Journal: eLife

Article Title: Differentiation of mouse fetal lung alveolar progenitors in serum-free organotypic cultures

doi: 10.7554/eLife.65811

Figure Lengend Snippet: ( A ) IC261, CX-4945, and DMAT treatments (48 h) lead to downregulation of AT2 cell markers. TTP22 and Emodin (also CK2 inhibitors) do not lead to the same phenotype, possibly due to differences in potency/target affinity. Expression levels relative to DMSO control. Three biological replicates (consisting of 2 technical replicates each) were analyzed per compound. ( B ) Casein Kinase inhibition by IC261, CX-4945, and DMAT (6 h) leads to reduced Axin2 relative expression. Treatment with TTP22 or Emodin does not significantly affect Axin2 levels. More than three biological replicates were analyzed. ( C ) CK inhibition reduced WNT/β-catenin-dependent transcription in HEK293T epithelial cells (SuperTOPFlash-based luciferase assay). ( B ) Mean values are displayed; error bars represent S.D.; p - values from one-way ANOVA, Tukey’s multiple comparisons test. ( C ) Mean values displayed; error bars represent S.D.; p-values from one-way ANOVA, Tukey’s multiple comparisons test; displayed p-values refer to comparisons with WNT3A-treated condition. Figure 4—source data 1. Normalized expression values of AT2 cell markers, CK inhibitors vs. DMSO control. Normalized Axin2 expression values, CK inhibitors vs. DMSO control and related statistics. Raw luciferase data. Normalized luciferase values and related statistics.

Article Snippet: Chemical compound, drug , TTP22 , Tocris , Tocris:4432 , (10 μM).

Techniques: Expressing, Control, Inhibition, Luciferase

Journal: eLife

Article Title: Differentiation of mouse fetal lung alveolar progenitors in serum-free organotypic cultures

doi: 10.7554/eLife.65811

Figure Lengend Snippet:

Article Snippet: Chemical compound, drug , TTP22 , Tocris , Tocris:4432 , (10 μM).

Techniques: Recombinant, Transfection, Construct, Plasmid Preparation, Mutagenesis, Reporter Assay, Reverse Transcription, SYBR Green Assay, Sequencing, Software

Journal: Frontiers in Microbiology

Article Title: Intestinal Flora-Derived Kynurenic Acid Protects Against Intestinal Damage Caused by Candida albicans Infection via Activation of Aryl Hydrocarbon Receptor

doi: 10.3389/fmicb.2022.934786

Figure Lengend Snippet: KynA suppressed the MK2/p-MK2 signaling pathway by activating AHR. We investigated the regulation of TTP and expression changes of MK2 and P-MK2 induced by AHR activation at the cellular level. In Caco-2 cells, after treatment with KynA, expression of CYP1A1 increased significantly, as did expression of TTP also ( P < 0.05), while expression of MK2 decreased significantly ( P < 0.05). In the CA- Caco-2 cell model, the expression of proteins CYP1A1 and TTP decreased significantly, but the expression of p-MK2 increased ( P < 0.01). After the treatment of Caco-2 cells with KynA and the AHR agonist FICZ, the expression of CYP1A1 and TTP was significantly increased, but the expression of p-MK2 decreased significantly ( P < 0.01). Treatment with an AHR inhibitor (CH223191) led to a decrease in the expression of CYP1A1 and TTP, and an increase in the expression of p-MK2 ( P < 0.01). Statistical significance was evaluated using the Mann–Whitney U test. P -values < 0.05 (*) or < 0.01 (**) were considered statistically significant. CA, Candida albicans infection; KynA, Kynurenic acid; FICZ, 6-Formylindolo[3,2-b]carbazole. P -values < 0.001 (***).

Article Snippet: Proteintech, United States); anti-AHR antibody (1:1,000, 67785-1-Ig; Proteintech, United States); anti-ZO-1 antibody (1:1,000, 21773-1-AP, Proteintech, United States); anti-GAPDH antibody (1:1,000, 60004-1-Ig, Proteintech, United States); anti-MK2 antibody (1:1,000, 13949-1-AP, Proteintech, United States); anti-CYP1A1 antibody (1:1,000, 13241-1-AP, Proteintech, United States); anti-TTP antibody (1:1,000, 12737-1-AP; Proteintech, United States); anti-MLCK antibody (1:1,000, 21642-1-AP; Proteintech, United States); and anti-pMLC antibody (1:2,000, CST-3671; Cell Signaling Technology, United States).

