|
MedChemExpress
recombinant human tgfβ2 ![]() Recombinant Human Tgfβ2, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant human tgfβ2/product/MedChemExpress Average 94 stars, based on 1 article reviews
recombinant human tgfβ2 - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Elabscience Biotechnology
tgfbr1/alk5 ![]() Tgfbr1/Alk5, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tgfbr1/alk5/product/Elabscience Biotechnology Average 90 stars, based on 1 article reviews
tgfbr1/alk5 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Eli Lilly
the anti-tgfβr2 antibody mt1 ![]() The Anti Tgfβr2 Antibody Mt1, supplied by Eli Lilly, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the anti-tgfβr2 antibody mt1/product/Eli Lilly Average 90 stars, based on 1 article reviews
the anti-tgfβr2 antibody mt1 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Ribobio co
primers of tgfβ1 ![]() Primers Of Tgfβ1, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers of tgfβ1/product/Ribobio co Average 90 stars, based on 1 article reviews
primers of tgfβ1 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Azenta
primer tgfβr2_e3f1: 5′ tcaggaattcattggcaggct 3′ ![]() Primer Tgfβr2 E3f1: 5′ Tcaggaattcattggcaggct 3′, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer tgfβr2_e3f1: 5′ tcaggaattcattggcaggct 3′/product/Azenta Average 90 stars, based on 1 article reviews
primer tgfβr2_e3f1: 5′ tcaggaattcattggcaggct 3′ - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
rabbit anti-human monoclonal antibody recognizing the gkqywlitafhak transmembrane epitope of tgfβr2 ![]() Rabbit Anti Human Monoclonal Antibody Recognizing The Gkqywlitafhak Transmembrane Epitope Of Tgfβr2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti-human monoclonal antibody recognizing the gkqywlitafhak transmembrane epitope of tgfβr2/product/GenScript corporation Average 90 stars, based on 1 article reviews
rabbit anti-human monoclonal antibody recognizing the gkqywlitafhak transmembrane epitope of tgfβr2 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
mt tgfβr2-3′utr constructs ![]() Mt Tgfβr2 3′Utr Constructs, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mt tgfβr2-3′utr constructs/product/Obio Technology Corp Ltd Average 90 stars, based on 1 article reviews
mt tgfβr2-3′utr constructs - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
plasmid pcdna tgfβr2 ![]() Plasmid Pcdna Tgfβr2, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid pcdna tgfβr2/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
plasmid pcdna tgfβr2 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
NanoTemper Technologies
tgfβr2 protein ![]() Tgfβr2 Protein, supplied by NanoTemper Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tgfβr2 protein/product/NanoTemper Technologies Average 90 stars, based on 1 article reviews
tgfβr2 protein - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ABclonal Biotechnology
rabbit anti-tgfβr2 ![]() Rabbit Anti Tgfβr2, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti-tgfβr2/product/ABclonal Biotechnology Average 90 stars, based on 1 article reviews
rabbit anti-tgfβr2 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
ZenBio
anti-tgfβr2 ![]() Anti Tgfβr2, supplied by ZenBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-tgfβr2/product/ZenBio Average 90 stars, based on 1 article reviews
anti-tgfβr2 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
pgl6-mir based luciferase reporter plasmids containing mutated type (mt) tgfβr2 3′utr ![]() Pgl6 Mir Based Luciferase Reporter Plasmids Containing Mutated Type (Mt) Tgfβr2 3′Utr, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgl6-mir based luciferase reporter plasmids containing mutated type (mt) tgfβr2 3′utr/product/Sangon Biotech Average 90 stars, based on 1 article reviews
pgl6-mir based luciferase reporter plasmids containing mutated type (mt) tgfβr2 3′utr - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular medicine (Cambridge, Mass.)
