90
|
Addgene inc
aav8 dio hsyn hm4di mcherry Aav8 Dio Hsyn Hm4di Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pmc08429727-176-18-26?v=Addgene+inc Average 90 stars, based on 1 article reviews
aav8 dio hsyn hm4di mcherry - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
aav5 hsyn dio hm3d gq mcherry Aav5 Hsyn Dio Hm3d Gq Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pm39164260-227-99-104?v=Addgene+inc Average 92 stars, based on 1 article reviews
aav5 hsyn dio hm3d gq mcherry - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
93
|
Addgene inc
parlato Parlato, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/10__7554_slash_elife__103738__3-201-103-127?v=Addgene+inc Average 93 stars, based on 1 article reviews
parlato - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
90
|
Addgene inc
mouse c myc Mouse C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/us08748179-136-8-18?v=Addgene+inc Average 90 stars, based on 1 article reviews
mouse c myc - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
popins arel1 Popins Arel1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pm31398045__ol9b02406_si_001-11-10-24?v=Addgene+inc Average 93 stars, based on 1 article reviews
popins arel1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
92
|
Addgene inc
synapsin yfp navii iii construct Synapsin Yfp Navii Iii Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pm41770922-290-2-10?v=Addgene+inc Average 92 stars, based on 1 article reviews
synapsin yfp navii iii construct - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
93
|
Addgene inc
435 ybbr strep houlard 435 Ybbr Strep Houlard, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pm40614722-666-146-189?v=Addgene+inc Average 93 stars, based on 1 article reviews
435 ybbr strep houlard - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
plasmid 3 × ere tata luciferase Plasmid 3 × Ere Tata Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pmc12155627-60-1-12?v=Addgene+inc Average 93 stars, based on 1 article reviews
plasmid 3 × ere tata luciferase - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
golden 436 gate assembly Golden 436 Gate Assembly, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/10__1016_slash_j__omtn__2025__102734-228-11-31?v=Addgene+inc Average 93 stars, based on 1 article reviews
golden 436 gate assembly - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
90
|
Addgene inc
ggct 3 Ggct 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/ppr0409418-71-5-23?v=Addgene+inc Average 90 stars, based on 1 article reviews
ggct 3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
91
|
Addgene inc
pcr Pcr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pmc05364052-212-13-17?v=Addgene+inc Average 91 stars, based on 1 article reviews
pcr - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
90
|
Addgene inc
trcn0000173273 ttgggaagcttatagtggagg Trcn0000173273 Ttgggaagcttatagtggagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/three+plasmid+system/pmc05775503__mmc1-108-53-90?v=Addgene+inc Average 90 stars, based on 1 article reviews
trcn0000173273 ttgggaagcttatagtggagg - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |