three plasmid system Search Results


90
Addgene inc aav8 dio hsyn hm4di mcherry
Aav8 Dio Hsyn Hm4di Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pmc08429727-176-18-26?v=Addgene+inc
Average 90 stars, based on 1 article reviews
aav8 dio hsyn hm4di mcherry - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

92
Addgene inc aav5 hsyn dio hm3d gq mcherry
Aav5 Hsyn Dio Hm3d Gq Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pm39164260-227-99-104?v=Addgene+inc
Average 92 stars, based on 1 article reviews
aav5 hsyn dio hm3d gq mcherry - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc parlato
Parlato, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/10__7554_slash_elife__103738__3-201-103-127?v=Addgene+inc
Average 93 stars, based on 1 article reviews
parlato - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
Addgene inc mouse c myc
Mouse C Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/us08748179-136-8-18?v=Addgene+inc
Average 90 stars, based on 1 article reviews
mouse c myc - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc popins arel1
Popins Arel1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pm31398045__ol9b02406_si_001-11-10-24?v=Addgene+inc
Average 93 stars, based on 1 article reviews
popins arel1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
Addgene inc synapsin yfp navii iii construct
Synapsin Yfp Navii Iii Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pm41770922-290-2-10?v=Addgene+inc
Average 92 stars, based on 1 article reviews
synapsin yfp navii iii construct - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc 435 ybbr strep houlard
435 Ybbr Strep Houlard, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pm40614722-666-146-189?v=Addgene+inc
Average 93 stars, based on 1 article reviews
435 ybbr strep houlard - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc plasmid 3 × ere tata luciferase
Plasmid 3 × Ere Tata Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pmc12155627-60-1-12?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plasmid 3 × ere tata luciferase - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc golden 436 gate assembly
Golden 436 Gate Assembly, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/10__1016_slash_j__omtn__2025__102734-228-11-31?v=Addgene+inc
Average 93 stars, based on 1 article reviews
golden 436 gate assembly - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
Addgene inc ggct 3
Ggct 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/ppr0409418-71-5-23?v=Addgene+inc
Average 90 stars, based on 1 article reviews
ggct 3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

91
Addgene inc pcr
Pcr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pmc05364052-212-13-17?v=Addgene+inc
Average 91 stars, based on 1 article reviews
pcr - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

90
Addgene inc trcn0000173273 ttgggaagcttatagtggagg
Trcn0000173273 Ttgggaagcttatagtggagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/three+plasmid+system/pmc05775503__mmc1-108-53-90?v=Addgene+inc
Average 90 stars, based on 1 article reviews
trcn0000173273 ttgggaagcttatagtggagg - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results