Journal: Biochemistry

Article Title: Tissue Inhibitor of Metalloprotease-2 (TIMP-2): Bioprocess Development, Physicochemical, Biochemical, and Biological Characterization of Highly Expressed Recombinant Protein

doi: 10.1021/acs.biochem.7b00700

Figure Lengend Snippet: Comparison of wild-type (wt) TIMP-2 (pT2MO1 coding sequence) and codon-optimized (CO) rhTIMP-2-6XHis (COT2his) cDNA and protein sequences. (A) ClustalW (MacVector version 15.5.0) pairwise nucleotide alignment and comparison of the wt TIMP-2 (pT2MO1) and codon-optimized rhTIMP-2-6XHis (COT2his) cDNA sequences using a 10-nucleotide window indicating changes made to and from G and C nucleotides. (B) Comparison of the % GC content in the pT2MO1 (blue) and COT2his (red) lines in 10-nucleotide sequence windows using the MacVector software. (C) Alignment of the translated protein sequences from wt (pT2MO1) and codon-optmized rhTIMP-2-6XHis (COT2his) cDNA sequences.

Article Snippet: Separated proteins were blotted and probed with the murine anti-TIMP-2 antibody (catalog no. MAB 9711, R&D Systems) and anti-His-6 (catalog no. MA1–21315, Pierce).

Techniques: Sequencing, Software

Journal: Biochemistry

Article Title: Tissue Inhibitor of Metalloprotease-2 (TIMP-2): Bioprocess Development, Physicochemical, Biochemical, and Biological Characterization of Highly Expressed Recombinant Protein

doi: 10.1021/acs.biochem.7b00700

Figure Lengend Snippet: Analysis of two-step downstream purification of rhTIMP-2– 6XHis following bioprocess scale expression. Samples from the bioprocess purification were analyzed as shown in the (A) PageBlue Protein-stained SDS−PAGE gel of the fractions obtained from the IMAC (HisTrap column) purification step. Lane M contained the molecular weight standards (SeeBlue Plus 2 Prestained Standards, Invitrogen, catalog no. LC 5925). Lane CM contained the starting condition medium sample obtained from the HEK-293-F suspension culture. Lane FT contained the flow-through (unbound) fraction obtained during sample loading. Lane NSE contained the nonspecific elution obtained during step gradient elution with 20 mM imidazole. Lane SE contained the specific elution fraction obtained following 250 mM imidazole step elution. (B) PageBlue stained SDS−PAGE gel showing that the rhTIMP-2-6XHis-containing fractions from the IMAC (HisTrap) purification contain a predominant 22 kDa band with minor higher-molecular weight contaminants. The reverse phase HPLC purification effectively removed these higher-molecular weight contaminants, resulting in a single 22 kDa band with >95% purity as estimated by densitometry using a Bio-Rad ChemiDoc XRS+ instrument with Image Lab software. (C) Western Blot analysis of the IMAC fractions using anti-TIMP-2 (top) anti-6XHis tag (bottom) antibodies. The lanes are labeled the same as in panel A.

Article Snippet: Separated proteins were blotted and probed with the murine anti-TIMP-2 antibody (catalog no. MAB 9711, R&D Systems) and anti-His-6 (catalog no. MA1–21315, Pierce).

Techniques: Purification, Expressing, Staining, SDS Page, Molecular Weight, Software, Western Blot, Labeling

Journal: Biochemistry

Article Title: Tissue Inhibitor of Metalloprotease-2 (TIMP-2): Bioprocess Development, Physicochemical, Biochemical, and Biological Characterization of Highly Expressed Recombinant Protein

doi: 10.1021/acs.biochem.7b00700

Figure Lengend Snippet: Inhibition of MMP-2 activity by rhTIMP-2-6XHis and Ala +TIMP-2 was monitored by colorimetric product formation at 412 nm. (A) MMP-2 enzymatic activity data plotted vs log molar concentration of rhTIMP-2-6XHis (red) and Ala+TIMP-2 (blue) were fitted to a nonlinear curve for the one-site enzyme inhibitor response. (B) Data from the linear range of the rhTIMP-2-6XHis inhibition curve were analyzed by linear regression analysis and extrapolation to the X-axis to estimate the molar ratio of rhTIMP-2-6XHis to MMP-2, resulting in complete inhibition of MMP-2 enzymatic activity (n = 3; mean ± standard error of the mean).

Article Snippet: Separated proteins were blotted and probed with the murine anti-TIMP-2 antibody (catalog no. MAB 9711, R&D Systems) and anti-His-6 (catalog no. MA1–21315, Pierce).

