tmpy Search Results


94
TargetMol mil 36ra
Mil 36ra, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mil 36ra/product/TargetMol
Average 94 stars, based on 1 article reviews
mil 36ra - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
TargetMol a24
Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or <t>A24</t> on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.
A24, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a24/product/TargetMol
Average 93 stars, based on 1 article reviews
a24 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol neurogro neuronal basic culture medium
Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or <t>A24</t> on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.
Neurogro Neuronal Basic Culture Medium, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/neurogro neuronal basic culture medium/product/TargetMol
Average 93 stars, based on 1 article reviews
neurogro neuronal basic culture medium - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol s8790 keap1 targetmol cat
Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or <t>A24</t> on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.
S8790 Keap1 Targetmol Cat, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s8790 keap1 targetmol cat/product/TargetMol
Average 93 stars, based on 1 article reviews
s8790 keap1 targetmol cat - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol gm csf
Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or <t>A24</t> on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.
Gm Csf, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gm csf/product/TargetMol
Average 93 stars, based on 1 article reviews
gm csf - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol paper pu 1 gtcagaacgatcactcttgg gtaagtcatctgtggattggt
Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or <t>A24</t> on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.
Paper Pu 1 Gtcagaacgatcactcttgg Gtaagtcatctgtggattggt, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper pu 1 gtcagaacgatcactcttgg gtaagtcatctgtggattggt/product/TargetMol
Average 93 stars, based on 1 article reviews
paper pu 1 gtcagaacgatcactcttgg gtaagtcatctgtggattggt - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
TargetMol kdm1a wt
Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT <t>for</t> <t>KDM1A-WT</t> rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.
Kdm1a Wt, supplied by TargetMol, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kdm1a wt/product/TargetMol
Average 90 stars, based on 1 article reviews
kdm1a wt - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
TargetMol s100a8 a9 inhibitor
Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT <t>for</t> <t>KDM1A-WT</t> rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.
S100a8 A9 Inhibitor, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s100a8 a9 inhibitor/product/TargetMol
Average 93 stars, based on 1 article reviews
s100a8 a9 inhibitor - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol rmif
Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT <t>for</t> <t>KDM1A-WT</t> rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.
Rmif, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rmif/product/TargetMol
Average 93 stars, based on 1 article reviews
rmif - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
TargetMol human targetmol tmpy 06830 ptpn12
Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT <t>for</t> <t>KDM1A-WT</t> rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.
Human Targetmol Tmpy 06830 Ptpn12, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human targetmol tmpy 06830 ptpn12/product/TargetMol
Average 93 stars, based on 1 article reviews
human targetmol tmpy 06830 ptpn12 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

91
TargetMol shp2 sirna
FIGURE 1 | <t>SHP2</t> expression is increased in primary chondrocytes after IL-1β treatment and in mouse OA cartilage. (A) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (B) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with various doses of IL-1β for 24 h. (C) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (D) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with 5 ng/ml IL-1β for different time points. *P < 0.05, **P < 0.01 versus chondrocytes without IL-1β treatment. (E) Representative immunofluorescence images of SHP2 in articular cartilage in DMM and Sham mice, scale bar = 100 µm.
Shp2 Sirna, supplied by TargetMol, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shp2 sirna/product/TargetMol
Average 91 stars, based on 1 article reviews
shp2 sirna - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

93
TargetMol tmpy
FIGURE 1 | <t>SHP2</t> expression is increased in primary chondrocytes after IL-1β treatment and in mouse OA cartilage. (A) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (B) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with various doses of IL-1β for 24 h. (C) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (D) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with 5 ng/ml IL-1β for different time points. *P < 0.05, **P < 0.01 versus chondrocytes without IL-1β treatment. (E) Representative immunofluorescence images of SHP2 in articular cartilage in DMM and Sham mice, scale bar = 100 µm.
Tmpy, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tmpy/product/TargetMol
Average 93 stars, based on 1 article reviews
tmpy - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or A24 on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 1 The cytotoxic IC50 of treatments on paired cancer cell lines (drug-sensitive and drug-resistant). (A) Paclitaxel with or without B23 or A24 on HeLaS3 and KB/VIN. (B) Vincristine with or without B23 or A24 on HeLaS3 and KB/VIN. (C) Paclitaxel with or without B23 or A24 on MCF-7 and MCF-7/DOX. (D) Vincristine with or without B23 or A24 on MCF-7 and MCF-7/DOX. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the chemotherapeutic drug-only in each group.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques:

Figure 2 The influential events of B23 and A24 on HepG2 and HepG2/VIN cell lines. (A) B23 and A24 showed significant elevation in ROS production after 24-h treatment, which was especially obvious in the MDR cell line HepG2/VIN. Menadione (50 μM) was used as a positive control. (B) B23 and A24 induced prominent apoptosis after 48-h incubation. Paclitaxel (300 nM for HepG2 and 1500 nM for HepG2/VIN) was used as a positive control. (C) B23 and A24 did not show secondary necrosis after 72-h incubation. Paclitaxel (300 nM for HepG2 and 1500 nM for HepG2/VIN) was used as a positive control. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 2 The influential events of B23 and A24 on HepG2 and HepG2/VIN cell lines. (A) B23 and A24 showed significant elevation in ROS production after 24-h treatment, which was especially obvious in the MDR cell line HepG2/VIN. Menadione (50 μM) was used as a positive control. (B) B23 and A24 induced prominent apoptosis after 48-h incubation. Paclitaxel (300 nM for HepG2 and 1500 nM for HepG2/VIN) was used as a positive control. (C) B23 and A24 did not show secondary necrosis after 72-h incubation. Paclitaxel (300 nM for HepG2 and 1500 nM for HepG2/VIN) was used as a positive control. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques: Positive Control, Incubation, Control

