96
|
ATCC
triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414 Triredraft 44705 Trire D5 6 P1 Cacagctctcgacctctctt Trichoderma Reesei Qm9414, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/pmc06616335__41598_2019_46435_MOESM1_ESM-92-64-70?v=ATCC Average 96 stars, based on 1 article reviews
triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
93
|
ATCC
trire2 Trire2, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/pmc06260743__12915_2018_593_MOESM2_ESM-48-207-206?v=ATCC Average 93 stars, based on 1 article reviews
trire2 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
90
|
EnTec GmbH Co KG
trirex 3022pj(01) Trirex 3022pj(01), supplied by EnTec GmbH Co KG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/us10808101-0-25-27?v=EnTec+GmbH+Co+KG Average 90 stars, based on 1 article reviews
trirex 3022pj(01) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Biesterfeld Spezialchemie
pellets of pc trirex 3025n2 Pellets Of Pc Trirex 3025n2, supplied by Biesterfeld Spezialchemie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/pm39880925-59-0-9?v=Biesterfeld+Spezialchemie Average 90 stars, based on 1 article reviews
pellets of pc trirex 3025n2 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Chemie GmbH
zinc borate Zinc Borate, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/10__1080_slash_1023666x__2017__1295339-38-11-24?v=Chemie+GmbH Average 90 stars, based on 1 article reviews
zinc borate - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
ATCC
tcu1 gene Tcu1 Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/pm27942754-36-23-37?v=ATCC Average 90 stars, based on 1 article reviews
tcu1 gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
arabinosidase b (abfb; trire2|55139) Arabinosidase B (Abfb; Trire2|55139), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/trirep/pm20678930-46-3-26?v=GenScript+corporation Average 90 stars, based on 1 article reviews
arabinosidase b (abfb; trire2|55139) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |