type hct116 Search Results


94
Genecopoeia hct116
Mean fluorescent intensity (MFI) of CD47 and PD-L1 on <t>HCT116</t> cells (A) 48 hours after photon (8 Gy) or proton (8 CGE) irradiation, (B) 48 hours after 4–20 Gy or sham irradiation and (C) 2–6 days after 8-Gy or sham irradiation determined via flow cytometry (n = 3–4). D-F, Histoscores (H-scores; D and F) and (E) representative images of CD47 immunohistochemistry surface staining on CRC cells (arrowheads) in pretreatment biopsies versus post-irradiation surgical specimens in 30 rectal cancer patients who underwent short-course neoadjuvant radiotherapy (RT, 5 Gy × 5 Fr) followed by en-bloc resection. Bars on H-scores, mean ± standard errors (paired t-test); good responders, Mandard tumor regression grade (TRG) 2–3; poor responders, TRG 4–5; scale bar, 100 μm. G, CD47 and PD-L1 MFI in various human solid cancer cells after 8-Gy irradiation (n = 6). H-J, Expression of CD47 and PD-L1 on scrambled shRNA control (shCtrl) versus ATR shRNA-knockdown (shATR) HCT116 cells treated +/− 8 Gy radiotherapy. ATR knockdown was assessed by (H) immunoblotting 24 hours after 8-Gy or sham irradiation (n = 3 biological replicates). I, Transcriptional levels of CD47 in shCtrl or shATR clones 24 hours after 8-Gy or sham irradiation (n = 9). J, Histograms and MFI of CD47 and PD-L1 on shCtrl- or shATR-HCT116 cells 48 hours after 8-Gy or sham irradiation (n = 5). K-M, Histograms and MFI of CD47 and PD-L1 on HCT116 cells 48 hours after 8-Gy or sham irradiation +/− (K) ATRi (300 nM VE822), (L) Chk1i (300 nM UCN-01), or (M) STAT3i (100 μM NSC74859; n = 5–6). N, Phagocytosis assays using differentiated THP1-Dual cells, which expresses IRF and NF-κB reporters, co-cultured with CFSE-labeled HCT116 cells +/− RT and ATR inhibition (300 nM VE822, n = 6–9). Phagocytosis is expressed as the percentage of CFSE+ cells in CD64+ THP1-Dual cells. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001.
Hct116, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/type+hct116/Wild+type+Parental+HCT116+Reference+Standard/pmc09373855-421-0-32
Average 94 stars, based on 1 article reviews
hct116 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
China Center for Type Culture Collection hct116
Mean fluorescent intensity (MFI) of CD47 and PD-L1 on <t>HCT116</t> cells (A) 48 hours after photon (8 Gy) or proton (8 CGE) irradiation, (B) 48 hours after 4–20 Gy or sham irradiation and (C) 2–6 days after 8-Gy or sham irradiation determined via flow cytometry (n = 3–4). D-F, Histoscores (H-scores; D and F) and (E) representative images of CD47 immunohistochemistry surface staining on CRC cells (arrowheads) in pretreatment biopsies versus post-irradiation surgical specimens in 30 rectal cancer patients who underwent short-course neoadjuvant radiotherapy (RT, 5 Gy × 5 Fr) followed by en-bloc resection. Bars on H-scores, mean ± standard errors (paired t-test); good responders, Mandard tumor regression grade (TRG) 2–3; poor responders, TRG 4–5; scale bar, 100 μm. G, CD47 and PD-L1 MFI in various human solid cancer cells after 8-Gy irradiation (n = 6). H-J, Expression of CD47 and PD-L1 on scrambled shRNA control (shCtrl) versus ATR shRNA-knockdown (shATR) HCT116 cells treated +/− 8 Gy radiotherapy. ATR knockdown was assessed by (H) immunoblotting 24 hours after 8-Gy or sham irradiation (n = 3 biological replicates). I, Transcriptional levels of CD47 in shCtrl or shATR clones 24 hours after 8-Gy or sham irradiation (n = 9). J, Histograms and MFI of CD47 