Quantification of total photon flux from whole-body imaging in (H), showing significantly reduced metastatic burden in RHOV-KO–tumor bearing mice (n=10 mice; two way ANOVA P < 0.0001). J, Volume of ascites fluid collected from SKOV3 WT and RHOV-KO group (n=10, Unpaired t-test, P value shown). K, L, Representative images and quantification of number of peritoneal tumor nodules in SKOV3 WT and RHOV-KO injected mice showing reduced size and incidence of peritoneal metastases in RHOV-KO group (n=10, Unpaired t-test P value shown). M, Representative ex vivo bioluminescence images of excised omentum from mice injected with SKOV3-WT and KO cells showing reduced flux in the RHOV-KO mice omentum. N, Quantification of omental bioluminescence intensity from (M), (n=10, Unpaired t-test P value shown). O, Representative gross images and H&E staining of omentum from SKOV3 WT and RHOV-KO injected mice. P, Quantification of omental weight from SKOV3 WT and RHOV-KO injected mice (n=10, Unpaired t-test P value shown).

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: Luciferase, Labeling, Injection, MANN-WHITNEY, In Vivo, Imaging, Ex Vivo, Staining

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A, Live/dead staining of OVCA433 cells cultured under anchorage-independent (a-i) conditions in flat bottom ultra-low attachment plates (ULA) in the absence of serum keeps cells dispersed as single cells and small clusters in suspension, Calcein-AM (green) marks live cells; ethidium homodimer (red) marks dead cells. B, Representative fluorescent images of Live/Dead WT and RHOV-KO OVCA433 cells over time in anchorage-independent conditions in flat bottom ULA. Images were taken at 4x magnification and stitched (2×2 stich) to show whole well. Scale Bar=500uM. C, 10x magnification of Live/Dead cells from OVCA433 WT and RHOV-KO cells in flat bottom ULA from 72Hrs in a-i, scale bar=500uM. D, RHOV-KO cells show significantly increased single cell anoikis susceptibility. Time-course quantification of cumulative cell death under a-i conditions in OVCA433 WT and RHOV-KO cells in flat bottom ULA model (n=3, two way ANOVA P <0.0001, Sidak’s multiple comparisons post hoc test P value shown). E, Representative images of multicellular aggregates (MCAs) formed by OVCA433, SKOV3, and OVCAR3 WT and RHOV-KO cells after 72 hrs in round-bottom ULA plates imaged at 10x magnification, Scale Bar=500uM. F, Cells cultured under anchorage-independent (a-i) conditions in round bottom ultra-low attachment plates (ULA) in the presence of serum allowing cells to cluster into multicellular aggregates in suspension, Calcein-AM (green) marks live cells and ethidium homodimer (red) marks dead cells. G-I, Quantification of Live/dead staining of MCAs at 72 hrs in a-i reveals significantly increased cell death in RHOV-KO cell aggregates in OVCA433 (G), SKOV3, (H), OVCAR3 (I) (n = 3, Unpaired t-test P value shown).

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: Staining, Cell Culture, Suspension

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A, MCA spheroid compaction assay in SKOV3 WT and RHOV-KO cells, showing reduced compaction in KO cells (n=3, two way ANOVA, P < 0.0001). B, MCA spheroid compaction assay in OVCAR3 WT and RHOV-KO cells, showing reduced compaction in KO cells (n=3, two way ANOVA, P < 0.0001). C, Schematic of the mesothelial clearance assay. RFP-labeled ovarian cancer spheroids were co-cultured atop a GFP-expressing mesothelial monolayer on collagen to mimic peritoneal colonization. D, Representative images of mesothelial clearance at indicated timepoints. RHOV-KO spheroids show significantly impaired clearance compared to WT cells, failing to fully displace the mesothelium or engage with the ECM. Images acquired at 10x magnification, Scale bar= 100uM. E, Quantification of mesothelial clearance area over time. RHOV-KO spheroids show progressive failure to expand and maintain cleared zones (n=3; two way ANOVA P value shown). F, Representative images and quantification of wound healing assay in SKOV3 WT and RHOV-KO cells showing loss of migratory capacity in RHOV-KO cells, Images acquired at 10x magnification, scale bar=100uM (n=3; two way ANOVA P value shown). G, Transwell invasion assay demonstrates severely reduced Matrigel invasion in RHOV-KO SKOV3 cells (n=3, unpaired t-test P value shown). H, Summary schematic illustrating RHOV’s role across sequential steps of metastatic progression.

