trirep Search Results


96
ATCC triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414
Triredraft 44705 Trire D5 6 P1 Cacagctctcgacctctctt Trichoderma Reesei Qm9414, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pmc06616335__41598_2019_46435_MOESM1_ESM-92-64-70?v=ATCC
Average 96 stars, based on 1 article reviews
triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

trire2  (ATCC)
93
ATCC trire2
Trire2, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pmc06260743__12915_2018_593_MOESM2_ESM-48-207-206?v=ATCC
Average 93 stars, based on 1 article reviews
trire2 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
EnTec GmbH Co KG trirex 3022pj(01)
Trirex 3022pj(01), supplied by EnTec GmbH Co KG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/us10808101-0-25-27?v=EnTec+GmbH+Co+KG
Average 90 stars, based on 1 article reviews
trirex 3022pj(01) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Biesterfeld Spezialchemie pellets of pc trirex 3025n2
Pellets Of Pc Trirex 3025n2, supplied by Biesterfeld Spezialchemie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pm39880925-59-0-9?v=Biesterfeld+Spezialchemie
Average 90 stars, based on 1 article reviews
pellets of pc trirex 3025n2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Chemie GmbH zinc borate
Zinc Borate, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/10__1080_slash_1023666x__2017__1295339-38-11-24?v=Chemie+GmbH
Average 90 stars, based on 1 article reviews
zinc borate - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
ATCC tcu1 gene
Tcu1 Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pm27942754-36-23-37?v=ATCC
Average 90 stars, based on 1 article reviews
tcu1 gene - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation arabinosidase b (abfb; trire2|55139)
Arabinosidase B (Abfb; Trire2|55139), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pm20678930-46-3-26?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
arabinosidase b (abfb; trire2|55139) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier


Image Search Results