and PD-L1 on shCtrl- or shATR-HCT116 cells 48 hours after 8-Gy or sham irradiation (n = 5). K-M, Histograms and MFI of CD47 and PD-L1 on HCT116 cells 48 hours after 8-Gy or sham irradiation +/− (K) ATRi (300 nM VE822), (L) Chk1i (300 nM UCN-01), or (M) STAT3i (100 μM NSC74859; n = 5–6). N, Phagocytosis assays using differentiated THP1-Dual cells, which expresses IRF and NF-κB reporters, co-cultured with CFSE-labeled HCT116 cells +/− RT and ATR inhibition (300 nM VE822, n = 6–9). Phagocytosis is expressed as the percentage of CFSE+ cells in CD64+ THP1-Dual cells. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001.
Hct116, supplied by China Center for Type Culture Collection, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/type+hct116/hct116/pmc11525029__mmc2-188-202-204
Average 90 stars, based on 1 article reviews
hct116 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Metabion International AG sns-seq data wild-type hct116 cells
a Schematic representation of human ORC1 protein domains , , . b Cross-correlation between endogenous ORC1, and unlabeled (control) or EU-labeled RNA (short or long pulse), comparing STORM experimental (EXP) and randomized (RND) analysis in the chromatin fraction of U2OS cells synchronized in G1. Data were presented as mean values ( n > 50 cells). Indicated p values (ns denoting p value >0.05) derive from unpaired two-sample t -test. c Schematic of RIP-seq and iCLIP experimental approaches, where endogenous or Flag-tagged ORC1 is immunoprecipitated from native or UV-crosslinked nuclear extracts, followed by recovery of full-length or digested bound RNAs. Below, the number of genes identified by both methods, with different iCLIP stringencies, and hypergeometric test p values of the experimental overlap (RIP-iCLIP) on top of the bars; red for selected high confidence (HC) ORC1-RNAs. d Genomic distributions of ORC1 iCLIP crosslinks, and (below) their density around TSSs (−/+ 10 kb) of ORC1-bound genes. e Gene length and expression level of high confidence (HC) ORC1-RNAs (iCLIP-RIP overlap) and ORC1-RNAs (iCLIP-RIP union), relative to sample size-matched control genes with different fold changes (FC) in ORC1 RIP-seq. n = number of genes in each category (Supplementary Data ; from iCLIP data [>5 crosslink sites and <0.05 FDR] and RIP-seq data [log2 fold change >1 and p value <0.05]). Box plots show the median distribution between Q1 and Q3. *** denotes p value <0.001, derived from unpaired two-tailed Student’s t -test. f Gene biotypes of ORC1-RNAs. g Percentage of ORC1-RNA and high confidence ORC1-RNA (HC) genes with mutual interactions according to Hi-C analysis, compared to controls shown in Fig. 1e. Bars represent mean values. **** denotes p value <0.0001, derived from a two-proportion z -test. h , i Density plots of h ORC1 ChIP-seq and i SNS-seq normalized reads across six quantiles (Q) of ORC1-RNA genes, defined by ORC1 iCLIP, centered around their TSSs (−/+ 5 kb). j Browser snapshot of representative high confidence ORC1-RNA genes, showing data of ORC1 RNA-binding (ORC1 RIP-seq or iCLIP crosslinks), and replication origins (SNS-seq) at their TSSs, in <t>HCT116</t> cells. Green arrows indicate positions of GAA repeats.
Sns Seq Data Wild Type Hct116 Cells, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/type+hct116/sns+seq+data+wild+type+hct116+cells/pmc10366126-272-46-55
Average 90 stars, based on 1 article reviews
sns-seq data wild-type hct116 cells - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