Figure 3 The effects of B23 and A24 on the cell membrane in paired drug-sensitive and drug-resistant cell lines. (A) B23 and A24 increased cell membrane fluidity in MDR HepG2/VIN after 72-h treatment. MBCD (2.5 mM) was used as a positive control. (B) B23 increased cell membrane fluidity in ABCB1/Flp-InTM-293, whereas A24 showed effects on both cell lines after 72-h treatment. MBCD (2.5 mM) was used as a positive control. (C) B23 and A24 significantly inhibited the efflux function of P-gp and increased calcein retention after 30-min pretreatment in the MDR HepG2/VIN cell line. B23 also showed effects in HepG2. Verapamil (10 μM) was used as a positive control. (D) B23 and A24 significantly inhibited the efflux function of P-gp and increased calcein retention after 30-min pretreatment in the drug-resistant ABCB1/Flp-InTM-293. Verapamil (10 μM) was used as a positive control. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 3 The effects of B23 and A24 on the cell membrane in paired drug-sensitive and drug-resistant cell lines. (A) B23 and A24 increased cell membrane fluidity in MDR HepG2/VIN after 72-h treatment. MBCD (2.5 mM) was used as a positive control. (B) B23 increased cell membrane fluidity in ABCB1/Flp-InTM-293, whereas A24 showed effects on both cell lines after 72-h treatment. MBCD (2.5 mM) was used as a positive control. (C) B23 and A24 significantly inhibited the efflux function of P-gp and increased calcein retention after 30-min pretreatment in the MDR HepG2/VIN cell line. B23 also showed effects in HepG2. Verapamil (10 μM) was used as a positive control. (D) B23 and A24 significantly inhibited the efflux function of P-gp and increased calcein retention after 30-min pretreatment in the drug-resistant ABCB1/Flp-InTM-293. Verapamil (10 μM) was used as a positive control. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques: Membrane, Positive Control, Control

Figure 4 The overall effects of B23 and A24 on the human P-gp. (A) B23 (left panel) and A24 (right panel) exhibited a dose-dependent inhibition on the P-gp efflux function (5–20 μM). (B) B23 and (C) A24 increased the intracellular rhodamine 123 fluorescence dose-dependently (2.5–10 μM). Verapamil (10 μM) was used as a positive control. (D) B23 showed a significant down-regulation of ABCB1 gene expression after 72-h treatment, while A24 showed a slight inhibitory effect. (E) Representative result and (F) quantitative results of P-gp protein expression after 72-h B23 and A24 treatment. (G) Results of MDR1 P-gp conformational change. B23 and A24 showed no influence compared to the positive control vinblastine. The fluorescent peaks of B23 and A24 did not move rightward and overlapped with negative control DMSO, while the fluorescent peak of vinblastine moved rightward and exhibited a fluorescence increase. The left panel exhibited representative results, and the right showed quantitative results. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. *Indicated p-value < 0.05 compared to the control in each group.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 4 The overall effects of B23 and A24 on the human P-gp. (A) B23 (left panel) and A24 (right panel) exhibited a dose-dependent inhibition on the P-gp efflux function (5–20 μM). (B) B23 and (C) A24 increased the intracellular rhodamine 123 fluorescence dose-dependently (2.5–10 μM). Verapamil (10 μM) was used as a positive control. (D) B23 showed a significant down-regulation of ABCB1 gene expression after 72-h treatment, while A24 showed a slight inhibitory effect. (E) Representative result and (F) quantitative results of P-gp protein expression after 72-h B23 and A24 treatment. (G) Results of MDR1 P-gp conformational change. B23 and A24 showed no influence compared to the positive control vinblastine. The fluorescent peaks of B23 and A24 did not move rightward and overlapped with negative control DMSO, while the fluorescent peak of vinblastine moved rightward and exhibited a fluorescence increase. The left panel exhibited representative results, and the right showed quantitative results. Experiments were performed on different days and repeated at least nine times. Data were presented as mean plus S.E. *Indicated p-value < 0.05 compared to the control in each group.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques: Inhibition, Fluorescence, Positive Control, Gene Expression, Expressing, Negative Control, Control

