tcgcagagcaaaaattaaagggtgc Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 3130 genetic analyser
    3130 Genetic Analyser, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 571 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3130 genetic analyser/product/Thermo Fisher
    Average 99 stars, based on 571 article reviews
    Price from $9.99 to $1999.99
    3130 genetic analyser - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher abi prism 3100 genetic analyser
    Abi Prism 3100 Genetic Analyser, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 926 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism 3100 genetic analyser/product/Thermo Fisher
    Average 99 stars, based on 926 article reviews
    Price from $9.99 to $1999.99
    abi prism 3100 genetic analyser - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher amplitaq gold dna polymerase
    Amplitaq Gold Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 13081 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaq gold dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 13081 article reviews
    Price from $9.99 to $1999.99
    amplitaq gold dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher geneamp pcr system 2400
    Geneamp Pcr System 2400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 792 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr system 2400/product/Thermo Fisher
    Average 94 stars, based on 792 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr system 2400 - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher geneamp pcr system 9700
    Geneamp Pcr System 9700, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14954 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr system 9700/product/Thermo Fisher
    Average 99 stars, based on 14954 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr system 9700 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher platinium taq dna polymerase
    Platinium Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinium taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 186 article reviews
    Price from $9.99 to $1999.99
    platinium taq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results