Techniques: Expressing, Activation Assay, MANN-WHITNEY, Infection

Journal: Nucleic Acids Research

Article Title: Ectopic over-expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28

doi: 10.1093/nar/gkr1302

Figure Lengend Snippet: TTP negatively regulates the levels of Lin28a in human cancer cells. ( A–D ) Overexpression of TTP inhibits Lin28a levels in PA1 cells. PA1 cells were transfected with pcDNA6/V5-TTP or pcDNA6/V5 for 24 h. (A) The levels of TTP, Drosha, Dicer, Ago2 and Lin28a proteins were determined by western blot assays. (B) The expression levels of TTP and Lin28a were determined by semi-qRT-PCR. (C) The level of Lin28a was determined by qRT-PCR. The levels obtained from PA1/pcDNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (** P < 0.01). (D) Overexpression of TTP decreases Lin28b levels in PA1 cells. The level of TTP and Lin28b were determined by RT-PCR (top panel) and western blot (bottom panel). ( E–I ) Downregulation of TTP by siRNA increases Lin28a levels and decreases let-7b in HCT116 cells. HCT116 cells were transfected with TTP-specific (TTP-siRNA) or scRNA. After 24 h, the levels of TTP and Lin28a were determined by qRT-PCR (E and F) and western blot assays (G). The level of let-7b was determined by qRT-PCR (H) and cell viability was assessed by measuring absorbance at 490 nm using a MTS cell proliferation assay (I). The levels obtained from mock-transfected HCT116 cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (** P < 0.01; *** P < 0.001). ns, not significant. ( J ) The level of TTP protein is inversely correlated with those of Lin28a protein within several human cell lines. Levels of TTP and Lin28a proteins were determined by western blot analysis in PA1 (ovarian teratocarcinoma), MCF7 (breast adenocarcinoma), AGS (gastric adenocarcinoma), K562 (erythroleukemia), HepG2 (hepatocellular carcinoma) and NT2 (neuronally committed teratocarcinoma) cells. β-Actin was detected as the loading control. ( K ) TTP expression level is inversely correlated with that of Lin28a in human ovarian tissues. Representative TTP and Lin28a immunohistochemical staining in normal and ovarian adenocarcinoma tissues. Normal ovarian tissues showed strong immunoreactivity for TTP, where as the ovarian adenocarcinoma showed strong positive staining for Lin28a.

Article Snippet: After deparaffinization, primary antibody anti-human TTP antibody (sc-14030, Santa Cruz Biotechnology) or anti-human Lin28a antibody (ab46020, Abcam) at a 1:100 dilution was applied for 2°h at room temperature.

Techniques: Over Expression, Transfection, Western Blot, Expressing, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Proliferation Assay, Control, Immunohistochemical staining, Staining

Journal: Nucleic Acids Research

Article Title: Ectopic over-expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28

doi: 10.1093/nar/gkr1302

Figure Lengend Snippet: TTP and Lin28a expression and clinicopathologic features of patients with ovarian adenocarcinoma

Article Snippet: After deparaffinization, primary antibody anti-human TTP antibody (sc-14030, Santa Cruz Biotechnology) or anti-human Lin28a antibody (ab46020, Abcam) at a 1:100 dilution was applied for 2°h at room temperature.

Techniques: Expressing, Significance Assay, Staining

Journal: Nucleic Acids Research

Article Title: Ectopic over-expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28