Figure 5 The modulatory mechanisms of B23 and A24 on the TMD of human P-gp. (A) B23 exhibited an uncompetitive (upper panel, lines were parallel) and non- competitive (lower panel, lines intersected at X-axis) inhibition on the transport of rhodamine 123 and doxorubicin, respectively. (B) A24 exhibited competitive inhibition (lines intersected at Y-axis) on the transport of rhodamine 123 and doxorubicin. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group. Experiments were performed on different days and repeated at least nine times. (C) The wholescale results of molecular docking between human P-gp (PDB: 7O9W) and B23 or A24 (labeled green color) at the TMD drug-binding site. (D) The top view results of molecular docking between human P-gp (PDB: 7O9W) and five ligands (labeled green color) at the TMD drug-binding site. For comparison, doxorubicin, Hoechst 33342, and verapamil were adopted as the site-binding positive controls.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 5 The modulatory mechanisms of B23 and A24 on the TMD of human P-gp. (A) B23 exhibited an uncompetitive (upper panel, lines were parallel) and non- competitive (lower panel, lines intersected at X-axis) inhibition on the transport of rhodamine 123 and doxorubicin, respectively. (B) A24 exhibited competitive inhibition (lines intersected at Y-axis) on the transport of rhodamine 123 and doxorubicin. Data were presented as mean plus S.E. * indicated p-value < 0.05 compared to the control in each group. Experiments were performed on different days and repeated at least nine times. (C) The wholescale results of molecular docking between human P-gp (PDB: 7O9W) and B23 or A24 (labeled green color) at the TMD drug-binding site. (D) The top view results of molecular docking between human P-gp (PDB: 7O9W) and five ligands (labeled green color) at the TMD drug-binding site. For comparison, doxorubicin, Hoechst 33342, and verapamil were adopted as the site-binding positive controls.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques: Inhibition, Control, Labeling, Binding Assay, Comparison

Figure 6 The modulatory mechanisms of B23 and A24 on the NBD of human P-gp. (A) B23 stimulated the basal P-gp ATPase activity but inhibited the verapamil-stimulated ATPase activity. (B) A24 stimulated both the basal P-gp ATPase activity and the verapamil-stimulated ATPase activity. Data were presented as mean plus S.E. * and # indicated p-value < 0.05 compared to the control in each group. Experiments were performed on different days and repeated at least nine times. (C) The wholescale results of molecular docking between human P-gp (PDB: 7O9W) and three ligands (labeled pink color) at the NBD ATP-binding site. For comparison, verapamil was adopted as the positive control.

Journal: Drug Design Development and Therapy

Article Title: Alisol Triterpenoids Exhibit Triple Modulatory Mechanisms on the Cell Membrane to Overcome Cancer Multidrug Resistance

doi: 10.2147/dddt.s521116

Figure Lengend Snippet: Figure 6 The modulatory mechanisms of B23 and A24 on the NBD of human P-gp. (A) B23 stimulated the basal P-gp ATPase activity but inhibited the verapamil-stimulated ATPase activity. (B) A24 stimulated both the basal P-gp ATPase activity and the verapamil-stimulated ATPase activity. Data were presented as mean plus S.E. * and # indicated p-value < 0.05 compared to the control in each group. Experiments were performed on different days and repeated at least nine times. (C) The wholescale results of molecular docking between human P-gp (PDB: 7O9W) and three ligands (labeled pink color) at the NBD ATP-binding site. For comparison, verapamil was adopted as the positive control.

Article Snippet: Chemicals and Reagents B23 and A24 were purchased from TargetMol Chemicals Inc. (Boston, MA, USA).

Techniques: Activity Assay, Control, Labeling, Binding Assay, Comparison, Positive Control

Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT for KDM1A-WT rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.

Journal: The Journal of Biological Chemistry

Article Title: Lysine demethylase KDM1A promotes cell growth via FKBP8–BCL2 axis in hepatocellular carcinoma

doi: 10.1016/j.jbc.2022.102374

Figure Lengend Snippet: Cytoplasmic KDM1A promotes HCC cell growth . A and B , left panel , same number of HLF control or KDM1A-KD cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows Western blot (WB) for indicated cells. Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA followed by pair-wise comparison as indicated. C , 500 HLF control or KDM1A-KD cells were seeded in 6-well plate. About 14 days later, cell colonies were stained with crystal violet . D and E , HLF control cells ( D ) or cells expressing Myc-KDM1A ( E ) were fractionated into cytoplasm (Cyto) and nucleus (Nuc). Shown are the WB results with indicated antibodies. F , GFP-KDM1A were expressed in HLF cells with lentivirus. Shown are photos taken with fluorescent microscopy. The scale bar represents 20 μm. G and H , left panel , same number of HLF KDM1A-KD and rescue cells were seeded. Cell proliferation over 5 days was measured with CCK-8. Fold of growth was normalized to that in control cells. Right panel shows WB for indicated cells. (Ctrl for control, KD for KDM1A-KD, WT for KDM1A-WT rescue, AA for K114A/R115A rescue, AA-DN for K114A/R115A–A539E/K661A rescue). Error bars denote standard deviation of six biological replicates. p Value was calculated by one-way ANOVA. CCK-8, Cell Counting Kit-8; HCC, hepatocellular carcinoma; KD, knockdown; KDM1A, lysine demethylase 1A.

Article Snippet: Coexpression with KDM1A-WT but not inactive mutant decreased FKBP8 methylation ( E ).Consistently, treatment with KDM1A selective inhibitor ORY1001 (TargetMol; catalog no.: T6922) increased FKBP8 methylation ( F ).

Techniques: Control, CCK-8 Assay, Western Blot, Standard Deviation, Comparison, Staining, Expressing, Microscopy, Cell Counting, Knockdown

KDM1A–K117 is acetylated by KAT8. A , FLAG-KDM1A was cotransfected with HA-tagged acetyltransferases into 293T cells. KDM1A acetylation was analyzed with IP–WB. B , FLAG-KDM1A was cotransfected with increasing HA-KAT8 into 293T cells. KDM1A acetylation was analyzed with IP–WB. C , FLAG-KDM1A was cotransfected with HA-KAT8-WT or inactive -K274A (DN) into 293T cells. KDM1A acetylation was analyzed with IP–WB. D , FLAG-KDM1A fragments were cotransfected with HA-KAT8 into 293T cells. FLAG-KDM1A acetylation was analyzed with IP–WB. E , FLAG-KDM1A-WT or -K117R was cotransfected with KAT8 into 293T cells. KDM1A acetylation was analyzed with IP–WB. F , FLAG-KDM1A-WT or -K117R was cotransfected with KAT8 into 293T cells. Cells were then treated with 3.3 μM TSA and/or 20 mM NIM for 4 h before collection. KDM1A acetylation was analyzed with IP–WB. HA, hemagglutinin; IP, immunoprecipitation; K117, lysine 117; KAT8, lysine acetyltransferase 8; KDM1A, lysine demethylase 1A; NIM, nicotinamide; TSA, trichostatin A; WB, Western blot.

Journal: The Journal of Biological Chemistry

Article Title: Lysine demethylase KDM1A promotes cell growth via FKBP8–BCL2 axis in hepatocellular carcinoma

doi: 10.1016/j.jbc.2022.102374

Figure Lengend Snippet: KDM1A–K117 is acetylated by KAT8. A , FLAG-KDM1A was cotransfected with HA-tagged acetyltransferases into 293T cells. KDM1A acetylation was analyzed with IP–WB. B , FLAG-KDM1A was cotransfected with increasing HA-KAT8 into 293T cells. KDM1A acetylation was analyzed with IP–WB. C , FLAG-KDM1A was cotransfected with HA-KAT8-WT or inactive -K274A (DN) into 293T cells. KDM1A acetylation was analyzed with IP–WB. D , FLAG-KDM1A fragments were cotransfected with HA-KAT8 into 293T cells. FLAG-KDM1A acetylation was analyzed with IP–WB. E , FLAG-KDM1A-WT or -K117R was cotransfected with KAT8 into 293T cells. KDM1A acetylation was analyzed with IP–WB. F , FLAG-KDM1A-WT or -K117R was cotransfected with KAT8 into 293T cells. Cells were then treated with 3.3 μM TSA and/or 20 mM NIM for 4 h before collection. KDM1A acetylation was analyzed with IP–WB. HA, hemagglutinin; IP, immunoprecipitation; K117, lysine 117; KAT8, lysine acetyltransferase 8; KDM1A, lysine demethylase 1A; NIM, nicotinamide; TSA, trichostatin A; WB, Western blot.

Article Snippet: Coexpression with KDM1A-WT but not inactive mutant decreased FKBP8 methylation ( E ).Consistently, treatment with KDM1A selective inhibitor ORY1001 (TargetMol; catalog no.: T6922) increased FKBP8 methylation ( F ).

Techniques: Immunoprecipitation, Western Blot

K117 acetylation promotes cytoplasmic localization and protein stability of KDM1A. A and B , KDM1A-WT or mutants were rescue expressed in HLF KDM1A-KD cells. A , shown is the result of immunofluorescence with myc-tag antibody. The scale bar represents 20 μm. B , cells were fractionated into cytoplasmic and nuclear fractions. Fractions were analyzed with WB. C , KDM1A-WT or mutants were expressed in HLF cells, whereas endogenous KDM1A was knocked down with doxycycline-inducible shRNA. Cells were analyzed with WB. D , 0.2 μg Myc-KDM1A-WT or mutants were transiently cotransfected with 0.05 μg GFP into 293T cells in 3.5 cm dish. Cells were analyzed with WB with GFP and actin as loading control. E , KAT8 was knocked down in HLF cells with lentivirus-expressed shRNA. Cells were analyzed with WB. F and G , 0.4 μg Myc-KDM1A-WT or 0.2 μg -K117Q, -K114A/R115A was transfected into 293T cells in 3.5 cm dish. About 24 h later, cells were split equally into three or four dishes as indicated. The next day, cells were treated with 25 μg/ml Chx for indicated time and analyzed with WB. H , 0.4 μg KDM1A-WT or 0.2 μg KDM1A-K114A/K115A were transfected into control or JADE2-KD 293T cells in 3.5 cm dish. About 24 h later, cells were split equally into three dishes as indicated. The next day, cells were then treated with 25 μg/ml Chx for indicated time and analyzed with WB. Chx, cycloheximide; JADE2, Jade family PHD finger 2; K117, lysine 117; KD, knockdown; KDM1A, lysine demethylase 1A; WB, Western blot.

Journal: The Journal of Biological Chemistry

Article Title: Lysine demethylase KDM1A promotes cell growth via FKBP8–BCL2 axis in hepatocellular carcinoma

doi: 10.1016/j.jbc.2022.102374

Figure Lengend Snippet: K117 acetylation promotes cytoplasmic localization and protein stability of KDM1A. A and B , KDM1A-WT or mutants were rescue expressed in HLF KDM1A-KD cells. A , shown is the result of immunofluorescence with myc-tag antibody. The scale bar represents 20 μm. B , cells were fractionated into cytoplasmic and nuclear fractions. Fractions were analyzed with WB. C , KDM1A-WT or mutants were expressed in HLF cells, whereas endogenous KDM1A was knocked down with doxycycline-inducible shRNA. Cells were analyzed with WB. D , 0.2 μg Myc-KDM1A-WT or mutants were transiently cotransfected with 0.05 μg GFP into 293T cells in 3.5 cm dish. Cells were analyzed with WB with GFP and actin as loading control. E , KAT8 was knocked down in HLF cells with lentivirus-expressed shRNA. Cells were analyzed with WB. F and G , 0.4 μg Myc-KDM1A-WT or 0.2 μg -K117Q, -K114A/R115A was transfected into 293T cells in 3.5 cm dish. About 24 h later, cells were split equally into three or four dishes as indicated. The next day, cells were treated with 25 μg/ml Chx for indicated time and analyzed with WB. H , 0.4 μg KDM1A-WT or 0.2 μg KDM1A-K114A/K115A were transfected into control or JADE2-KD 293T cells in 3.5 cm dish. About 24 h later, cells were split equally into three dishes as indicated. The next day, cells were then treated with 25 μg/ml Chx for indicated time and analyzed with WB. Chx, cycloheximide; JADE2, Jade family PHD finger 2; K117, lysine 117; KD, knockdown; KDM1A, lysine demethylase 1A; WB, Western blot.

Article Snippet: Coexpression with KDM1A-WT but not inactive mutant decreased FKBP8 methylation ( E ).Consistently, treatment with KDM1A selective inhibitor ORY1001 (TargetMol; catalog no.: T6922) increased FKBP8 methylation ( F ).

Techniques: Immunofluorescence, shRNA, Control, Transfection, Knockdown, Western Blot

KDM1A–FKBP8–BCL2 axis increases cellular resistance to sorafenib. A , 293T cells were transfected with GST-FKBP8, Myc-SMYD3, Myc-KDM1A, and HA-KAT8. Cells were analyzed with GST-pulldown (PD) and WB. B and C , KDM1A-WT or KDM1A–K117R was rescue expressed in HLF KDM1A-KD cells. Cells were analyzed with WB ( B ). In ( C ), cells were treated with 5 μM sorafenib for 80 h. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control cells. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. D , WB analysis for sorafenib-resistant HLF cell. E , KDM1A was knocked down in sorafenib-resistant HLF cells. Cells were treated with 5 μM sorafenib for 4 days. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. F , primary HCC cell culture 1 was treated with 10 μM GSK2879552 (GSK) or 10 μM ORY1001 (ORY) for 5 days. Cells were analyzed with WB. G , primary HCC cell culture 1 was infected with lentivirus expressing KAT8-shRNA. After selection with puromycin for 5 days, cell lysates were analyzed with WB. H , primary HCC cell culture 1 was treated with 5 μM sorafenib and/or 10 μM ORY1001. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. BCL2, B-cell lymphoma-2; CCK-8, Cell Counting Kit-8; FKBP8, FKBP prolyl isomerase 8; GST, glutathione- S -transferase; HA, hemagglutinin; HCC, hepatocellular carcinoma; KAT8, lysine acetyltransferase 8; KDM1A, lysine demethylase 1A; SMYD3, SET and MYND domain–containing 3; WB, Western blot.

Journal: The Journal of Biological Chemistry

Article Title: Lysine demethylase KDM1A promotes cell growth via FKBP8–BCL2 axis in hepatocellular carcinoma

doi: 10.1016/j.jbc.2022.102374

Figure Lengend Snippet: KDM1A–FKBP8–BCL2 axis increases cellular resistance to sorafenib. A , 293T cells were transfected with GST-FKBP8, Myc-SMYD3, Myc-KDM1A, and HA-KAT8. Cells were analyzed with GST-pulldown (PD) and WB. B and C , KDM1A-WT or KDM1A–K117R was rescue expressed in HLF KDM1A-KD cells. Cells were analyzed with WB ( B ). In ( C ), cells were treated with 5 μM sorafenib for 80 h. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control cells. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. D , WB analysis for sorafenib-resistant HLF cell. E , KDM1A was knocked down in sorafenib-resistant HLF cells. Cells were treated with 5 μM sorafenib for 4 days. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. F , primary HCC cell culture 1 was treated with 10 μM GSK2879552 (GSK) or 10 μM ORY1001 (ORY) for 5 days. Cells were analyzed with WB. G , primary HCC cell culture 1 was infected with lentivirus expressing KAT8-shRNA. After selection with puromycin for 5 days, cell lysates were analyzed with WB. H , primary HCC cell culture 1 was treated with 5 μM sorafenib and/or 10 μM ORY1001. Cell proliferation was measured with CCK-8. Fold of cell proliferation was normalized to that of control. Error bars denote standard deviation of six biological replicates. p Value was calculated with one-way ANOVA followed by pair-wise comparison as indicated. BCL2, B-cell lymphoma-2; CCK-8, Cell Counting Kit-8; FKBP8, FKBP prolyl isomerase 8; GST, glutathione- S -transferase; HA, hemagglutinin; HCC, hepatocellular carcinoma; KAT8, lysine acetyltransferase 8; KDM1A, lysine demethylase 1A; SMYD3, SET and MYND domain–containing 3; WB, Western blot.

Article Snippet: Coexpression with KDM1A-WT but not inactive mutant decreased FKBP8 methylation ( E ).Consistently, treatment with KDM1A selective inhibitor ORY1001 (TargetMol; catalog no.: T6922) increased FKBP8 methylation ( F ).

Techniques: Transfection, CCK-8 Assay, Control, Standard Deviation, Comparison, Cell Culture, Infection, Expressing, shRNA, Selection, Cell Counting, Western Blot

FIGURE 1 | SHP2 expression is increased in primary chondrocytes after IL-1β treatment and in mouse OA cartilage. (A) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (B) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with various doses of IL-1β for 24 h. (C) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (D) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with 5 ng/ml IL-1β for different time points. *P < 0.05, **P < 0.01 versus chondrocytes without IL-1β treatment. (E) Representative immunofluorescence images of SHP2 in articular cartilage in DMM and Sham mice, scale bar = 100 µm.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 1 | SHP2 expression is increased in primary chondrocytes after IL-1β treatment and in mouse OA cartilage. (A) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (B) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with various doses of IL-1β for 24 h. (C) Representative western blot of MMP3, MMP13, COL2A1, SHP2, and (D) mRNA level of Shp2 determined by qRT-PCR in chondrocytes after stimulation with 5 ng/ml IL-1β for different time points. *P < 0.05, **P < 0.01 versus chondrocytes without IL-1β treatment. (E) Representative immunofluorescence images of SHP2 in articular cartilage in DMM and Sham mice, scale bar = 100 µm.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Expressing, Western Blot, Quantitative RT-PCR

FIGURE 2 | SHP2 regulates IL-1β–induced cartilage destruction in vitro. (A) Representative western blot of MMP3, MMP13 and SHP2 after chondrocytes were transfected with si-NC or si-SHP2 for 48 h and then were treated with IL-1β (5 ng/ml) for indicated time points. (B–H) mRNA levels of Shp2, Mmp3, Mmp13, Aggrecan, Col2a, Sox9, and Col10a1 were shown in chondrocytes that were transfected with si-NC or si-SHP2 for 48 h and then were treated with IL-1β (5 ng/mL) for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001 versus si-NC transfected chondrocytes. (I) Representative western blot of MMP3, MMP13 and SHP2 after chondrocytes transfected with control plasmid (p-CON) or SHP2 (p-SHP2) overexpressed plasmid for 48 h and then incubated with or without IL-1β (5 ng/ml) for indicated time points. (J–P) mRNA levels of Shp2, Mmp3, Mmp13, Aggrecan, Col2a1, Sox9, and Col10a1 were shown in chondrocytes transfected with p-CON or p-SHP2 plasmids for 48 h and then stimulated with IL-1β (5 ng/mL) for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 versus p-CON transfected chondrocytes.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 2 | SHP2 regulates IL-1β–induced cartilage destruction in vitro. (A) Representative western blot of MMP3, MMP13 and SHP2 after chondrocytes were transfected with si-NC or si-SHP2 for 48 h and then were treated with IL-1β (5 ng/ml) for indicated time points. (B–H) mRNA levels of Shp2, Mmp3, Mmp13, Aggrecan, Col2a, Sox9, and Col10a1 were shown in chondrocytes that were transfected with si-NC or si-SHP2 for 48 h and then were treated with IL-1β (5 ng/mL) for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001 versus si-NC transfected chondrocytes. (I) Representative western blot of MMP3, MMP13 and SHP2 after chondrocytes transfected with control plasmid (p-CON) or SHP2 (p-SHP2) overexpressed plasmid for 48 h and then incubated with or without IL-1β (5 ng/ml) for indicated time points. (J–P) mRNA levels of Shp2, Mmp3, Mmp13, Aggrecan, Col2a1, Sox9, and Col10a1 were shown in chondrocytes transfected with p-CON or p-SHP2 plasmids for 48 h and then stimulated with IL-1β (5 ng/mL) for 24 h. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 versus p-CON transfected chondrocytes.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: In Vitro, Western Blot, Transfection, Control, Plasmid Preparation, Incubation