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: Labeling, Cell Culture, Expressing, Wound Healing Assay, Transwell Invasion Assay

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A–C, Bulk RNA-sequencing of OVCA433 WT and RHOV-KO cells cultured under three conditions: adherent (A), early anchorage-independent (2 hrs; B), and late anchorage-independent (24 hrs; C). Left panels: volcano plots showing distribution of differentially expressed genes between WT and KO cells. Right panels: Gene Ontology (GO) Biological Pathways enrichment analysis of significantly downregulated pathways in RHOV-KO cells in each condition (n=3). D, Transcription factor enrichment analysis (TFEA) of differentially expressed genes at the 2 hrs a-i timepoint identifies c-Jun as the top predicted downregulated transcriptional regulator in RHOV-KO cells. E, GO enrichment of RHOV dependent c-Jun–regulated genes shows their convergence on pathways related to actin cytoskeleton organization, anchoring junctions, and cell motility. F-G , Western blots representative image (F) and quantification (G) showing reduced phospho-c-Jun (Ser63) in RHOV-KO SKOV3 cells (n=3, two way ANOVA P values shown). H, Phalloidin staining shows reduced polymerized F-actin in RHOV-KO cells under early a-i (2hrs) conditions, indicating impaired actin cytoskeletal remodeling in both OVCA433 and SKOV3 RHOV-KO cells. Images acquired at 63x magnification. Scale bar = 100uM (SKOV3), 10uM (OVCA433).

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: RNA Sequencing, Cell Culture, Western Blot, Staining

Journal: bioRxiv

Article Title: RHOV is a Detachment-Responsive Rho GTPase Necessary for Ovarian Cancer Peritoneal Metastasis

doi: 10.1101/2025.08.12.669944

Figure Lengend Snippet: A, Schematic of RHOV constructs used in rescue experiments: wild-type RHOV (WT), GTP-locked constitutively active G40V mutant (CA), dominant-negative GDP-bound S45N mutant (DN), and palmitoylation-deficient membrane localization C234S mutant ( ϕλ MEM). B, WT and CA RHOV but not DN or ϕλ MEM RHOV-mutants restore anoikis resistance in RHOV-KO SKOV3 aggregates after cells were cultured in anchorage independent (a-i) conditions for 72Hrs using ultra-low attachment plates. Representative images of live cells are labeled with Calcein-AM (green), and dead cells with Ethidium Homodimer (red). Images acquired at 10x magnification. Scale bar = 500uM. C, Quantification of live/dead percentage from (B), presented as percentage of dead cells relative to total (n=3; One-way ANOVA P <0.0001, Sidak’s post hoc test P value shown). D, Representative wound healing assay images at 0- and 7-days post-scratch in RHOV-KO SKOV3 cells expressing indicated RHOV rescue constructs or EV control. E, Quantification of % wound closure in (D) at day7; RHOV-WT and CA restore migratory capacity, while DN and ϕλ MEM do not (n=3; One-way ANOVA P=0.0009, Sidak’s post hoc test P value shown). F, Phalloidin staining of F-actin reveals restoration of actin architecture in RHOV-WT expressing SKOV3-RHOV-KO cells. Images acquired at 63x magnification. Scale bar = 100uM. G, H, Characterization of c-Jun/Pak pathway components in SKOV3 RHOV-KO+EV vs RHOV-rescue mutants. Representative Western blots are shown. Densitometry of protein bands from replicate experiments are quantified (n=3; One-way ANOVA, Sidak’s post hoc test P value shown).

Article Snippet: Wild-type (WT) human RHOV (RefSeq: NM_133639) was subcloned from the pCMV6-Entry vector (Origene, RC211121) into the pLX304 lentiviral expression vector (Addgene, #25890) using Gateway® recombination cloning (Thermo Scientific).