Article Title: Targeting PYK2, entrectinib allays anterior subcapsular cataracts in mice by regulating TGFβ2 signaling pathway.
doi: 10.1186/s10020-024-00921-9
Figure Lengend Snippet: Fig. 3 Entrectinib retards the migration and proliferation of human lens epithelial cells. (A) Cells were exposed to different doses of Entrectinib(0–64µM). IC50 = 10.06µM. (B) The effects of Entrectinib (0.25, 0.5, 1, 2µM) on proliferation induced by TGFβ2(10ng/ml) were assessed by CCK8 assay. (C) The EdU assay illustrated the effects of Entrectinib(0.25, 0.5, 1, 2µM) on proliferation induced by TGFβ2(10ng/ml). The proportion of EdU-positive cells was quanti fied and statistically analyzed (Scale bar = 200 μm). (D) Cell migration was recorded at 0, 6, 12, and 24 h after administrated TGFβ2(10ng/ml) and different doses of Entrectinib (0.25, 0.5, 1, 2µM). Black straight lines showed the wound edges. The migration rates were quantified and statistically analyzed (Scale bar = 200 μm). (E) After being seeded for 24 h, cells that moved vertically and stuck to the polycarbonate membrane’s exterior were stained with crystal violet and recorded. The number of cells that migrated through the membrane was quantified and statistically analyzed (Scale bar = 200 μm). Data was expressed as means ± SD, n = 3. #P < 0.05, ##P < 0.01, ###P < 0.001 and ####P < 0.0001versus control group. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus TGFβ2 group
Article Snippet:
Techniques: Migration, CCK-8 Assay, EdU Assay, Staining, Membrane, Control
Journal: Molecular medicine (Cambridge, Mass.)
Article Title: Targeting PYK2, entrectinib allays anterior subcapsular cataracts in mice by regulating TGFβ2 signaling pathway.
doi: 10.1186/s10020-024-00921-9
Figure Lengend Snippet: Fig. 4 Entrectinib suppressed the EMT of the human lens epithelial cells. (A) Relative mRNA expression of α-SMA, collagen I, fibronectin, and E-cadherin were analyzed by quantitative real-time PCR. GAPDH served as a reference gene. (B-C) Western blot was applied to analyze the relative protein expres sion of α-SMA, collagen I, fibronectin, and E-cadherin in cells. GAPDH served as a reference protein. (D) Immunofluorescence staining of α-SMA (red) and nuclei (blue) (Scale bar = 50 μm). Data was expressed as means ± SD, n = 3. ####P < 0.0001 versus control group. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 versus TGFβ2 group
Article Snippet:
Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Immunofluorescence, Staining, Control
Journal: Molecular medicine (Cambridge, Mass.)
Article Title: Targeting PYK2, entrectinib allays anterior subcapsular cataracts in mice by regulating TGFβ2 signaling pathway.
doi: 10.1186/s10020-024-00921-9
Figure Lengend Snippet: Fig. 5 Entrectinib inhibits the activation of Smad and non-Smad signaling pathway induced by TGFβ2. (A-B) The phosphorylation levels of Smad2, Smad3, AKT, JNK, ERK, and P38 in cells treated by TGFβ2(10ng/ml) and different doses of Entrectinib (0.25, 0.5, 1, 2µM) were analyzed by western blot. GAPDH served as a reference protein. Data was expressed as means ± SD, n = 3. #P < 0.05, ##P < 0.01 and ####P < 0.0001 versus control group. **P < 0.01, ***P < 0.001 and ****P < 0.0001 versus TGFβ2 group
Article Snippet:
Techniques: Activation Assay, Phospho-proteomics, Western Blot, Control
Journal: Molecular medicine (Cambridge, Mass.)
Article Title: Targeting PYK2, entrectinib allays anterior subcapsular cataracts in mice by regulating TGFβ2 signaling pathway.
doi: 10.1186/s10020-024-00921-9
Figure Lengend Snippet: Fig. 6 PYK2 is a potential target of Entrectinib. (A) The binding model between Entrectinib (pink) and the crucial residues of PYK2 (purple). (B) The bind ing affinity between PYK2 and Entrectinib was analyzed by Microscale thermophoresis (MST). (C) Cellular Thermal Shift Assay and Western blot were performed to evaluate the stability of PYK2 after incubation with or without Entrectinib at different temperatures. (D) Drug Affinity Responsive Target Sta bility and Western blot were performed to evaluate the resistance of PYK2 to enzymatic hydrolysis. (E) The phosphorylation levels of PYK2 in cells treated by TGFβ2(10ng/ml) and different doses of Entrectinib (0.25, 0.5, 1, 2µM) were analyzed by western blot. GAPDH served as a reference protein. Data was expressed as means ± SD, n = 3. ###P < 0.001 versus control group. ****P < 0.0001 versus TGFβ2 group
Article Snippet:
Techniques: Binding Assay, Microscale Thermophoresis, Thermal Shift Assay, Western Blot, Incubation, Phospho-proteomics, Control
Journal: Molecular medicine (Cambridge, Mass.)