FIGURE 3 | SHP2 activates Wnt/β-catenin in chondrocytes. (A) Representative western blot of p-β-catenin (S33/37/T41), p-β-catenin (Y142) and β-catenin, in chondrocytes incubated with IL-1β of 5 ng/ml for the indicated time points. (B) Representative western blot of p-β-catenin (Y142), β-catenin and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for indicated time points after si-NC or si-SHP2 transfection for 48 h. (C) Representative western blot of MMP3, MMP13, β-catenin, and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for indicated time points after siRNA or active form of β-catenin (β-cat-S33Y) transfection with for 48 h. (D) Representative western blot of β-catenin and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for the indicated time points after p-CON or p-SHP2 transfection for 48 h.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 3 | SHP2 activates Wnt/β-catenin in chondrocytes. (A) Representative western blot of p-β-catenin (S33/37/T41), p-β-catenin (Y142) and β-catenin, in chondrocytes incubated with IL-1β of 5 ng/ml for the indicated time points. (B) Representative western blot of p-β-catenin (Y142), β-catenin and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for indicated time points after si-NC or si-SHP2 transfection for 48 h. (C) Representative western blot of MMP3, MMP13, β-catenin, and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for indicated time points after siRNA or active form of β-catenin (β-cat-S33Y) transfection with for 48 h. (D) Representative western blot of β-catenin and SHP2 in chondrocytes incubated with IL-1β (5 ng/ml) for the indicated time points after p-CON or p-SHP2 transfection for 48 h.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Western Blot, Incubation, Transfection

FIGURE 4 | SHP2 interacts with β-catenin and activates Wnt/β-catenin target genes. (A) β-catenin was co-immunoprecipitated with an anti-SHP2 antibody and (B) SHP2 was co-immunoprecipitated with an anti-β-catenin antibody in chondrocytes. (C) Immunofluorescence image for SHP2 and β-catenin cellular localization in chondrocytes. Scale bar, 100 µm. (D) Relative mRNA levels of three Wnt/β-catenin targets Axin2, Lef1, and Tcf4 in chondrocytes after si-NC or si-SHP2 transfection. (E) Relative mRNA levels of three Wnt/β-catenin targets Axin2, Lef1, and Tcf4 in chondrocytes after p-CON or p-SHP2 transfection. n = 3, **P < 0.01, ***P < 0.001 versus si-NC or p-CON transfected chondrocytes.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 4 | SHP2 interacts with β-catenin and activates Wnt/β-catenin target genes. (A) β-catenin was co-immunoprecipitated with an anti-SHP2 antibody and (B) SHP2 was co-immunoprecipitated with an anti-β-catenin antibody in chondrocytes. (C) Immunofluorescence image for SHP2 and β-catenin cellular localization in chondrocytes. Scale bar, 100 µm. (D) Relative mRNA levels of three Wnt/β-catenin targets Axin2, Lef1, and Tcf4 in chondrocytes after si-NC or si-SHP2 transfection. (E) Relative mRNA levels of three Wnt/β-catenin targets Axin2, Lef1, and Tcf4 in chondrocytes after p-CON or p-SHP2 transfection. n = 3, **P < 0.01, ***P < 0.001 versus si-NC or p-CON transfected chondrocytes.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Immunoprecipitation, Transfection

FIGURE 5 | SHP2 knockdown inhibits MAPK and NF-κB signaling pathways. Chondrocytes were transfected with siRNA for 48 h, and then stimulated with IL-1β for indicated time points. (A) Representative western blot and (B) quantification of the effect of SHP2 silencing on phosphorylated p38, JNK, ERK in chondrocytes. (C) Representative western blot and (D) quantification of the effect of SHP2 silencing on phosphorylated p65, IKKβ, and IκBα in chondrocytes. *P < 0.05, **P < 0.01 versus cells transfected with si-NC and without IL-1β treatment.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 5 | SHP2 knockdown inhibits MAPK and NF-κB signaling pathways. Chondrocytes were transfected with siRNA for 48 h, and then stimulated with IL-1β for indicated time points. (A) Representative western blot and (B) quantification of the effect of SHP2 silencing on phosphorylated p38, JNK, ERK in chondrocytes. (C) Representative western blot and (D) quantification of the effect of SHP2 silencing on phosphorylated p65, IKKβ, and IκBα in chondrocytes. *P < 0.05, **P < 0.01 versus cells transfected with si-NC and without IL-1β treatment.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Knockdown, Protein-Protein interactions, Transfection, Western Blot

FIGURE 6 | SHP2 overexpression activates MAPK and NF-κB Signaling Pathways. Chondrocytes were transfected with p-CON or p-SHP2 overexpression plasmid for 48 h, and then stimulated with IL-1β for indicated time points. (A) Representative western blot and (B) quantification of the effect of SHP2 overexpression on phosphorylated p38, JNK, ERK in chondrocytes. (C) Representative western blot and (D) quantification of the effect of SHP2 overexpression on phosphorylated p65, IKKβ, and IκBα in chondrocytes. *P < 0.05, **P < 0.01 versus cells transfected with p-CON and without IL-1β treatment.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 6 | SHP2 overexpression activates MAPK and NF-κB Signaling Pathways. Chondrocytes were transfected with p-CON or p-SHP2 overexpression plasmid for 48 h, and then stimulated with IL-1β for indicated time points. (A) Representative western blot and (B) quantification of the effect of SHP2 overexpression on phosphorylated p38, JNK, ERK in chondrocytes. (C) Representative western blot and (D) quantification of the effect of SHP2 overexpression on phosphorylated p65, IKKβ, and IκBα in chondrocytes. *P < 0.05, **P < 0.01 versus cells transfected with p-CON and without IL-1β treatment.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Over Expression, Protein-Protein interactions, Transfection, Plasmid Preparation, Western Blot