Techniques: Construct, Mutagenesis, Dominant Negative Mutation, Membrane, Cell Culture, Labeling, Wound Healing Assay, Expressing, Control, Staining, Western Blot

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Knockdown of tomosyn reduces dendritic complexity and dendritic spine density. (a) Representative images and reconstructed dendritic trees from mouse hippocampal neurons transfected with scrambled shRNA + GFP or shTomosyn + GFP or shTomosyn + Tom r ‐GFP. Scale bar, 100 µm. (b) Sholl analysis, (c) branch number, and (d) total dendrite length of reconstructed neurons. General dendrite complexity was quantified by the area under the Sholl curve. Neurons expressing shTomosyn exhibited compromised dendritic complexity, whereas expression of Tom r ‐GFP rescued simplified dendritic complexity in shTomosyn‐expressing neurons compared to scramble controls. * p < 0.05, **** p < 0.0001, one‐way ANOVA with Tukey's test. n = 26 scramble, 28 shTomosyn, and 27 Tomosyn rescue. (e) Confocal images of dendritic spines from neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, or shTomosyn + Tom r ‐GFP for 72 hr. Scale bar, 2 µm. (f) Mean spine density was decreased in tomosyn knockdown neurons at primary, secondary, and tertiary dendrites. Spine density was restored in Tom r ‐GFP rescue and shTomosyn co‐expressing neurons compared to shTomosyn + GFP. * p < 0.05, *** p < 0.001, **** p < 0.0001 by two‐way ANOVA with Tukey's test multiple comparisons test. n = 15 scramble, 14 shTomosyn, and 15 Tomosyn rescue [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Transfection, shRNA, Expressing

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Frequency of miniature EPSCs is decreased in tomosyn knockdown neurons. Cultured hippocampal neurons were transfected with either scrambled shRNA or shTomosyn. (a) An example of current traces collected from whole‐cell voltage‐clamp of hippocampal neurons. (b) Examples of average (top) and scaled (bottom) mEPSC traces from scrambled shRNA and shTomosyn transfected neurons. Summary graphs show (c) frequency, (d) amplitude, (e) charge, and (f) decay time constant of recorded mEPSCs. * p < 0.05, **** p < 0.0001, Student's t‐ test. n = 22 scramble and 21 shTomosyn [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Cell Culture, Transfection, shRNA

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Tomosyn knockdown results in increased RhoA activity in hippocampal neurons. Hippocampal neurons were co‐transfected with a RhoA biosensor and either scrambled shRNA or shTomosyn. (a) Representative images show the neurons in the intensity‐modulated display mode. Higher magnification of the soma and a dendritic segment in dashed box areas are enlarged for better visualization. Scale bar, 20 and 5 µm. (b) FRET efficiency was determined as a ratio of YFP/CFP. **** p < 0.0001, unpaired Student's t ‐test. n = 72 scramble and 69 shTomosyn. (c) Schematic structure of domain mutant tomosyn. FL‐Tom, full‐length mouse tomosyn (1‐1166 aa); Tom‐ΔC, containing an N‐terminal domain with WD40 repeats (1‐1048 aa); Tom‐ΔN, containing a SNARE coil‐coiled domain (1049‐1109 aa). (d) Western blot shows the expression of domain mutant tomosyn (Tom‐ΔC‐RFP and Tom‐ΔN‐RFP), FL‐Tom‐RFP, and RFP control in N2a cells. (e) Summary graph showing FRET efficiency in domain mutant tomosyn‐expressing neurons. Neurons with Tom‐ΔN‐RFP showed increased FRET efficiency. *** p < 0.001 compared to RFP, FL‐tomosyn, and ΔC‐tomosyn, one‐way ANOVA with Dunnett's multiple comparisons test. n = 32 RFP, 28 FL‐Tom‐RFP, 29 Tom‐ΔC‐RFP, and 32 Tom‐ΔN‐RFP