doi: 10.1093/nar/gkr1302

Figure Lengend Snippet: TTP enhances the decay of Lin28a mRNA through interaction with an ARE within the Lin28a mRNA 3′-UTR. ( A and B ) TTP destabilizes Lin28a mRNA. PA1 cells were transfected with pcDNA6/V5-TTP or pcDNA6/V5 for 24 h. (A) The level of TTP protein was determined by western blot assays. (B) Expression of Lin28a mRNA in PA1 cells was determined by qRT-PCR and mRNA half-life was calculated from the non-linear regression of the mRNA levels at the indicated times after the addition of 5.0 µg/ml actinomycin D. A one-phase model of exponential decay was used to derive the indicated mRNA decay curves. Results shown on the graph represent the means ± SD of three independent experiments (** P < 0.01; *** P < 0.001). ( C ) Inhibition of TTP by siRNA enhances Lin28a mRNA stability. HCT116 cells were transfected with siRNA against TTP-specific (TTP-siRNA) or scRNA for 24 h. Expression of Lin28a mRNA in HCT116 cells was determined by qRT-PCR and mRNA half-life was calculated as described in (B). Results shown on the graph represent the means ± SD of three independent experiments (* P < 0.05). ( D ) Lin28a mRNA half-life in PA1 cell with low TTP level is longer than that in AGS cells with high TTP level. Expression of Lin28a mRNA in PA1 and AGS cells was determined by qRT-PCR and mRNA half-life was calculated as described in (B). Results shown on the graph represent the means ± SD of three independent experiments (*** P < 0.001). ( E and F ) The first AUUUA pentamer (ARE1) within the Lin28a 3′-UTR is essential for the inhibitory effect of TTP. (E) Schematic representation of the luciferase reporter constructs used in this study. Fragments (Frag) and oligonucleotides (Oligo) derived from the Lin28a mRNA 3′-UTR were cloned downstream of the luciferase reporter gene in the psiCHECK2 luciferase expression vector. White circles, wild-type (W) pentameric motif AUUUA; gray circles, mutated (M) motif AGCA. (F) PA1 cells were co-transfected with pcDNA6/V5-TTP and a psiCHECK2 luciferase reporter constructs containing fragments (left panel) or oligonucleotides (right panel) derived from the Lin28a mRNA 3′-UTR as described in (E) for 24 h. After normalizing luciferase activity, the luciferase activity obtained from PA1 cells transfected with the Frag-ARE1 luciferase construct alone or Oligo-ARE1W alone were set to 1.0. Results shown represent the means ± SD of three independent experiments (* P < 0.05; ** P < 0.01). ns, not significant. ( G and H ) TTP decreases the luciferase activity of luciferase reporter gene containing the Lin28b 3′-UTR. (G) Schematic representation of the luciferase reporter constructs used in this study. Fragments (Frag) derived from the Lin28b mRNA 3′-UTR were cloned downstream of the luciferase reporter gene in the psiCHECK2 luciferase expression vector. White circles, wild-type pentameric motif AUUUA. (H) PA1 cells were co-transfected with pcDNA6/V5-TTP and a psiCHECK2 luciferase reporter constructs containing fragments derived from the Lin28b mRNA 3′-UTR as described in (G) for 24 h. After normalizing luciferase activity, the luciferase activity obtained from PA1 cells transfected with each Frag-ARE luciferase construct alone was set to 1.0. Results shown represent the means ± SD of three independent experiments (** P < 0.01; *** P < 0.001). ( I ) Ribonucleoprotein immunoprecipitation assay. PA1 cells were cotransfected with pcDNA6/V5-TTP and psiCHECK2 luciferase reporter constructs containing Lin28a Oligo-ARE1W. psiCHECK2 luciferase reporter construct containing mutant ARE1, Oligo-ARE1M was used as a negative control. At 24 h after transfection, the ribonucleoprotein complexes containing TTP were immunoprecipitated with protein G-agarose and anti-V5 or a control antibody. The luciferase mRNA in the immunoprecipitates was amplified by RT-PCR. The presence of TTP in the immunoprecipitates was detected by western blot with anti-V5 antibody. ( J and K ) RNA EMSA was performed by mixing cytoplasmic extracts containing 3.0 µg of total protein from pcDNA6/V5-TTP-transfected PA1 cells (J) or HCT116 cells (K) with 80 fmol biotinylated wild-type Oligo-ARE1W (WT) or mutant Oligo-ARE1M (MUT) probe. Anti-V5 (J), anti-TTP (K) or control antibody was added to the reaction mixtures. Position of the TTP containing bands (TTP) and super-shifted bands (SS) are indicated.

Article Snippet: After deparaffinization, primary antibody anti-human TTP antibody (sc-14030, Santa Cruz Biotechnology) or anti-human Lin28a antibody (ab46020, Abcam) at a 1:100 dilution was applied for 2°h at room temperature.

Techniques: Transfection, Western Blot, Expressing, Quantitative RT-PCR, Inhibition, Luciferase, Construct, Derivative Assay, Clone Assay, Plasmid Preparation, Activity Assay, Immunoprecipitation, Mutagenesis, Negative Control, Control, Amplification, Reverse Transcription Polymerase Chain Reaction

Journal: Nucleic Acids Research

Article Title: Ectopic over-expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28

