templates Search Results


96
New England Biolabs rt enzyme mix
Rt Enzyme Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pmc13092968-59-47-50?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
rt enzyme mix - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
OriGene human dopamine receptor 2
Human Dopamine Receptor 2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/10__1074_slash_jbc__m112__342998-95-6-11?v=OriGene
Average 90 stars, based on 1 article reviews
human dopamine receptor 2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier




94
OriGene tacr1 human quantitative pcr template
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Tacr1 Human Quantitative Pcr Template, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pmc12919490-22-26-34?v=OriGene
Average 94 stars, based on 1 article reviews
tacr1 human quantitative pcr template - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

92
OriGene human tchp plasmid as template
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Human Tchp Plasmid As Template, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pm38538594-298-22-27?v=OriGene
Average 92 stars, based on 1 article reviews
human tchp plasmid as template - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

94
OriGene hk200550
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Hk200550, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pm23171216-91-19-21?v=OriGene
Average 94 stars, based on 1 article reviews
hk200550 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

92
Proteintech proteintech 55201 1 ap ppp2r1a
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Proteintech 55201 1 Ap Ppp2r1a, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pmc12022016__41419_2025_7663_MOESM1_ESM-39-102-102?v=Proteintech
Average 92 stars, based on 1 article reviews
proteintech 55201 1 ap ppp2r1a - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

93
OriGene gapdh reference gene sequence
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Gapdh Reference Gene Sequence, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/pm40933471-98-1-8?v=OriGene
Average 93 stars, based on 1 article reviews
gapdh reference gene sequence - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Bio-Rad mini whole gel eluter harvester
A , Quantitative RT‐PCR analysis of <t>TACR1</t> , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.
Mini Whole Gel Eluter Harvester, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/templates/us07569665-414-11-16?v=Bio-Rad
Average 93 stars, based on 1 article reviews
mini whole gel eluter harvester - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results


ACLY is a target of the splicing factor ESRP1. A and B , volcano plot of differentially expressed genes in high ver s us low ACLY PSI ( A ) or high versus low ACLY expression ( B ). Tumors were stratified by upper and lower quartile (See <xref ref-type=Fig. 2 , C and D ). C , genes ranked by Spearman correlation between expression and ACLY PSI across TCGA tumor specimens. Log 2 fold change for selected genes are also included (see ( A )). D , qPCR of ESRP1 normalized by 18S ( left ) and ACLY PSI ( right ) in HEK293T cells overexpressing ESRP1. Data points represent individual wells. Conditions were compared using one-way ANOVA. E , qPCR of ESRP1 normalized by 18S ( left ) and ACLY PSI ( right ) in HCT-116 cells expressing indicated shRNA. Data points represent individual wells. Conditions were compared using Student’s two-tailed t test. Symbols: ns ( p > 0.05), p ≤ 0.05 (∗), p ≤ 0.001 (∗∗∗), p ≤ 0.0001 (∗∗∗∗). ACLY, ATP-citrate lyase; ESRP1, epithelial splicing regulatory protein 1; EV, empty vector; PSI, percent spliced in; TCGA, The Cancer Genome Atlas. " width="100%" height="100%">

Journal: The Journal of Biological Chemistry

Article Title: ACLY alternative splicing correlates with cancer phenotypes

doi: 10.1016/j.jbc.2024.107418

Figure Lengend Snippet: ACLY is a target of the splicing factor ESRP1. A and B , volcano plot of differentially expressed genes in high ver s us low ACLY PSI ( A ) or high versus low ACLY expression ( B ). Tumors were stratified by upper and lower quartile (See Fig. 2 , C and D ). C , genes ranked by Spearman correlation between expression and ACLY PSI across TCGA tumor specimens. Log 2 fold change for selected genes are also included (see ( A )). D , qPCR of ESRP1 normalized by 18S ( left ) and ACLY PSI ( right ) in HEK293T cells overexpressing ESRP1. Data points represent individual wells. Conditions were compared using one-way ANOVA. E , qPCR of ESRP1 normalized by 18S ( left ) and ACLY PSI ( right ) in HCT-116 cells expressing indicated shRNA. Data points represent individual wells. Conditions were compared using Student’s two-tailed t test. Symbols: ns ( p > 0.05), p ≤ 0.05 (∗), p ≤ 0.001 (∗∗∗), p ≤ 0.0001 (∗∗∗∗). ACLY, ATP-citrate lyase; ESRP1, epithelial splicing regulatory protein 1; EV, empty vector; PSI, percent spliced in; TCGA, The Cancer Genome Atlas.

Article Snippet: Human ESRP1 (Origene) , qPCR , CTCAGGGTCGAAGGAACGGA , TACCGGGTCCCCATGTGATG.

Techniques: Expressing, shRNA, Two Tailed Test, Plasmid Preparation

Journal: The Journal of Biological Chemistry

Article Title: ACLY alternative splicing correlates with cancer phenotypes

doi: 10.1016/j.jbc.2024.107418

Figure Lengend Snippet:

Article Snippet: Human ESRP1 (Origene) , qPCR , CTCAGGGTCGAAGGAACGGA , TACCGGGTCCCCATGTGATG.

Techniques: Sequencing

A , Quantitative RT‐PCR analysis of TACR1 , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Regulation of Aldosterone Secretion by Substance P and the Neurokinin Type 1 Receptor in Aldosterone‐Producing Adenomas

doi: 10.1161/JAHA.125.045539

Figure Lengend Snippet: A , Quantitative RT‐PCR analysis of TACR1 , TACR2 , and TACR3 mRNAs in 42 independent APAs. Each dot indicates 1 adenoma. Data are presented as mean±SEM. P =0.012; P <0.0001. B , Comparison of the expression levels of the TACR1 gene between different APA subgroups. classical APAs; nonclassical APAs (left panel) P =0.045; NKD and KCNJ5 (middle panel); CYP11B2‐positive nodules in nonclassical APAs (<2 nodules vs ≥2 nodules, right panel). C through F , Distribution of NK1R immunostaining in APA and adjacent adrenal tissue representative of n=56 independent APAs. C, E, F, NK1R staining in a classical APA and its adjacent adrenal cortex. C , Overall NK1R staining pattern in an APA and the adjacent adrenal cortex. D , Closer view of the NK1R staining in a different classical APA, highlighting areas of staining present in the zona glomerulosa or organized in micronodules within the adrenal tissue adjacent to the adenoma (arrows). E , Close‐up view of NK1R‐positive staining in the ZG and nerve ganglia in the adrenal cortex adjacent to the adenoma). F , High magnification view illustrating the distribution of NK1R staining in a group of adenoma cells. Arrow and arrowhead show membrane and cytoplasmic NK1R staining, respectively. APA indicates aldosterone‐producing adenoma; C, classical; Ca, capsule; G, nerve ganglia; KCNJ5 , KCNJ5 mutation detected; NC, nonclassical; NKD, no KCNJ5 mutation detected; NK1R, neurokinin type 1 receptor; RT‐PCR, reverse transcription polymerase chain reaction; and ZG, zona glomerulosa.

Article Snippet: Each sample was analyzed in duplicates, and cDNA quantification was normalized to PPIA (cyclophilin) using the ΔCt method and standard curves generated from polyA mRNAs or TACR1 human quantitative PCR template ( HK210362 , Origene, Rockville, USA).

Techniques: Quantitative RT-PCR, Comparison, Expressing, Immunostaining, Staining, Membrane, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Reverse Transcription, Polymerase Chain Reaction