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Activity Assay, Transfection, shRNA, Mutagenesis, Western Blot, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Inhibition of the Rho signaling pathway restores altered dendritic structures in tomosyn knockdown neurons. Representative images show (a) dendritic morphology at DIV7 and (b) spine morphology at DIV15. Transfected neurons were co‐expressed by scramble shRNA or IRES‐EGFP together with IRES‐EGFP (left), EGFP‐WT‐RhoA (middle), and EGFP‐T19N‐RhoA (right). Scale bar, 100 µm in a and 2 µm in b. Quantification of (c) branch number, (d) total dendrite length, and (e) spine density of neurons co‐transfected neurons. Co‐expression of T19N‐RhoA resulted in similar levels of dendritic complexity and spine density between scramble control‐ and shTomosyn‐expressing neurons. ** p < 0.01, *** p < 0.001, **** p < 0.0001, two‐way ANOVA with Sidak's multiple comparisons test. n = 27 scramble + ctrl, 35 scramble + WT‐RhoA, 34 scramble + T19N‐RhoA, 37 shTomosyn + ctrl, 35 shTomosyn + WT‐RhoA, and 36 shTomosyn + T19N‐RhoA in c and d; n = 20 scramble + ctrl, 26 scramble + WT‐RhoA, 22 scramble + T19N‐RhoA, 18 shTomosyn + ctrl, 19 shTomosyn + WT‐RhoA, 21 shTomosyn + T19N‐RhoA in e

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Inhibition, Knockdown, Transfection, shRNA, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Surface expression of GluR1 subunits is reduced in tomosyn knockdown neurons. (a) Western blot analysis of co‐immunoprecipitation experiments in cultured cortical neurons. Cultured cortical neuron lysates at 15 DIV were immunoprecipitated with either anti‐tomosyn antibody, rabbit IgG control, anti‐syntaxin‐4 antibody, or mouse IgG control. Immunoblot was probed with tomosyn and syntaxin‐4 antibodies. FT = flow through. Quantification of the surface expression of pHluorin‐GluR1 in (b) dendritic spines and (c) dendritic segments. Cultured neurons were co‐transfected with either Tomosyn‐RFP (OE), scrambled shRNA, or shTomosyn and pHluorin‐GluR1. Tomosyn knockdown neurons were treated with the RhoA inhibitor, C3T. * p < 0.05, *** p < 0.001, one‐way ANOVA with Dunnett's multiple comparisons test. n = 16 OE, 20 scramble, 22 shTomosyn, and 23 shTomosyn + C3T. (d) Representative confocal images showing surface staining for pHluorin‐GluR1 in cultured hippocampal neurons at 15 DIV. Scale bar, 2 µm

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Expressing, Knockdown, Western Blot, Immunoprecipitation, Cell Culture, Control, Transfection, shRNA, Staining

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Autism‐associated mutant tomosyn fails to restore dendritic arborization and spine loss in tomosyn knockdown neurons. (a) An illustration of the location of L412V and Y502C mutations in tomosyn. (b) Representative images of reconstructed dendritic trees and (c) Sholl analysis, (d) branch number, and (e) total dendrite length from mouse hippocampal neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, shTomosyn + WT r ‐Tom‐GFP, shTomosyn + L412V r ‐Tom‐GFP, or shTomosyn + Y502C r ‐Tom‐GFP. Scale bar, 100 µm. Both L412V and Y502C mutant tomosyn failed to rescue total dendrite length compared to scrambled shRNA. Only Y502C failed to rescue branch number compared to scramble. # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 when compared to scramble; * p < 0.05, ** p < 0.01, **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Tukey multiple comparisons test. n = 30 scramble, 31 shTomosyn, 27 WT rescue, 33 L412V rescue, and 31 Y502C rescue. (f) Representative confocal images and (g) the quantification of spine density in cultured hippocampal neurons transfected with different tomosyn constructs as described in b, c, d, and e. Scale bar, 2 µm. #### p < 0.0001 when compared to scramble; **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Dunnett's multiple comparison tests. n = 31 scramble, 30 shTomosyn, 29 WT rescue, 31 L412V rescue, and 31 Y502C rescue. (h) A reduction of GluR1 surface expression in dendritic segments in neurons co‐expressing shTomosyn‐L412V r ‐Tom‐RFP, compared to shTomosyn‐WT r ‐Tom‐RFP, was observed. ** p < 0.01 when compared to shTomosyn; ## p < 0.01, ### p < 0.001 when compared to shTomosyn‐L412V r ‐Tom‐RFP by one‐way ANOVA with Tukey's multiple comparisons test. n = 28 scramble, 21 shTomosyn, 22 WT rescue, 24 L412V rescue, 20 Y502C rescue

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Mutagenesis, Knockdown, Transfection, shRNA, Cell Culture, Construct, Comparison, Expressing