Article Title: Targeting PYK2, entrectinib allays anterior subcapsular cataracts in mice by regulating TGFβ2 signaling pathway.
doi: 10.1186/s10020-024-00921-9
Figure Lengend Snippet: Fig. 7 The knockdown of PYK2 inhibits the TGFβ2-induced EMT through a non-Smad signaling pathway. (A) The knockdown efficiency of PYK2 was evaluated by western blotting. (B) The knockdown of PYK2 inhibited the EMT induced by TGFβ2. The efficacy of Entrectinib is influenced by PYK2 knock down. (C) PYK2 knockdown inhibited the activation of AKT, JNK, ERK, and P38. GAPDH served as a reference protein. Data was expressed as means ± SD, n = 3. #P < 0.05 and ##P < 0.01 versus the control group
Article Snippet:
Techniques: Knockdown, Western Blot, Activation Assay, Control
Journal: Antioxidants
Article Title: Mechanism of Action of Isoflavone Derived from Soy-Based Tempeh as an Antioxidant and Breast Cancer Inhibitor via Potential Upregulation of miR-7-5p: A Multimodal Analysis Integrating Pharmacoinformatics and Cellular Studies
doi: 10.3390/antiox13060632
Figure Lengend Snippet: Results of the top one PPI network analyses.
Article Snippet: The materials used in this study include 96% ethanol, acetonitrile, methanol, formic acid, trypsin-ethylenediaminetetraacetic acid solution, MCF-7 and MCF-10A, potassium persulfate, sodium chloride, ABTS, mitoxantrone and talazoparib (Sigma-Aldrich, Darmstadt, Germany), Dulbecco’s modified eagle medium (DMEM), bovine serum albumin (BSA), penicillin and streptomycin (Thermo Fisher Scientific, Waltham, MA, USA), FRAP (BioVision, Milpitas, CA, USA), STAT3, EGFR, IGF1R kinase, CDK1,
Techniques: Phospho-proteomics, Activation Assay, Protein-Protein interactions, Ubiquitin Proteomics, Migration, Expressing, Homologous Recombination, Inhibition, Activity Assay
Journal: Antioxidants
Article Title: Mechanism of Action of Isoflavone Derived from Soy-Based Tempeh as an Antioxidant and Breast Cancer Inhibitor via Potential Upregulation of miR-7-5p: A Multimodal Analysis Integrating Pharmacoinformatics and Cellular Studies
doi: 10.3390/antiox13060632
Figure Lengend Snippet: ΔG of molecular docking parameter of SBT-P-derived isoflavone.
Article Snippet: The materials used in this study include 96% ethanol, acetonitrile, methanol, formic acid, trypsin-ethylenediaminetetraacetic acid solution, MCF-7 and MCF-10A, potassium persulfate, sodium chloride, ABTS, mitoxantrone and talazoparib (Sigma-Aldrich, Darmstadt, Germany), Dulbecco’s modified eagle medium (DMEM), bovine serum albumin (BSA), penicillin and streptomycin (Thermo Fisher Scientific, Waltham, MA, USA), FRAP (BioVision, Milpitas, CA, USA), STAT3, EGFR, IGF1R kinase, CDK1,
Techniques: Control
Journal: bioRxiv
Article Title: TGFβ receptor inhibition unleashes interferon-β production by tumor-associated macrophages and enhances radiotherapy efficacy
doi: 10.1101/2022.01.17.476557
Figure Lengend Snippet: ( A ) Left panel shows the treatment scheme used for theTC1/Luc head and neck model, with irradiation at 8 Gy at day 7 and two weekly injection of MT1. Right panel presents the Kaplan-Meier survival curves of the different treatment groups. ( B ) In vivo bioluminescent imaging was performed to follow tumor growth, and quantification of the bioluminescent signal from individual mice was performed at different time points post treatment (For A and B: n = 17-33 mice/group from 4 independent experiments). ( C ) Left panel presents the treatment scheme used for the SCC VII head and neck mouse model, with irradiation at 12 Gy at day 9 and two weekly injection of MT1. Right panel shows the Kaplan-Meier survival curves (n= 10-12 mice/group from 3 independent experiments). ( D ) Left panel shows the treatment scheme used for the LL2/Luc lung orthotopic mouse model and includes the irradiation at 12 Gy at day 5 and two weekly injection of MT1. Right panel presents the Kaplan-Meier survival curves (n= 4-15 mice/group from 2 independent experiments). For all panels: *: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001 (A; C-D, log-rank test,).
