taq dna polymerase Search Results

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen taq dna polymerase
    Slowly migrating DNAs are converted into ocDNA by <t>Taq</t> (A) or T4 (B) <t>DNA</t> polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.
    Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 7075 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Qiagen
    Average 99 stars, based on 7075 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher taq dna polymerase
    Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from <t>DNA</t> of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and <t>Taq</t> I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])
    Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 33252 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 33252 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Jena Bioscience taq dna polymerase
    Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from <t>DNA</t> of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and <t>Taq</t> I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])
    Taq Dna Polymerase, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 99/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Jena Bioscience
    Average 99 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Millipore taq dna polymerase
    (A) The suggested effects of PtNPs on polymerase chain reaction (PCR) is based on binding of PtNPs to the <t>Taq</t> <t>DNA</t> polymerase, which leads to ceasing of PCR, (B) whereas CisPt primarily intercalates in DNA structure and stops PCR by this way. The gel electrophoregrams of PCR product mixture with particular concentration of (C) PtNPs (0.04–4 200 ng/mL of Pt) and (D) CisPt (0.04–42 000 ng/mL of Pt). (E) DNA denaturation temperature affected by the 0–200 μg/mL of Pt derivatives. Fluorescence of labelled nucleotides of DNA fragment after sequencing, which was influenced by (F) 0–20 μg/mL of PtNPs and (G) 0–0.33 μg/mL of CisPt. For all measurement n = 3.
    Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 2728 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Millipore
    Average 99 stars, based on 2728 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher taq dna polymerase pfu taq polymerase
    Silver-stained electrophoresis polyacrylamide gel obtained from the amplification of gapdh and kDNA with the multiplex PCR system. (A) PCR products from the multiplex PCR system using <t>Taq</t> <t>DNA</t> polymerase enzymes (ABM ® ) in the presence of 5% DMSO. (B) PCR products from the multiplex PCR system using the FideliTaq PCR Master Mix (Affymetrix, USB). In both figures: 1. molecular-weight marker (50-bp DNA ladder); 2. infected rodent; 3. uninfected rodent; 4. human DNA; and 5. negative PCR control.
    Taq Dna Polymerase Pfu Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 179 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase pfu taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 179 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase pfu taq polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher taq polymerase kit
    Silver-stained electrophoresis polyacrylamide gel obtained from the amplification of gapdh and kDNA with the multiplex PCR system. (A) PCR products from the multiplex PCR system using <t>Taq</t> <t>DNA</t> polymerase enzymes (ABM ® ) in the presence of 5% DMSO. (B) PCR products from the multiplex PCR system using the FideliTaq PCR Master Mix (Affymetrix, USB). In both figures: 1. molecular-weight marker (50-bp DNA ladder); 2. infected rodent; 3. uninfected rodent; 4. human DNA; and 5. negative PCR control.
    Taq Polymerase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 139 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase kit/product/Thermo Fisher
    Average 99 stars, based on 139 article reviews
    Price from $9.99 to $1999.99
    taq polymerase kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher ex taq polymerase
    Silver-stained electrophoresis polyacrylamide gel obtained from the amplification of gapdh and kDNA with the multiplex PCR system. (A) PCR products from the multiplex PCR system using <t>Taq</t> <t>DNA</t> polymerase enzymes (ABM ® ) in the presence of 5% DMSO. (B) PCR products from the multiplex PCR system using the FideliTaq PCR Master Mix (Affymetrix, USB). In both figures: 1. molecular-weight marker (50-bp DNA ladder); 2. infected rodent; 3. uninfected rodent; 4. human DNA; and 5. negative PCR control.
    Ex Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq polymerase/product/Thermo Fisher
    Average 92 stars, based on 117 article reviews
    Price from $9.99 to $1999.99
    ex taq polymerase - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Thermo Fisher taq polymerase buffer
    <t>Primase</t> vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and <t>Taq</t> polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.
    Taq Polymerase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase buffer/product/Thermo Fisher
    Average 99 stars, based on 455 article reviews
    Price from $9.99 to $1999.99
    taq polymerase buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher recombinant taq dna polymerase
    <t>Primase</t> vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and <t>Taq</t> polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.
    Recombinant Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1595 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 1595 article reviews
    Price from $9.99 to $1999.99
    recombinant taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher thermostart taq polymerase
    <t>Primase</t> vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and <t>Taq</t> polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.
    Thermostart Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermostart taq polymerase/product/Thermo Fisher
    Average 86 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    thermostart taq polymerase - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Thermo Fisher accuprime taq dna polymerase
    <t>Primase</t> vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and <t>Taq</t> polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.
    Accuprime Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/accuprime taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 1259 article reviews
    Price from $9.99 to $1999.99
    accuprime taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    TaKaRa taq dna polymerase
    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic <t>DNA.</t> PCR was performed on the isolated genomic DNA using <t>taq</t> DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for
    Taq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 9958 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/TaKaRa
    Average 99 stars, based on 9958 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Thermo Fisher hotstart taq polymerase
    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic <t>DNA.</t> PCR was performed on the isolated genomic DNA using <t>taq</t> DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for
    Hotstart Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstart taq polymerase/product/Thermo Fisher
    Average 95 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    hotstart taq polymerase - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Thermo Fisher phusion taq polymerase
    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic <t>DNA.</t> PCR was performed on the isolated genomic DNA using <t>taq</t> DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for
    Phusion Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 306 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 306 article reviews
    Price from $9.99 to $1999.99
    phusion taq polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results