Techniques: Inhibition, Activity Assay, Concentration Assay

Journal: Oncotarget

Article Title: TIMP-1 and CD82, a promising combined evaluation marker for PDAC

doi: 10.18632/oncotarget.14133

Figure Lengend Snippet: a . Culture system model of 293A cells and PANC-1 cells. b . The culture system was effective. (I) 293A cells were transfected with peGFP-N2 or pTIMP-1–eGFP. Cell lysates were immunoblotted with anti-GFP and anti–α-tubulin mAbs. (II) ELISA of TIMP-1 in 293A culture supernatant. TIMP-1 level in culture supernatant from 293A cells transfected with pTIMP-1-eGFP was almost twice as much as it from 293A cells transfected with eGFP. (III) PANC-1 cells were treated with culture supernatant from eGFP/eGFP-TIMP-1 transfected 293A cells. Outside-in GFP was detectable in PANC-1 cells. Cell lysates were immunoblotted with anti-GFP and anti–α-tubulin mAbs. Endogenous CD82 could be immunoprecipitated by outside-in TIMP-1 (eGFP-tagged) in PANC-1 (as arrowhead pointed at). c . TIMP-1–eGFP membrane–cytoplasm translocation in PANC-1 cells. PANC-1 cells were cultured with culture supernatant of 293A cells transfected with peGFP-N2 or pTIMP-1–eGFP. PANC-1 cells were immunostained with mouse anti-GFP mAb and counterstained with DAPI. d . CD82 mediated TIMP-1–eGFP membrane–cytoplasm translocation in PANC-1 cells. PANC-1 cells which were transfected with siNC (100 nM) or siCD82 (100 nM) for 48h were treated with culture supernatant of 293A cells transfected with peGFP-N2 or pTIMP-1–eGFP. PANC-1 cells were immunostained with mouse anti-GFP mAb and counterstained with DAPI. Scale bar = 20μm. CD82 deletion was confirmed by western blotting. e . CD82-eYFP fusion protein overexpression by pCD82-eYFP transfection. 293A cells were transfected with peYFP-N2 or pCD82-eYFP for 24 h. Cell lysates (using 1% Triton X-100) were immunoblotted with mouse anti-CD82 and anti–α-tubulin mAbs. Images shown are representative of eYFP and CD82-eYFP distribution in live PANC-1 cells. Scale bar = 20μm. f . TIMP-1 protein but not TIMP-2 triggers CD82 leaving from cytomembrane into cytoplasm. Images shown are representative of intense foci of CD82-eYFP fluorescence in the 0 th , 3 th , 15 th minute since TIMP-1 or TIMP-2 protein (100 ng/ml) addition in live PANC-1 cells. The scatter diagram quantified the images in the right by calculating outside-in spots (less than 0.5μm, reflecting CD82) in PANC-1 cytoplasm using Imaris8.0.

Article Snippet: Recombinant human TIMP-1 (Cys 24-Ala 207), TIMP-2 (Cys 27-Pro 220) and CD82-LEL (Gly 111-Leu 228) were procured from Sino Biological, Inc. (Beijing, China).

Techniques: Transfection, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Translocation Assay, Cell Culture, Western Blot, Over Expression, Fluorescence

Journal: Oncotarget

Article Title: TIMP-1 and CD82, a promising combined evaluation marker for PDAC

doi: 10.18632/oncotarget.14133

Figure Lengend Snippet: a . Migration inhibitory effect of cyclopamine and TIMP-1 in PANC-1 cells. Cells were treated with cyclopamine (10 μM) or TIMP-1 (50, 100 ng/mL) for 24 h. b . Mild CD82 deletion weakened TIMP-1 inhibition of PANC-1 cell migration. Cells were transfected with siNC (20 nM) or two independent siRNAs (20 nM) targeting CD82 for 48h. Cells were then treated with TIMP-1 (100 ng/mL) for 6 h. Scale bar = 60μm. c . TIMP-2 had no inhibitory effect on PANC-1 cell migration. Cells were treated with TIMP-2 or cyclopamine (10 μM) for 24 h. d . DN–TIMP-1 significantly weakened TIMP-1 inhibition of PANC-1 cell migration. Cells were treated with TIMP-1 (100 ng/mL) or DN–TIMP-1 (100 ng/mL) for 18 h. Error bars represent SD . * p < 0.05; ** p <0.01; *** p <0.001; ns denotes no statistical significance.

Article Snippet: Recombinant human TIMP-1 (Cys 24-Ala 207), TIMP-2 (Cys 27-Pro 220) and CD82-LEL (Gly 111-Leu 228) were procured from Sino Biological, Inc. (Beijing, China).

Techniques: Migration, Inhibition, Transfection

Journal: Oncotarget

Article Title: Prognostic significance of Cytokeratin 20-positive lymph node vascular endothelial growth factor A mRNA and chromodomain helicase DNA binding protein 4 in pN0 colorectal cancer patients

doi: 10.18632/oncotarget.23424

Figure Lengend Snippet: Sensitivity of detection for the 12 validated differential expressed genes

Article Snippet: TaqMan gene expression assays of specific primers and MGB probes were purchased from Applied Biosystems for the detection of 1) CHD4 (Hs00172349_m1), 2) NME1 Hs00264824_m1, 3) PNN Hs00170192_m1, 4) SET Hs04276680_m1, 5) SMAD4 Hs00929647_m1, 6) SSTR2 Hs00990356_m1, 7) TIMP2 Hs00234278_m1, 8) TIMP4 Hs00162784_m1, 9) CTBP1 Hs00972284_m1, 10) MTA1 Hs00950776_m1, 11) NME4 Hs00359037_m1 and 12) TGFB1 Hs00998133_m1.