N/A
The Wild type Parental HCT116 Reference Standard is FFPE derived from a highly characterized diploid HCT116 cell line. This reference standard can be used to assess the performance of your NGS, sanger sequencing and qPCR
  Buy from Supplier

Image Search Results


Mean fluorescent intensity (MFI) of CD47 and PD-L1 on HCT116 cells (A) 48 hours after photon (8 Gy) or proton (8 CGE) irradiation, (B) 48 hours after 4–20 Gy or sham irradiation and (C) 2–6 days after 8-Gy or sham irradiation determined via flow cytometry (n = 3–4). D-F, Histoscores (H-scores; D and F) and (E) representative images of CD47 immunohistochemistry surface staining on CRC cells (arrowheads) in pretreatment biopsies versus post-irradiation surgical specimens in 30 rectal cancer patients who underwent short-course neoadjuvant radiotherapy (RT, 5 Gy × 5 Fr) followed by en-bloc resection. Bars on H-scores, mean ± standard errors (paired t-test); good responders, Mandard tumor regression grade (TRG) 2–3; poor responders, TRG 4–5; scale bar, 100 μm. G, CD47 and PD-L1 MFI in various human solid cancer cells after 8-Gy irradiation (n = 6). H-J, Expression of CD47 and PD-L1 on scrambled shRNA control (shCtrl) versus ATR shRNA-knockdown (shATR) HCT116 cells treated +/− 8 Gy radiotherapy. ATR knockdown was assessed by (H) immunoblotting 24 hours after 8-Gy or sham irradiation (n = 3 biological replicates). I, Transcriptional levels of CD47 in shCtrl or shATR clones 24 hours after 8-Gy or sham irradiation (n = 9). J, Histograms and MFI of CD47 and PD-L1 on shCtrl- or shATR-HCT116 cells 48 hours after 8-Gy or sham irradiation (n = 5). K-M, Histograms and MFI of CD47 and PD-L1 on HCT116 cells 48 hours after 8-Gy or sham irradiation +/− (K) ATRi (300 nM VE822), (L) Chk1i (300 nM UCN-01), or (M) STAT3i (100 μM NSC74859; n = 5–6). N, Phagocytosis assays using differentiated THP1-Dual cells, which expresses IRF and NF-κB reporters, co-cultured with CFSE-labeled HCT116 cells +/− RT and ATR inhibition (300 nM VE822, n = 6–9). Phagocytosis is expressed as the percentage of CFSE+ cells in CD64+ THP1-Dual cells. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001.

Journal: Science immunology

Article Title: ATR-mediated CD47 and PD-L1 upregulation restricts radiotherapy-induced immune priming and abscopal responses in colorectal cancer

doi: 10.1126/sciimmunol.abl9330

Figure Lengend Snippet: Mean fluorescent intensity (MFI) of CD47 and PD-L1 on HCT116 cells (A) 48 hours after photon (8 Gy) or proton (8 CGE) irradiation, (B) 48 hours after 4–20 Gy or sham irradiation and (C) 2–6 days after 8-Gy or sham irradiation determined via flow cytometry (n = 3–4). D-F, Histoscores (H-scores; D and F) and (E) representative images of CD47 immunohistochemistry surface staining on CRC cells (arrowheads) in pretreatment biopsies versus post-irradiation surgical specimens in 30 rectal cancer patients who underwent short-course neoadjuvant radiotherapy (RT, 5 Gy × 5 Fr) followed by en-bloc resection. Bars on H-scores, mean ± standard errors (paired t-test); good responders, Mandard tumor regression grade (TRG) 2–3; poor responders, TRG 4–5; scale bar, 100 μm. G, CD47 and PD-L1 MFI in various human solid cancer cells after 8-Gy irradiation (n = 6). H-J, Expression of CD47 and PD-L1 on scrambled shRNA control (shCtrl) versus ATR shRNA-knockdown (shATR) HCT116 cells treated +/− 8 Gy radiotherapy. ATR knockdown was assessed by (H) immunoblotting 24 hours after 8-Gy or sham irradiation (n = 3 biological replicates). I, Transcriptional levels of CD47 in shCtrl or shATR clones 24 hours after 8-Gy or sham irradiation (n = 9). J, Histograms and MFI of CD47 and PD-L1 on shCtrl- or shATR-HCT116 cells 48 hours after 8-Gy or sham irradiation (n = 5). K-M, Histograms and MFI of CD47 and PD-L1 on HCT116 cells 48 hours after 8-Gy or sham irradiation +/− (K) ATRi (300 nM VE822), (L) Chk1i (300 nM UCN-01), or (M) STAT3i (100 μM NSC74859; n = 5–6). N, Phagocytosis assays using differentiated THP1-Dual cells, which expresses IRF and NF-κB reporters, co-cultured with CFSE-labeled HCT116 cells +/− RT and ATR inhibition (300 nM VE822, n = 6–9). Phagocytosis is expressed as the percentage of CFSE+ cells in CD64+ THP1-Dual cells. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001.