    Slowly migrating DNAs are converted into ocDNA by Taq (A) or T4 (B) DNA polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.

    Journal: Journal of Virology

    Article Title: Transgenically Expressed T-Rep of Tomato Yellow Leaf Curl Sardinia Virus Acts as a trans-Dominant-Negative Mutant, Inhibiting Viral Transcription and Replication

    doi: 10.1128/JVI.75.22.10573-10581.2001

    Figure Lengend Snippet: Slowly migrating DNAs are converted into ocDNA by Taq (A) or T4 (B) DNA polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.

    Article Snippet: To verify the nature of these slowly migrating molecules, TNAs extracted from the samples at 24 and 72 h were incubated with Taq DNA polymerase and analyzed by Southern blot (Fig. B).

    Techniques: Incubation, Transgenic Assay, Infection, Migration

    Slowly migrating DNAs also accumulate at early stages after transfection of wt protoplasts with TYLCSV. TNAs were extracted from protoplasts transfected with pTOM6. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slow-migrating viral DNAs are indicated with an asterisk (∗). HPT, hours posttransfection. (A) Time course analysis of viral DNA forms. Sample at 72 h was diluted 20-fold to give signals of satisfactory intensity on the autoradiographic film. (B) Taq DNA polymerase treatment of TNAs at 24 and 72 h after transfection. Samples were incubated for 10 min at 37°C with (+) or without (−) the polymerase. Lane C, sample at 72 h digested with Bgl II to show the linear DNA.

    Journal: Journal of Virology

    Article Title: Transgenically Expressed T-Rep of Tomato Yellow Leaf Curl Sardinia Virus Acts as a trans-Dominant-Negative Mutant, Inhibiting Viral Transcription and Replication

    doi: 10.1128/JVI.75.22.10573-10581.2001

    Figure Lengend Snippet: Slowly migrating DNAs also accumulate at early stages after transfection of wt protoplasts with TYLCSV. TNAs were extracted from protoplasts transfected with pTOM6. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slow-migrating viral DNAs are indicated with an asterisk (∗). HPT, hours posttransfection. (A) Time course analysis of viral DNA forms. Sample at 72 h was diluted 20-fold to give signals of satisfactory intensity on the autoradiographic film. (B) Taq DNA polymerase treatment of TNAs at 24 and 72 h after transfection. Samples were incubated for 10 min at 37°C with (+) or without (−) the polymerase. Lane C, sample at 72 h digested with Bgl II to show the linear DNA.

    Article Snippet: To verify the nature of these slowly migrating molecules, TNAs extracted from the samples at 24 and 72 h were incubated with Taq DNA polymerase and analyzed by Southern blot (Fig. B).

    Techniques: Transfection, Incubation

    Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Journal: BMC Genomics

    Article Title: Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction

    doi: 10.1186/1471-2164-9-584

    Figure Lengend Snippet: Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Article Snippet: The results showed a tendency that positive signals were improved and background signals were decreased compared to the use of HotStar Taq DNA polymerase, although statistical evidence is lacking (results not shown).

    Techniques: Negative Control

    Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from DNA of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and Taq I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])

    Journal: Current Microbiology

    Article Title: Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences

    doi: 10.1007/s00284-011-9949-6

    Figure Lengend Snippet: Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from DNA of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and Taq I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])

    Article Snippet: The reaction mixture (25 μl) contained 10 mmol/l Tris–HCl, pH 8.8, 1.5 mmol/l MgCl2 , 50 mmol/l KCl, 0.08% Nonidet P40 (Fermentas, Vilnius, Lithuania), 5 pmol of each primer (Institute of Biochemistry and Biophysics, Warsaw, Poland), 0.2 mmol/l of each deoxyribonucleotide (Fermentas), 2 U of Taq DNA polymerase (Fermentas), and 2 μl of DNA.