FIGURE 7 | Knockdown of SHP2 prevents cartilage destruction at 8 weeks after DMM surgery. (A) Immunofluorescence image of SHP2 after mice were intra-articular injected with Ad-shControl and Ad-shSHP2 virus 8 weeks after DMM surgery, scale bar = 100 µm. (B) HE, Safranin O/Fast Green, and toluidine blue staining and (C) OARSI grades of knee joints from Ad-shControl and Ad-shSHP2 mice at 8 weeks after DMM surgery. Scale bars, 100 µm, *P < 0.05, ***P < 0.001 versus Sham + Ad-shC or DMM + Ad-shC group. (D,E) Immunostaining images and quantification of MMP3, MMP13, AGGRECAN, and COL2A1 in the joint cartilage of control and SHP2 knockdown mice at 8 weeks after DMM surgery. *P < 0.05, **P < 0.01 versus Sham + Ad-shC or DMM + Ad-shC group. n = 6. Scale bars, 100 µm. (F) Representative micro-CT images of the knee joints in each group. n = 6. Scale bar, 1.0 mm.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 7 | Knockdown of SHP2 prevents cartilage destruction at 8 weeks after DMM surgery. (A) Immunofluorescence image of SHP2 after mice were intra-articular injected with Ad-shControl and Ad-shSHP2 virus 8 weeks after DMM surgery, scale bar = 100 µm. (B) HE, Safranin O/Fast Green, and toluidine blue staining and (C) OARSI grades of knee joints from Ad-shControl and Ad-shSHP2 mice at 8 weeks after DMM surgery. Scale bars, 100 µm, *P < 0.05, ***P < 0.001 versus Sham + Ad-shC or DMM + Ad-shC group. (D,E) Immunostaining images and quantification of MMP3, MMP13, AGGRECAN, and COL2A1 in the joint cartilage of control and SHP2 knockdown mice at 8 weeks after DMM surgery. *P < 0.05, **P < 0.01 versus Sham + Ad-shC or DMM + Ad-shC group. n = 6. Scale bars, 100 µm. (F) Representative micro-CT images of the knee joints in each group. n = 6. Scale bar, 1.0 mm.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Knockdown, Injection, Virus, Staining, Immunostaining, Control, Micro-CT

FIGURE 8 | Knockdown of SHP2 prevents cartilage destruction at 12 weeks after DMM surgery. (A) Immunofluorescence image of SHP2 after mice were intra-articular injected with Ad-shControl and Ad-shSHP2 virus 12 weeks after DMM surgery, scale bar = 100 µm. (B) HE, Safranin O/Fast Green, and toluidine blue staining and (C) OARSI grades of knee joints from Ad-shControl and Ad-shSHP2 mice at 12 weeks after DMM surgery. Scale bars, 100 µm, **P < 0.01, ***P < 0.001 versus Sham + Ad-shC or DMM + Ad-shC group. (D,E) Immunostaining images and quantification of MMP3, MMP13, AGGRECAN, and COL2A1 in the joint cartilage of control and SHP2 knockdown mice at 12 weeks after DMM surgery. *P < 0.05 versus Sham + Ad-shC or DMM + Ad-shC group. n = 6. Scale bars, 100 µm. (F) Representative u-CT images of the knee joints in each group. n = 6. Scale bar, 1.0 mm.

Journal: Frontiers in cell and developmental biology

Article Title: Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Promotes Inflammation and Accelerates Osteoarthritis by Activating β-Catenin.

doi: 10.3389/fcell.2021.646386

Figure Lengend Snippet: FIGURE 8 | Knockdown of SHP2 prevents cartilage destruction at 12 weeks after DMM surgery. (A) Immunofluorescence image of SHP2 after mice were intra-articular injected with Ad-shControl and Ad-shSHP2 virus 12 weeks after DMM surgery, scale bar = 100 µm. (B) HE, Safranin O/Fast Green, and toluidine blue staining and (C) OARSI grades of knee joints from Ad-shControl and Ad-shSHP2 mice at 12 weeks after DMM surgery. Scale bars, 100 µm, **P < 0.01, ***P < 0.001 versus Sham + Ad-shC or DMM + Ad-shC group. (D,E) Immunostaining images and quantification of MMP3, MMP13, AGGRECAN, and COL2A1 in the joint cartilage of control and SHP2 knockdown mice at 12 weeks after DMM surgery. *P < 0.05 versus Sham + Ad-shC or DMM + Ad-shC group. n = 6. Scale bars, 100 µm. (F) Representative u-CT images of the knee joints in each group. n = 6. Scale bar, 1.0 mm.

Article Snippet: Primary chondrocytes were plated onto 96-well plates for SHP2 siRNA or over-expressed plasmid transfection and then were stimulated with IL-1β for 24 h. All tests were performed in Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 April 2021 | Volume 9 | Article 646386 triplicate and cell proliferation was measured by Cell Counting Kit-8 Assay (CCK-8, TargetMol).

Techniques: Knockdown, Injection, Virus, Staining, Immunostaining, Control