Article Snippet: HCT116 and HT29 cells were lentivirally transduced with mCherry-shATR (target sequences: GGAATATAATACAGTTGTACA, GCGGCTTAAGTCTGATTTGCT, and GCCATTATCAAAGCTGATAAA) or mCherry-scrambled shRNA vectors, whereas MC38 cells were transduced with mCherry-Luciferase lentiviral particles according to manufacturer’s protocols (GeneCopoeia).

Techniques: Irradiation, Flow Cytometry, Immunohistochemistry, Staining, Expressing, shRNA, Control, Knockdown, Western Blot, Clone Assay, Cell Culture, Labeling, Inhibition

a Schematic representation of human ORC1 protein domains , , . b Cross-correlation between endogenous ORC1, and unlabeled (control) or EU-labeled RNA (short or long pulse), comparing STORM experimental (EXP) and randomized (RND) analysis in the chromatin fraction of U2OS cells synchronized in G1. Data were presented as mean values ( n > 50 cells). Indicated p values (ns denoting p value >0.05) derive from unpaired two-sample t -test. c Schematic of RIP-seq and iCLIP experimental approaches, where endogenous or Flag-tagged ORC1 is immunoprecipitated from native or UV-crosslinked nuclear extracts, followed by recovery of full-length or digested bound RNAs. Below, the number of genes identified by both methods, with different iCLIP stringencies, and hypergeometric test p values of the experimental overlap (RIP-iCLIP) on top of the bars; red for selected high confidence (HC) ORC1-RNAs. d Genomic distributions of ORC1 iCLIP crosslinks, and (below) their density around TSSs (−/+ 10 kb) of ORC1-bound genes. e Gene length and expression level of high confidence (HC) ORC1-RNAs (iCLIP-RIP overlap) and ORC1-RNAs (iCLIP-RIP union), relative to sample size-matched control genes with different fold changes (FC) in ORC1 RIP-seq. n = number of genes in each category (Supplementary Data ; from iCLIP data [>5 crosslink sites and <0.05 FDR] and RIP-seq data [log2 fold change >1 and p value <0.05]). Box plots show the median distribution between Q1 and Q3. *** denotes p value <0.001, derived from unpaired two-tailed Student’s t -test. f Gene biotypes of ORC1-RNAs. g Percentage of ORC1-RNA and high confidence ORC1-RNA (HC) genes with mutual interactions according to Hi-C analysis, compared to controls shown in Fig. 1e. Bars represent mean values. **** denotes p value <0.0001, derived from a two-proportion z -test. h , i Density plots of h ORC1 ChIP-seq and i SNS-seq normalized reads across six quantiles (Q) of ORC1-RNA genes, defined by ORC1 iCLIP, centered around their TSSs (−/+ 5 kb). j Browser snapshot of representative high confidence ORC1-RNA genes, showing data of ORC1 RNA-binding (ORC1 RIP-seq or iCLIP crosslinks), and replication origins (SNS-seq) at their TSSs, in HCT116 cells. Green arrows indicate positions of GAA repeats.

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a Schematic representation of human ORC1 protein domains , , . b Cross-correlation between endogenous ORC1, and unlabeled (control) or EU-labeled RNA (short or long pulse), comparing STORM experimental (EXP) and randomized (RND) analysis in the chromatin fraction of U2OS cells synchronized in G1. Data were presented as mean values ( n > 50 cells). Indicated p values (ns denoting p value >0.05) derive from unpaired two-sample t -test. c Schematic of RIP-seq and iCLIP experimental approaches, where endogenous or Flag-tagged ORC1 is immunoprecipitated from native or UV-crosslinked nuclear extracts, followed by recovery of full-length or digested bound RNAs. Below, the number of genes identified by both methods, with different iCLIP stringencies, and hypergeometric test p values of the experimental overlap (RIP-iCLIP) on top of the bars; red for selected high confidence (HC) ORC1-RNAs. d Genomic distributions of ORC1 iCLIP crosslinks, and (below) their density around TSSs (−/+ 10 kb) of ORC1-bound genes. e Gene length and expression level of high confidence (HC) ORC1-RNAs (iCLIP-RIP overlap) and ORC1-RNAs (iCLIP-RIP union), relative to sample size-matched control genes with different fold changes (FC) in ORC1 RIP-seq. n = number of genes in each category (Supplementary Data ; from iCLIP data [>5 crosslink sites and <0.05 FDR] and RIP-seq data [log2 fold change >1 and p value <0.05]). Box plots show the median distribution between Q1 and Q3. *** denotes p value <0.001, derived from unpaired two-tailed Student’s t -test. f Gene biotypes of ORC1-RNAs. g Percentage of ORC1-RNA and high confidence ORC1-RNA (HC) genes with mutual interactions according to Hi-C analysis, compared to controls shown in Fig. 1e. Bars represent mean values. **** denotes p value <0.0001, derived from a two-proportion z -test. h , i Density plots of h ORC1 ChIP-seq and i SNS-seq normalized reads across six quantiles (Q) of ORC1-RNA genes, defined by ORC1 iCLIP, centered around their TSSs (−/+ 5 kb). j Browser snapshot of representative high confidence ORC1-RNA genes, showing data of ORC1 RNA-binding (ORC1 RIP-seq or iCLIP crosslinks), and replication origins (SNS-seq) at their TSSs, in HCT116 cells. Green arrows indicate positions of GAA repeats.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Labeling, Immunoprecipitation, Expressing, Derivative Assay, Two Tailed Test, Hi-C, ChIP-sequencing, RNA Binding Assay

a RNA-FISH representative images, and signal quantification (below), of RNAs containing GAA repeats, in ASO-transfected HCT116 cells. Dots represent mean values ( n = 4 biologically independent samples) ±SEM. * denotes p value < 0.05, derived from unpaired two-tailed Student’s t -test. b DNA fiber quantification of inter-origin distances and fork rates of ASO-transfected HCT116 cells. Red lines indicate the median. ns denotes p value > 0.05, ** denotes p value < 0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. c SNS-seq peak count frequency and distribution relative to TSS positions (±3 kb) in ASO control and anti-GAA treated HCT116 cells. d GSEA showing the reduction of SNS-seq signal (peaks enriched in the control condition) in anti-GAA downregulated genes. Statistical significance (adjusted p value 0.038) of the enrichment score (ES) derives from a permutation test. e CDC45 and PCNA chromatin immunofluorescences per cell (HCT116) upon ASO knockdown, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ±SEM. *** denotes p value < 0.001, derived from unpaired two-tailed Mann–Whitney t -test. f ORC1 western blot and protein quantification, in chromatin extracts of ASO-transfected HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value < 0.05, derived from paired two-tailed Student’s t -test. g Browser snapshot at DDX5-CEP95 locus showing ORC1 RIP-seq enrichment, ORC1 iCLIP peaks, and SNS-seq reads in HCT116 cells, with the position of qPCR primers (#) indicated, and origins highlighted in blue. h Enrichment of nascent strands determined by SNS-qPCR at genomic positions indicated in Fig. 2g, in siRNA-treated HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value <0.05, ** denotes p value < 0.01, derived from paired two-tailed Student’s t -test.

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a RNA-FISH representative images, and signal quantification (below), of RNAs containing GAA repeats, in ASO-transfected HCT116 cells. Dots represent mean values ( n = 4 biologically independent samples) ±SEM. * denotes p value < 0.05, derived from unpaired two-tailed Student’s t -test. b DNA fiber quantification of inter-origin distances and fork rates of ASO-transfected HCT116 cells. Red lines indicate the median. ns denotes p value > 0.05, ** denotes p value < 0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. c SNS-seq peak count frequency and distribution relative to TSS positions (±3 kb) in ASO control and anti-GAA treated HCT116 cells. d GSEA showing the reduction of SNS-seq signal (peaks enriched in the control condition) in anti-GAA downregulated genes. Statistical significance (adjusted p value 0.038) of the enrichment score (ES) derives from a permutation test. e CDC45 and PCNA chromatin immunofluorescences per cell (HCT116) upon ASO knockdown, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ±SEM. *** denotes p value < 0.001, derived from unpaired two-tailed Mann–Whitney t -test. f ORC1 western blot and protein quantification, in chromatin extracts of ASO-transfected HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value < 0.05, derived from paired two-tailed Student’s t -test. g Browser snapshot at DDX5-CEP95 locus showing ORC1 RIP-seq enrichment, ORC1 iCLIP peaks, and SNS-seq reads in HCT116 cells, with the position of qPCR primers (#) indicated, and origins highlighted in blue. h Enrichment of nascent strands determined by SNS-qPCR at genomic positions indicated in Fig. 2g, in siRNA-treated HCT116 cells. Data were presented as mean values ( n = 5 biologically independent experiments) ±SEM. ns denotes p value > 0.05, * denotes p value <0.05, ** denotes p value < 0.01, derived from paired two-tailed Student’s t -test.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Transfection, Derivative Assay, Two Tailed Test, MANN-WHITNEY, Western Blot