Article Snippet: The
Techniques: Irradiation, Injection, In Vivo, Imaging
Journal: bioRxiv
Article Title: TGFβ receptor inhibition unleashes interferon-β production by tumor-associated macrophages and enhances radiotherapy efficacy
doi: 10.1101/2022.01.17.476557
Figure Lengend Snippet: ( A ) Quantification of the bioluminescent signal from individual TC1/luc tumors was performed at different time points post treatment in the different groups treated with or without anti-CD8 antibody (aCD8). ( B ) Kaplan-Meier mouse survival curves (For A-B, n = 11-12 mice/group from 2 independent experiments). ( C ) Left panel shows images of the bioluminescent signal 10 days after TC1/Luc injection in 10 mice previously treated with RT and MT1 that underwent complete TC1/Luc tumor clearance and that were still tumor free 60 days after tumor grafting (Rechallenged), and in 5 treatment-naïve mice (Untreated). Right panel present the summary table of mice that developed or not tumors. For all panels: *: p<0.05; **: p<0.01; ***: p<0.001 (log-rank test).
Article Snippet: The
Techniques: Injection
Journal: bioRxiv
Article Title: TGFβ receptor inhibition unleashes interferon-β production by tumor-associated macrophages and enhances radiotherapy efficacy
doi: 10.1101/2022.01.17.476557
Figure Lengend Snippet: ( A ) Histograms representing the number of TAMs and Ly6C high monocytes/mg of TC1/Luc tumor. ( B ) Mean fluorescence intensity (MFI) of TAMs and Ly6C high monocytes expressing PD-L1 in the different indicated groups (for A and B: n = 8-9 mice from 3 independent experiments, mean ± SEM is reported). ( C ) Histogram representing the production of IFNβ by irradiated RAW264.7 cells determined by ELISA after treatment with different doses of TGFβ. ( D ) Production of IFNβ by RAW264.7 cells with or without irradiation and treated or not with 0.5 ng/ml TGFβ and/or MT1 (for C and D, data from 2 independent experiments performed in duplicate, mean ± SEM is reported). ( E ) Quantification of IFNβ production by BMDMs differentiated with M-CSF for 5 days and then irradiated or not and treated with 0.5 ng/ml TGFβ and/or MT1 (n=8-11 from 3 independent experiments). ( F ) Mice bearing TC1/Luc tumors were irradiated and treated with or without MT1 before euthanasia and tumor macrophages sorting (left panel). The right panel represents the quantification of IFNβ RNA in the extracted macrophages analyzed by qPCR. For all panels: *: p<0.05; **: p<0.01; ****: p<0.0001 (A,B Kruskal-Wallis with Dunn’s multiple comparison test; C,D, E one-way ANOVA with Šidák’s multiple comparison test, F Welch’s t test).
Article Snippet: The
Techniques: Fluorescence, Expressing, Irradiation, Enzyme-linked Immunosorbent Assay
Journal: bioRxiv
Article Title: TGFβ receptor inhibition unleashes interferon-β production by tumor-associated macrophages and enhances radiotherapy efficacy
doi: 10.1101/2022.01.17.476557
Figure Lengend Snippet: ( A ) Kaplan-Meier mouse survival curves of the different TC1/Luc groups treated with anti-type I IFN receptor subunit 1 antibody (IFNAR) or isotype control (IgG, n = 6-12 mice from 2 independent experiments). ( B ) Histogram representing the percent of viable tumor for each group. ( C) Representative images of CD8 staining by immunochemistry on head and neck tumors for the RT+IgG (left), RT+MT1 (middle) and RT+IFNAR (right) groups. ( D ) Quantification of total CD8 + T cell density per mm 2 in head and neck tumors. ( E-F ). Semiquantitative scoring of the CD8 density at the tumor periphery (E) and at the tumor core (F) (For B, D-F, n=7-9 from 2 independent experiments). ( G ) Tumor signals were quantified by bioluminescence in vivo imaging 7 days post radiotherapy for the different groups of irradiated mice that received intratumor clodronate liposomes (Clodro) or the control PBS liposomes (Lipo CTRL) and/or MT1. ( H ) Kaplan-Meier survival curves of the different groups of irradiated mice that received intratumor clodronate liposomes or the liposome controls and/or MT1 (For G-H, n=8-9 mice from 2 independent experiments). For all panels: *: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001 (A,H log-rank test, B and D-G one-way ANOVA with Tukey’s multiple comparison test).