Techniques:

Journal: Oncotarget

Article Title: Prognostic significance of Cytokeratin 20-positive lymph node vascular endothelial growth factor A mRNA and chromodomain helicase DNA binding protein 4 in pN0 colorectal cancer patients

doi: 10.18632/oncotarget.23424

Figure Lengend Snippet: Copy number and median fold-change of 12 validated differential expressed genes

Article Snippet: TaqMan gene expression assays of specific primers and MGB probes were purchased from Applied Biosystems for the detection of 1) CHD4 (Hs00172349_m1), 2) NME1 Hs00264824_m1, 3) PNN Hs00170192_m1, 4) SET Hs04276680_m1, 5) SMAD4 Hs00929647_m1, 6) SSTR2 Hs00990356_m1, 7) TIMP2 Hs00234278_m1, 8) TIMP4 Hs00162784_m1, 9) CTBP1 Hs00972284_m1, 10) MTA1 Hs00950776_m1, 11) NME4 Hs00359037_m1 and 12) TGFB1 Hs00998133_m1.

Techniques:

Journal: American Journal of Physiology - Renal Physiology

Article Title: SGLT2 inhibitor empagliflozin reduces renal growth and albuminuria in proportion to hyperglycemia and prevents glomerular hyperfiltration in diabetic Akita mice

doi: 10.1152/ajprenal.00520.2013

Figure Lengend Snippet: Real-time PCR primers used

Article Snippet: Each experiment was performed in triplicate. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Target Forward Reverse SGLT1 Mm00451203_m1 (Applied Biosystems) SGLT2 Mm00453831_m1 (Applied Biosystems) GLUT1 AACATGGAACCACCGCTACG GTGGTGAGTGTGGTGGATGG GLUT2 ATCGCCCTCTGCTTCCAGTAC GAACACGTAAGGCCCAAGGA PEPCK Mm01247058_m1 (Applied Biosystems) NFkB Mm00476361_m1 (Applied Biosystems) CCL2 Mm00441242-m1 (Applied Biosystems) CCL5 Mm01302428-m1 (Applied Biosystems) CD14 Mm00438094_g1 (Applied Biosystems) TIMP2 Mm00441825_m1 (Applied Biosystems) IL6 Mm00446190-m1 (Applied Biosystems) TGF-β Mm01178820-m1 (Applied Biosystems) NOX4 Mm00479246_m1 (Applied Biosystems) NOX2 Mm01287743_m1 (Applied Biosystems) Open in a separate window Real-time PCR primers used Determination of adipocyte size.

Techniques: Real-time Polymerase Chain Reaction

Journal: American Journal of Physiology - Renal Physiology

Article Title: SGLT2 inhibitor empagliflozin reduces renal growth and albuminuria in proportion to hyperglycemia and prevents glomerular hyperfiltration in diabetic Akita mice

doi: 10.1152/ajprenal.00520.2013

Figure Lengend Snippet: Empagliflozin attenuated diabetes-induced rise in renal expression of markers of kidney growth and inflammation. Empagliflozin (300 mg/kg of diet) or repelleted diet (vehicle) were given to Akita/+ and WT mice and kidneys harvested after 15 wk. Depicted are results for renal nuclear expression of p27 and p21 and renal cytosolic expression of HO-1 (A), and renal mRNA expression of NFkB, CCL2, CD14, TIMP2, and IL6 (B). *P < 0.05 vs. vehicle treatment in same genotype; #P < 0.05 vs. WT. ANOVA and unpaired Student's t-test and linear regression analysis. Linear regression lines were included when statistical significance was achieved. n = 10–13 per group.

Article Snippet: Each experiment was performed in triplicate. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Target Forward Reverse SGLT1 Mm00451203_m1 (Applied Biosystems) SGLT2 Mm00453831_m1 (Applied Biosystems) GLUT1 AACATGGAACCACCGCTACG GTGGTGAGTGTGGTGGATGG GLUT2 ATCGCCCTCTGCTTCCAGTAC GAACACGTAAGGCCCAAGGA PEPCK Mm01247058_m1 (Applied Biosystems) NFkB Mm00476361_m1 (Applied Biosystems) CCL2 Mm00441242-m1 (Applied Biosystems) CCL5 Mm01302428-m1 (Applied Biosystems) CD14 Mm00438094_g1 (Applied Biosystems) TIMP2 Mm00441825_m1 (Applied Biosystems) IL6 Mm00446190-m1 (Applied Biosystems) TGF-β Mm01178820-m1 (Applied Biosystems) NOX4 Mm00479246_m1 (Applied Biosystems) NOX2 Mm01287743_m1 (Applied Biosystems) Open in a separate window Real-time PCR primers used Determination of adipocyte size.

Techniques: Expressing