a 3D model of human ORC1 showing domains in colors, and residues R441, R444, and R465 (involved in RNA-binding) in red. Below, the vertebrate consensus of ORC1 RNA-binding region, circles indicating mutated residues in MUT-ORC1. b RNA staining of EMSA assays, with GST-tagged purified WT and MUT-ORC1 (amino acids 413–511) (2.5 µM) incubated with fragmented cellular RNA (2.5 µM). Below, the silver staining of proteins used in the assay. c Cross-correlation between ORC1 and EU-labeled RNA (long pulse) in G1-synchronized U2OS cells, untransfected or transfected with Halo-tagged WT and MUT-ORC1, comparing STORM experimental (EXP) and randomized (RND) samples. Data were presented as mean values ( n > 50 cells) ± SEM. ns denotes p value >0.05, ** denotes p value <0.01, derived from unpaired two-sample t -test. d DNA fiber quantification of inter-origin distances and fork rates in HCT116 cells transfected with the indicated siRNAs, ±plasmids expressing Flag-tagged WT or MUT-ORC1. Black lines indicate the median. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. e Browser snapshot at ORC1-RNA PABPC1 , NFAT5 , and DDX5-CEP95 loci, showing SNS-seq normalized signal of HCT116 cells stably expressing WT or MUT-ORC1. f GSEA showing enrichment of ORC1-RNAs in merged iCLIP-defined quantiles (Q), toward ranked genes according to their WT vs MUT (log2 fold change) SNS-seq coverage at TSSs. Statistical significance (adjusted p value 1.13e-18 or 0.003) of the enrichment scores (ES) were calculated by permutation tests. g CDC45 and PCNA chromatin immunofluorescences per cell, in HCT116 cells stably expressing WT or MUT-ORC1, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ± SEM. *** denotes p value <0.001, derived from unpaired two-tailed Mann–Whitney t -test. h Coverage plot of CDC45 ChIP-seq data at TSSs, in WT or MUT-ORC1 HCT116 stably expressing cells, and two-tailed t -test statistical results between their coverage at TSSs of ORC1 iCLIP-defined gene quantiles (Q).

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a 3D model of human ORC1 showing domains in colors, and residues R441, R444, and R465 (involved in RNA-binding) in red. Below, the vertebrate consensus of ORC1 RNA-binding region, circles indicating mutated residues in MUT-ORC1. b RNA staining of EMSA assays, with GST-tagged purified WT and MUT-ORC1 (amino acids 413–511) (2.5 µM) incubated with fragmented cellular RNA (2.5 µM). Below, the silver staining of proteins used in the assay. c Cross-correlation between ORC1 and EU-labeled RNA (long pulse) in G1-synchronized U2OS cells, untransfected or transfected with Halo-tagged WT and MUT-ORC1, comparing STORM experimental (EXP) and randomized (RND) samples. Data were presented as mean values ( n > 50 cells) ± SEM. ns denotes p value >0.05, ** denotes p value <0.01, derived from unpaired two-sample t -test. d DNA fiber quantification of inter-origin distances and fork rates in HCT116 cells transfected with the indicated siRNAs, ±plasmids expressing Flag-tagged WT or MUT-ORC1. Black lines indicate the median. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, **** denotes p value <0.0001, derived from unpaired two-tailed Mann–Whitney t -test. e Browser snapshot at ORC1-RNA PABPC1 , NFAT5 , and DDX5-CEP95 loci, showing SNS-seq normalized signal of HCT116 cells stably expressing WT or MUT-ORC1. f GSEA showing enrichment of ORC1-RNAs in merged iCLIP-defined quantiles (Q), toward ranked genes according to their WT vs MUT (log2 fold change) SNS-seq coverage at TSSs. Statistical significance (adjusted p value 1.13e-18 or 0.003) of the enrichment scores (ES) were calculated by permutation tests. g CDC45 and PCNA chromatin immunofluorescences per cell, in HCT116 cells stably expressing WT or MUT-ORC1, after soluble protein washout. Data were presented as mean values ( n > 100 cells) ± SEM. *** denotes p value <0.001, derived from unpaired two-tailed Mann–Whitney t -test. h Coverage plot of CDC45 ChIP-seq data at TSSs, in WT or MUT-ORC1 HCT116 stably expressing cells, and two-tailed t -test statistical results between their coverage at TSSs of ORC1 iCLIP-defined gene quantiles (Q).

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: RNA Binding Assay, Staining, Purification, Incubation, Silver Staining, Labeling, Transfection, Derivative Assay, Expressing, Two Tailed Test, MANN-WHITNEY, Stable Transfection, ChIP-sequencing

a p53 and ORC1-3xFlag protein quantification from western blots with total extracts of HCT116 cells, transfected with WT or MUT-ORC1, and treated with cycloheximide (CHX) or MG-132. Dots represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. b Western blot on chromatin extracts of HCT116 cells, transfected with Flag-tagged WT-ORC1 and MUT-ORC1, unsynchronized (Uns) or synchronized in G1/S and released at different times (T as in Supplementary Fig. ). Below, normalized protein quantification. Dots represent mean values ( n = 4 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, derived from paired two-tailed Student’s t -test. c Western blot and quantification of endogenous ORC1 on chromatin in different stages of the cell cycle (T as in Supplementary Fig. ), upon depletion of GAA-RNAs (ASO anti-GAA) or control conditions (ASO CTRL). Bars represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. d Western blot showing the effect of RNase A treatment on WT and MUT-ORC1 chromatin association, along the cell cycle of synchronized cells (T as in Supplementary Fig. ). Quantification of independent biological replicates ( n = 4) is shown in Supplementary Fig. . e Representation of the IDR in WT and MUT-ORC1, showing RNA-binding regions (orange), and the discrete positions of RNA-binding mutations (black) and phosphorylated residues (red) detected by mass spectrometry, in control or GAA-knockdown conditions. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: ORC1 binds to cis -transcribed RNAs for efficient activation of replication origins

doi: 10.1038/s41467-023-40105-3

Figure Lengend Snippet: a p53 and ORC1-3xFlag protein quantification from western blots with total extracts of HCT116 cells, transfected with WT or MUT-ORC1, and treated with cycloheximide (CHX) or MG-132. Dots represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. b Western blot on chromatin extracts of HCT116 cells, transfected with Flag-tagged WT-ORC1 and MUT-ORC1, unsynchronized (Uns) or synchronized in G1/S and released at different times (T as in Supplementary Fig. ). Below, normalized protein quantification. Dots represent mean values ( n = 4 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, derived from paired two-tailed Student’s t -test. c Western blot and quantification of endogenous ORC1 on chromatin in different stages of the cell cycle (T as in Supplementary Fig. ), upon depletion of GAA-RNAs (ASO anti-GAA) or control conditions (ASO CTRL). Bars represent mean values ( n = 3 biologically independent experiments) ± SEM. ns denotes p value >0.05, * denotes p value <0.05, ** denotes p value <0.01, derived from paired two-tailed Student’s t -test. d Western blot showing the effect of RNase A treatment on WT and MUT-ORC1 chromatin association, along the cell cycle of synchronized cells (T as in Supplementary Fig. ). Quantification of independent biological replicates ( n = 4) is shown in Supplementary Fig. . e Representation of the IDR in WT and MUT-ORC1, showing RNA-binding regions (orange), and the discrete positions of RNA-binding mutations (black) and phosphorylated residues (red) detected by mass spectrometry, in control or GAA-knockdown conditions. Source data are provided as a Source Data file.

Article Snippet: Samples were de-crosslinked overnight at 65 °C, followed by phenol:chloroform DNA extraction and ethanol precipitation. qPCR of precipitated DNA was done as cDNA samples (see RNA processing section), with self-designed primers at genomic DNA replication origins or control regions (Supplementary Data ), having SNS-seq data in wild-type HCT116 cells as a reference and purchased from Metabion.

Techniques: Western Blot, Transfection, Derivative Assay, Two Tailed Test, RNA Binding Assay, Mass Spectrometry