doi: 10.1093/nar/gkr1302

Figure Lengend Snippet: Overexpression of Lin28a attenuates the effects of TTP on let-7 b levels, CDC34 levels and PA1 cell growth. ( A–C ) Downregulation of Lin28a by siRNA increases let-7b levels but decreases CDC34 levels in PA1 cells. PA1 cells were transfected with Lin28a -specific (Lin28a-siRNA) or scRNA for 24 h. (A) The level of Lin28a was determined by qRT-PCR (top panel) and western blot assays (bottom panel). The levels obtained from PA1/scRNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (*** P < 0.001). (B) The level of mature let-7b was measured by qRT-PCR. The levels obtained from PA1/scRNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (* P < 0.05). (C) The level of CDC34 was determined by qRT-PCR. The levels obtained from PA1/scRNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (*** P < 0.001). ( D–F ) Transfection of Lin28a cDNA without the 3′-UTR abolishes the effects of TTP on expression of let-7b , CDC34 and PA1 cell growth. PA1 cells were transfected with a combination of pcDNA6/V5-TTP and pcDNA3/Flag-Lin28a for 24 h. (D) The levels of TTP and Lin28a were measured by semi-qRT-PCR (top panel) and western blot assays (bottom panel). (E) The level of let-7b was measured by qRT-PCR. The levels obtained from PA1/pcDNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (* P < 0.05; ** P < 0.01). (F) Cell viability was assessed by measuring absorbance at 490 nm using a MTS cell proliferation assay. The levels obtained from PA1/pcDNA cells were set to 1.0. Data are presented as the mean ± SD ( n = 3) (** P < 0.01; *** P < 0.001).

Article Snippet: After deparaffinization, primary antibody anti-human TTP antibody (sc-14030, Santa Cruz Biotechnology) or anti-human Lin28a antibody (ab46020, Abcam) at a 1:100 dilution was applied for 2°h at room temperature.

Techniques: Over Expression, Transfection, Quantitative RT-PCR, Western Blot, Expressing, Proliferation Assay

Journal: Molecular Biology of the Cell

Article Title: Tristetraprolin-mediated hexokinase 2 expression regulation contributes to glycolysis in cancer cells

doi: 10.1091/mbc.e18-09-0606

Figure Lengend Snippet: Figure 2. Inhibition of TTP by siRNA increases glycolytic capacity in cancer cells. MCF-

Article Snippet: Small interfering RNAs (siRNAs) against human TTP (TTP-siRNA, sc-36760) and control siRNA (scRNA, sc-37007) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

Techniques: Inhibition

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Forest plots depicting RNA and IHC-based for ZFP36 /TTP expression related to clinical outcomes (biochemical recurrence and disease-free survival) and risk of lethal prostate cancer (case-control cohorts). (B) (left) Upregulated and downregulated genes were identified by differential expression analysis of TCGA PRAD cases divided by lower quartile expression of ZFP36 ; (right). (C) Representative images of IF staining in human PCa used for expression analysis. Benign glands (arrowheads) stain for pan-cytokeratin (yellow) and basal (red) cocktails; tumor cells (arrows) demonstrate absent basal expression (panels ii & iv). Corresponding sections (i & iii) demonstrate intact epithelial staining for TTP (green). Panels v-vi: Diffuse prostate tumor with absent TTP expression. (D) Kaplan Meier survival analysis demonstrating that TTP deficiency, measured by protein expression (DFCI ( , )) and ZFP36 mRNA expression (TCGA PRAD ; Taylor et al ), results in shorter disease-free-survival, and even shorter disease-free-survival in combination with PTEN deficiency.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Expressing, Control, Quantitative Proteomics, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) hematoxylin and eosin staining of murine tumors highlighting morphological progression of wild-type (WT), Pten f/f / Zfp36 +/+ ( Pten -/-), Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 +/-) and Pten f/f / Zfp36 f/+ ( Pten -/- Zfp36 -/-) dorsolateral prostate tissue at 8 18, and 38 weeks. Scale bar 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. (C) Kaplan Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time-to-ethical endpoint in PCa driven by loss of Pten. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phos-p65 IF and Masson’s Trichrome staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) GSEA from RNA-seq of endpoint GEMM PCa tumors comparing Pten -/-, and Pten -/- Zfp36 -/- GEMMs, highlighting significant positively and negatively enriched GOBP pathways. (B) Ki-67 IHC, and Krt18 and αSMA IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Increased tumor cell proliferation and basement membrane breakdown is observed with loss of Zfp36 . (C) Number of mice that displayed PCa cells in distant organs by recombination PCR in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMMs. (D) Representative androgen receptor (AR) IF staining in pelvic lymph nodes of Pten -/- and Pten -/- Zfp36 -/- GEMMs highlighting local dissemination of prostate cells. Scale bar 100 μm. AR staining was over exposed during imaging to assist with prostate cell identification. (E) Representative images and quantification of budding in GEMM-derived organoids highlighting increased invasive and metastatic potential of Pten -/- Zfp36 -/-organoids. (F) Scratch assay in GEMM-derived 2D cells, comparing Pten -/- and Pten -/- Zfp36 -/- wound healing with that of Pten -/- Rb1 -/-, a previously described metastatic, neuroendocrine PCa murine cell line . *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: RNA Sequencing, Staining, Membrane, Imaging, Derivative Assay, Wound Healing Assay

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) AR, synaptophysin (Syp) and CD45 IF staining PCa in Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bar 100 μm. *p<0.05, **p<0.005. (B) Dual Krt8 and CD45 IF staining in Pten -/- and Pten -/- Zfp36 -/- GEMM dorsolateral prostate tissue at 38 weeks. Scale bar 50 μm.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Staining

Journal: bioRxiv

Article Title: Loss of tristetraprolin activates NF-κB induced phenotypic plasticity and primes transition to lethal prostate cancer

doi: 10.1101/2022.08.05.500896

Figure Lengend Snippet: (A) Kaplan Meier graph from GEMM aging studies where mice were surgically castrated at 38 weeks comparing Pten -/-, Pten -/- Zfp36 +/- and Pten -/- Zfp36 -/- mice, and whole prostate weights and representative images from mice 12 weeks post-castration. (B) Quantification of GEMM-derived Pten -/- and Pten -/- Zfp36 -/- organoid growth in the presence and absence of enzalutamide (10 μM). (C) Allograft tumor growth in mice treated with DMAPT (100 mg/kg/day) or water vehicle ± surgical castration, n=5 mice per treatment group. (D) End-point tumor volumes from allograft therapy studies. (E) Representative images and (F) quantification of cell death (green) in GEMM-derived PCa organoids treated with DMAPT (5 μM), enzalutamide (10 μM) or the combination of both for 72 hours, n=10 organoids per treatment group. (G) Representative images and flow cytometry quantification for CD45, synaptophysin, and AR expression in GEMM-derived PCa organoids treated with DMAPT (5 μM) or DMSO vehicle for 72 hours. (H) Fold-change in expression of the AR response gene – Fkbp5 in GEMM-derived 2D cell lines treated with DMAPT (5 μM) or DMSO vehicle for 72 hours, R1881 (10nM was used to stimulate AR activity. *p<0.05, **p<0.005, ***p<0.001. (I) Schematic overview: i) when ZFP36 is intact epithelial cells present with a luminal lineage phenotype and sensitivity to AR inhibition. ii) loss of ZFP36 results in an alternative epithelial cell lineage phenotype with reduced AR expression, increased SYP and CD45 expression, and increased NF-κB activation and inflammation, leading to lack of response to AR inhibition. iii) DMAPT treatment inhibits NF-κB and inflammation signaling and restores a more luminal epithelial cell type and responsiveness to AR inhibition.

Article Snippet: For CRISPR/Cas9-mediated knockout cell line generation, guide RNA (gRNA) sequences CATGACCTGTCATCCGACCA, AAGCGGGCGTTGTCGCTACG and GAGCTCGGTCTTGTATCGAG targeting murine Zfp36 and human ZFP36 respectively, were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, #52961) according to the Zhang lab protocol.

Techniques: Derivative Assay, Flow Cytometry, Expressing, Activity Assay, Inhibition, Activation Assay

Journal: Mitochondrion

Article Title: Splitting the functions of Rim2, a mitochondrial iron/pyrimidine carrier

doi: 10.1016/j.mito.2018.12.005

Figure Lengend Snippet: Isolated mitochondria, from strain YS102–46 (mrs3Δ mrs4Δ GAL-RIM2) transformed with YEp351 (Vec), and YEp351 bearing: Rim2 (WT), Rim2 (E248A), Rim2 (K299A) and grown in the absence of galactose, were preloaded with 3H-dTTP. The 3H-dTTP was washed away and the mitochondria were resuspended in HS buffer containing 50 mM NaCl to which 100 μm TDP, 100 μM TTP or nothing (−) had been added. After 10 min incubation at room temperature, the mitochondria were pelleted and 3H-TTP exported to the supernatant was quantified by liquid scintillation counting. (A) Results are expressed as a percentage of the total 3H-TTP initially loaded into the mitochondria, with 3H-dTTP remaining in mitochondria (dark gray) or 3H-dTTP exchanged to supernatant (light gray). Error bars indicate SD (n=3). (B) A single typical exchange experiment is shown with results expressed as cpm 3H-TTP retained in mitochondria (dark gray) or exported to the supernatant (light gray).

Article Snippet: Intact mitochondria in HS buffer containing 50 mM NaCl were incubated with 260 nM tritiated TTP (thymidine 5’ triphosphate [methyl 3 H] tetra sodium salt, MP Biomedical) or 48 nM dTTP (deoxy-thymidine 5’ triphosphate [methyl 3 H] tetra sodium salt, MP Biomedical) for 5 min at room temperature.

Techniques: Isolation, Transformation Assay, Incubation