Article Snippet: The
Techniques: Staining, In Vivo Imaging, Irradiation
Journal: Oncotarget
Article Title: Onco-miR-130 promotes cell proliferation and migration by targeting TGFβR2 in gastric cancer
doi: 10.18632/oncotarget.9936
Figure Lengend Snippet: A. Western blot analysis of TGFβR2 expression in GC cancer tissues and the paired adjacent noncancerous tissues (n=6). B. Relative levels of TGFβR2 mRNA levels in GC tissues (n=6). C. The predicted binding region of miR-130 in the mRNA of TGFβR2. D. Relative levels of miR-130 in GC tissues and para-carcinoma tissues (n=6). E. Immunohistochemistry assays of TGFβR2 expression in GC cancer tissues (n=6). * indicates P <0.05;** indicates P <0.01.
Article Snippet: The
Techniques: Western Blot, Expressing, Binding Assay, Immunohistochemistry
Journal: Oncotarget
Article Title: Onco-miR-130 promotes cell proliferation and migration by targeting TGFβR2 in gastric cancer
doi: 10.18632/oncotarget.9936
Figure Lengend Snippet: A. The predicted base-pairing interaction between miR-130 and TGFβR2 mRNA. B. Direct recognition of TGFβR2 by miR-130. SGC7901 cells were co-transfected with firefly luciferase reporters containing either WT or mutant TGFβR2 3′UTR with miR-130 mimics and inhibitors (n=3). C. Quantitative RT-PCR analysis of TGFβR2 mRNA levels in SGC7901 cells transfected with miR-130 mimics or inhibitors (n=3). D. The suppression of TGFβR2 expression by miR-130 in SGC7901 cells (n=3). E. Quantitative analysis of D (n=3). F. and G. Quantitative RT-PCR analysis of miR-130 levels in SGC7901 cells transfected with mimics or inhibitors (n=3). ** indicates P <0.01; *** indicated P <0.001.
Article Snippet: The
Techniques: Transfection, Luciferase, Mutagenesis, Quantitative RT-PCR, Expressing
Journal: Oncotarget
Article Title: Onco-miR-130 promotes cell proliferation and migration by targeting TGFβR2 in gastric cancer
doi: 10.18632/oncotarget.9936
Figure Lengend Snippet: A. and B . Knock-down of TGFβR2 expression by siRNA. SGC7901 cells were transfected with TGFβR2 siRNA, and the protein levels (A) and mRNA levels (B) were detected respectively. (n=3) C. and D. Up-regulation of TGFβR2 expression by plasmid. SGC7901 cells were transfected with TGFβR2 plasmid, and the protein levels (C) and mRNA levels (D) were detected respectively. PCDNA TGFβR2 refers to overexpression plasmid, and PCDNA NC refers to control plasmid. (n=3) ** indicates P <0.01.
Article Snippet: The
Techniques: Knockdown, Expressing, Transfection, Plasmid Preparation, Over Expression, Control
Journal: Oncotarget
Article Title: Onco-miR-130 promotes cell proliferation and migration by targeting TGFβR2 in gastric cancer
doi: 10.18632/oncotarget.9936
Figure Lengend Snippet: A. Transwell assays show that knock-down of TGFβR2 enhances cell migration of GC cells strongly (n=3). B. Quantitative analysis of A (n=3). C. Edu assays demonstrate that knock-down of TGFβR2 promotes cell proliferation of SGC7901 cells (n=3). D. Quantitative analysis of C (n=3). E. Validation of TGFβR2-mediated cell migration by wound healing method. PCDNA TGFβR2 refers to overexpression plasmid, and PCDNA NC refers to control plasmid. (n=3). ** indicates P <0.01.