    Techniques: Agarose Gel Electrophoresis, Marker

    (A) The suggested effects of PtNPs on polymerase chain reaction (PCR) is based on binding of PtNPs to the Taq DNA polymerase, which leads to ceasing of PCR, (B) whereas CisPt primarily intercalates in DNA structure and stops PCR by this way. The gel electrophoregrams of PCR product mixture with particular concentration of (C) PtNPs (0.04–4 200 ng/mL of Pt) and (D) CisPt (0.04–42 000 ng/mL of Pt). (E) DNA denaturation temperature affected by the 0–200 μg/mL of Pt derivatives. Fluorescence of labelled nucleotides of DNA fragment after sequencing, which was influenced by (F) 0–20 μg/mL of PtNPs and (G) 0–0.33 μg/mL of CisPt. For all measurement n = 3.

    Journal: PLoS ONE

    Article Title: Platinum nanoparticles induce damage to DNA and inhibit DNA replication

    doi: 10.1371/journal.pone.0180798

    Figure Lengend Snippet: (A) The suggested effects of PtNPs on polymerase chain reaction (PCR) is based on binding of PtNPs to the Taq DNA polymerase, which leads to ceasing of PCR, (B) whereas CisPt primarily intercalates in DNA structure and stops PCR by this way. The gel electrophoregrams of PCR product mixture with particular concentration of (C) PtNPs (0.04–4 200 ng/mL of Pt) and (D) CisPt (0.04–42 000 ng/mL of Pt). (E) DNA denaturation temperature affected by the 0–200 μg/mL of Pt derivatives. Fluorescence of labelled nucleotides of DNA fragment after sequencing, which was influenced by (F) 0–20 μg/mL of PtNPs and (G) 0–0.33 μg/mL of CisPt. For all measurement n = 3.

    Article Snippet: The volume of the reaction mixture was 25 μL, which was composed of 2.5 μL of 10× standard Taq reaction buffer, 0.5 μL of 1 mM deoxynucleotide solution, 0.5 μL of each of the primers (10 μM), 0.125 μL of Taq DNA polymerase; selected volume of water or drugs diluted with water (sterile, ACS purity, Sigma-Aldrich) and 0.5 μL of bacteriophage λ DNA.

    Techniques: Polymerase Chain Reaction, Binding Assay, Concentration Assay, Fluorescence, Sequencing

    Silver-stained electrophoresis polyacrylamide gel obtained from the amplification of gapdh and kDNA with the multiplex PCR system. (A) PCR products from the multiplex PCR system using Taq DNA polymerase enzymes (ABM ® ) in the presence of 5% DMSO. (B) PCR products from the multiplex PCR system using the FideliTaq PCR Master Mix (Affymetrix, USB). In both figures: 1. molecular-weight marker (50-bp DNA ladder); 2. infected rodent; 3. uninfected rodent; 4. human DNA; and 5. negative PCR control.

    Journal: PLoS ONE

    Article Title: Multiplex PCR as a tool for the diagnosis of Leishmania spp. kDNA and the gapdh housekeeping gene of mammal hosts

    doi: 10.1371/journal.pone.0173922

    Figure Lengend Snippet: Silver-stained electrophoresis polyacrylamide gel obtained from the amplification of gapdh and kDNA with the multiplex PCR system. (A) PCR products from the multiplex PCR system using Taq DNA polymerase enzymes (ABM ® ) in the presence of 5% DMSO. (B) PCR products from the multiplex PCR system using the FideliTaq PCR Master Mix (Affymetrix, USB). In both figures: 1. molecular-weight marker (50-bp DNA ladder); 2. infected rodent; 3. uninfected rodent; 4. human DNA; and 5. negative PCR control.

    Article Snippet: The reactions were successfully employed using two different Taq enzymes; however, the use of the Taq DNA polymerase enzyme (ABM® ) showed some unspecific heavier than the fragments of interest, whereas a slightly better resolution was obtained using the FideliTaq PCR Master Mix (Affymetrix, USB) with a cycling profile of only 30 cycles ( ).

