trirep Search Results


97
ATCC triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414
Triredraft 44705 Trire D5 6 P1 Cacagctctcgacctctctt Trichoderma Reesei Qm9414, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/P-1/pmc06616335__41598_2019_46435_MOESM1_ESM-92-64-70
Average 97 stars, based on 1 article reviews
triredraft 44705 trire d5 6 p1 cacagctctcgacctctctt trichoderma reesei qm9414 - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

92
ATCC triredraft 44705 trire seq f1 ctcccacagccagaagaaag trichoderma reesei qm9414
Triredraft 44705 Trire Seq F1 Ctcccacagccagaagaaag Trichoderma Reesei Qm9414, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/Malbranchea+cinnamomea/pmc06616335__41598_2019_46435_MOESM1_ESM-93-40-46
Average 92 stars, based on 1 article reviews
triredraft 44705 trire seq f1 ctcccacagccagaagaaag trichoderma reesei qm9414 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
EnTec GmbH Co KG trirex 3022pj(01)
Trirex 3022pj(01), supplied by EnTec GmbH Co KG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/trirex+3022pj+01+/us10808101-0-25-27
Average 90 stars, based on 1 article reviews
trirex 3022pj(01) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

trire2  (ATCC)
93
ATCC trire2
Trire2, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/Chlamydomonas+reinhardtii/pmc06260743__12915_2018_593_MOESM2_ESM-48-207-206
Average 93 stars, based on 1 article reviews
trire2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Biesterfeld Spezialchemie pellets of pc trirex 3025n2
Pellets Of Pc Trirex 3025n2, supplied by Biesterfeld Spezialchemie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/pellets+of+pc+trirex+3025n2/pm39880925-59-0-9
Average 90 stars, based on 1 article reviews
pellets of pc trirex 3025n2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Chemie GmbH zinc borate
Zinc Borate, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/zinc+borate/10__1080_slash_1023666x__2017__1295339-38-11-24
Average 90 stars, based on 1 article reviews
zinc borate - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
ATCC tcu1 gene
Tcu1 Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/Rhizopus+circinans+van+Tieghem%2C+teleomorph/pm27942754-36-23-37
Average 90 stars, based on 1 article reviews
tcu1 gene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation arabinosidase b (abfb; trire2|55139)
Arabinosidase B (Abfb; Trire2|55139), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/trirep/arabinosidase+b++abfb++trire2+55139+/pm20678930-46-3-26
Average 90 stars, based on 1 article reviews
arabinosidase b (abfb; trire2|55139) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier


Image Search Results