Article Snippet: The
Techniques: Knockdown, Migration, Biomarker Discovery, Over Expression, Plasmid Preparation, Control
Journal: Oncotarget
Article Title: Onco-miR-130 promotes cell proliferation and migration by targeting TGFβR2 in gastric cancer
doi: 10.18632/oncotarget.9936
Figure Lengend Snippet: A. The results showed that the epithelial markers (E-cadherin and cytokeratin) were up-regulated when miR-130 was knockdown or TGFβR2 was overexpressed. While, it showed a mesenchymal phenotype when miR-130 was up-regulated or TGFβR2 was inhibited. B, C, D and E . Quantitative analyses of A. PCDNA TGFβR2 refers to overexpression plasmid, and PCDNA NC refers to control plasmid. * indicates P <0.05; ** indicates P <0.01; *** indicated P <0.001.
Article Snippet: The
Techniques: Knockdown, Over Expression, Plasmid Preparation, Control
Journal: World Journal of Gastroenterology
Article Title: Dihydroergotamine ameliorates liver fibrosis by targeting transforming growth factor β type II receptor
doi: 10.3748/wjg.v29.i20.3103
Figure Lengend Snippet: Screening Food and Drug Administration-approved drugs for binding to transforming growth factor β type II receptor. A: The combination of transforming growth factor β type II receptor (TGFβR2) and transforming growth factor β 1 (TGFβ1); B: The structure of TGFβR2; C: The affinity of each Food and Drug Administration-approved drug and TGFβR2. The affinity of TGFβR2 and darifenacin, cyproheptadine, lifitegrast, difenoxin, phenytoin, dihydroergotamine (DHE), naldemedine, and irinotecan was -7.6, -7.4, -7.4, -7.3, -7.3, -7.3, -7.3, and -7.3 kcal/mol, respectively; D: Cell viability of LX-2 treated with 20 μM of the drugs for 24 h ( n = 5); E-H: Cell viability following LX-2 treatment with different concentrations of darifenacin, DHE, lifitegrast, and phenytoin for 24 h ( n = 6). All data are presented as mean ± standard error of the mean. One-way ANOVA test was performed. a P < 0.05, b P < 0.01, c P < 0.001, and d P < 0.0001. TGFβ: Transforming growth factor β; TGFβR: Transforming growth factor β receptor; DHE: Dihydroergotamine.
Article Snippet: The Kd value of the small molecules and the
Techniques: Binding Assay
Journal: World Journal of Gastroenterology
Article Title: Dihydroergotamine ameliorates liver fibrosis by targeting transforming growth factor β type II receptor
doi: 10.3748/wjg.v29.i20.3103
Figure Lengend Snippet: The binding affinity and sites of dihydroergotamine and transforming growth factor β type II receptor. A: Transforming growth factor β type II receptor (TGFβR2) bound to dihydroergotamine (DHE) with a Kd of 17.64 μM; B: Molecular dynamics simulation results of DHE and TGFβR2. Root-mean-square deviation of TGFβR2 skeleton atom; C: Root-mean-square fluctuation of backbone Cα atoms of TGFβR2 skeleton atom; D: The secondary structure components of TGFβR2 and complex simulation systems in 0-200 ns; E and F: The binding sites of DHE and TGFβR2; G: The binding affinity of TGFβR2 mutants with DHE. TGFβ: Transforming growth factor β; TGFβR: Transforming growth factor β receptor; DHE: Dihydroergotamine.
Article Snippet: The Kd value of the small molecules and the
Techniques: Binding Assay
Journal: World Journal of Gastroenterology
Article Title: Dihydroergotamine ameliorates liver fibrosis by targeting transforming growth factor β type II receptor
doi: 10.3748/wjg.v29.i20.3103
Figure Lengend Snippet: Content of secondary structural analysis from DSSP method
Article Snippet: The Kd value of the small molecules and the
Techniques:
Journal: World Journal of Gastroenterology
Article Title: Dihydroergotamine ameliorates liver fibrosis by targeting transforming growth factor β type II receptor
doi: 10.3748/wjg.v29.i20.3103
Figure Lengend Snippet: DNA sequence of extracellular transforming growth factor β type II receptor before and after mutation
Article Snippet: The Kd value of the small molecules and the
Techniques: Sequencing