    Techniques: Staining, Electrophoresis, Amplification, Multiplex Assay, Polymerase Chain Reaction, Molecular Weight, Marker, Infection

    HCT1026 inhibits MPTP-induced loss of striatal TH and DAT mRNAs expression . Ageing (9-11 month-old) C57Bl/6 mice fed with a control (ct) or HCT1026 diets (30 mg kg -1 ) starting at -10 d, underwent an MPTP treatment according to the subchronic injection paradigm, as described. Age-matched mice fed with the different diets received physiologic saline and served as controls. Mice were sacrificed at different time-intervals after MPTP. Striatal tissue samples were processed for semi-quantitative RT-PCR analysis as described. Total RNA isolated and cDNA synthesized using Retroscript Kit (see Materials and Methods) following the manufacturer's directions. The 250 ng of cDNA were used for PCR, by using Super Taq DNA polymerase with specific primer pairs for TH (620 bp) and DAT (328 bp), and Classic S18 Standard (495 bp). Samples from PCR reactions were separated electrophoretically on 2% agarose gel containing 0,2 μg/ml of ethidium bromide (B-D, F-H). Fluorescent bands of amplified gene products were captured by using Gel Logic 200 Imaging System (Kodak), values normalized against S18 and ratios expressed as percent of control, within each experimental group (A, E). Differences were analyzed by ANOVA followed by Newman-Keuls test, and considered significant when p

    Journal: Journal of Neuroinflammation

    Article Title: Combining nitric oxide release with anti-inflammatory activity preserves nigrostriatal dopaminergic innervation and prevents motor impairment in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson's disease

    doi: 10.1186/1742-2094-7-83

    Figure Lengend Snippet: HCT1026 inhibits MPTP-induced loss of striatal TH and DAT mRNAs expression . Ageing (9-11 month-old) C57Bl/6 mice fed with a control (ct) or HCT1026 diets (30 mg kg -1 ) starting at -10 d, underwent an MPTP treatment according to the subchronic injection paradigm, as described. Age-matched mice fed with the different diets received physiologic saline and served as controls. Mice were sacrificed at different time-intervals after MPTP. Striatal tissue samples were processed for semi-quantitative RT-PCR analysis as described. Total RNA isolated and cDNA synthesized using Retroscript Kit (see Materials and Methods) following the manufacturer's directions. The 250 ng of cDNA were used for PCR, by using Super Taq DNA polymerase with specific primer pairs for TH (620 bp) and DAT (328 bp), and Classic S18 Standard (495 bp). Samples from PCR reactions were separated electrophoretically on 2% agarose gel containing 0,2 μg/ml of ethidium bromide (B-D, F-H). Fluorescent bands of amplified gene products were captured by using Gel Logic 200 Imaging System (Kodak), values normalized against S18 and ratios expressed as percent of control, within each experimental group (A, E). Differences were analyzed by ANOVA followed by Newman-Keuls test, and considered significant when p

    Article Snippet: 250 ng of cDNA were used for PCR (96°C for 1 min for 2 cycles; 96°C for 1 min, 58°C for 4 min; 94°C for 1 min, 58°C for 2,5 min for 35 cycles, with a final extension at 70°C for 10 min) by using Super Taq DNA polymerase (Ambion, #AM1710) with specific primer pairs for TH (F: cgtggaatacacaaaggagg; R:ggtaggtttgatcttggtag; amplicon: 620 bp); DAT (F:cagagaggtggagctcatc; R:ggcagatcttccagacacc; amplicon: 328 bp), iNOS (F: tgctcccttccgaagtttctggcagcagcg; R: tcagagcctcgtggctttgggctcctc, amplicon: 500 bp) and Classic S18 Standard (amplicon: 495 bp; #Ambion AM1720), to normalize the expression.

    Techniques: Expressing, Mouse Assay, Injection, Quantitative RT-PCR, Isolation, Synthesized, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Imaging

    Primase vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and Taq polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.

    Journal: Nucleic Acids Research

    Article Title: A highly divergent archaeo-eukaryotic primase from the Thermococcus nautilus plasmid, pTN2

    doi: 10.1093/nar/gkt1385

    Figure Lengend Snippet: Primase vs. primer-dependent DNA polymerase activity of intact PolpTN2, PolPTNΔ 311–923 and Taq polymerase. ( A ) Intact PolpTN2 (40 ng/µl), ( B ) PolpTN2Δ 311–923 (80 ng/µl) or ( C ) Taq DNA polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA, which was or was not hybridized to the complementary oligonucleotide primer M13 forward ( Supplementary Table S1 ). At t = 0, 5, 10 and 15 min, aliquots were withdrawn and quenched into 25 mM EDTA. The amount of ds DNA synthesized was then determined using Sybr® Green I fluorescence as described in Materials and Methods. Circles, continuous line: synthesis with hybridized primer; squares, dashed line: synthesis without primer. Points are the average of two determinations. The standard deviation is indicated by error bars.

    Article Snippet: Non-radioactive primase and DNA polymerase assays Reactions were carried out in Taq polymerase buffer (75 mM Tris-HCl pH 8.8 at 25°C, 20 mM (NH4 )2 SO4 , 0.01% Tween 20) (Thermo) containing 2.5 mM MgCl2 , 0.4 mM of each of the four dNTPs, 2 ng/µl of M13mp18 single-stranded DNA (New England Biolabs) and enzyme components as described in the text.

    Techniques: Activity Assay, Incubation, Synthesized, SYBR Green Assay, Fluorescence, Standard Deviation

    Efficiency of intact PolpTN2 and PolpTN2Δ 311–923 in priming DNA synthesis by T. nautilus PolB and Taq DNA polymerase. T. nautilus PolB (8 ng/µl) or Taq polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA (without annealed primer) with increasing concentrations of either intact PolpTN2 ( A ) or PolpTN2 Δ 311–923 ( B ). DNA synthesis by intact PolpTN2 or PolpTN2 Δ 311–923 alone was included as a control. At t = 0 and 6 min, aliquots were withdrawn, quenched in 25 mM EDTA and assayed for ds DNA using Sybr® Green I fluorescence. Circles, continuous line: PolpTN2 or PolpTN2 Δ 311–923 alone; squares, dashed line: PolpTN2 or PolpTN2 Δ 311–923 plus Taq DNA polymerase; triangles, dotted line: PolpTN2 or PolpTN2 Δ 311–923 plus T. nautilus PolB DNA polymerase. Points are the average of three determinations. The standard deviation is indicated by error bars.

    Journal: Nucleic Acids Research

    Article Title: A highly divergent archaeo-eukaryotic primase from the Thermococcus nautilus plasmid, pTN2

    doi: 10.1093/nar/gkt1385

    Figure Lengend Snippet: Efficiency of intact PolpTN2 and PolpTN2Δ 311–923 in priming DNA synthesis by T. nautilus PolB and Taq DNA polymerase. T. nautilus PolB (8 ng/µl) or Taq polymerase (0,05 u/µl) were incubated at 70°C in Taq buffer + 0,4 mM dNTP and 2 ng/µl M13mp18 DNA (without annealed primer) with increasing concentrations of either intact PolpTN2 ( A ) or PolpTN2 Δ 311–923 ( B ). DNA synthesis by intact PolpTN2 or PolpTN2 Δ 311–923 alone was included as a control. At t = 0 and 6 min, aliquots were withdrawn, quenched in 25 mM EDTA and assayed for ds DNA using Sybr® Green I fluorescence. Circles, continuous line: PolpTN2 or PolpTN2 Δ 311–923 alone; squares, dashed line: PolpTN2 or PolpTN2 Δ 311–923 plus Taq DNA polymerase; triangles, dotted line: PolpTN2 or PolpTN2 Δ 311–923 plus T. nautilus PolB DNA polymerase. Points are the average of three determinations. The standard deviation is indicated by error bars.

    Article Snippet: Non-radioactive primase and DNA polymerase assays Reactions were carried out in Taq polymerase buffer (75 mM Tris-HCl pH 8.8 at 25°C, 20 mM (NH4 )2 SO4 , 0.01% Tween 20) (Thermo) containing 2.5 mM MgCl2 , 0.4 mM of each of the four dNTPs, 2 ng/µl of M13mp18 single-stranded DNA (New England Biolabs) and enzyme components as described in the text.

    Techniques: DNA Synthesis, Incubation, SYBR Green Assay, Fluorescence, Standard Deviation

    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic DNA. PCR was performed on the isolated genomic DNA using taq DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for

    Journal: Neuroscience letters

    Article Title: Involvement of GluR2 and GluR3 subunit C-termini in the trigeminal spinal subnucleus caudalis and C1-C2 neurons in trigeminal neuropathic pain

    doi: 10.1016/j.neulet.2010.12.060

    Figure Lengend Snippet: (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic DNA. PCR was performed on the isolated genomic DNA using taq DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for

    Article Snippet: PCR was performed on the isolated genomic DNA using taq DNA polymerase (TaKaRa Ex Taq™, Takara, Otsu, Japan) and primer sets (primer #21–23 for GluR2 delta7: #21, 5′-ACA GAG GAA GGT AGT GGA AGG GAG-3′; #22, 5′-CTT GGT TTG GTT GTT GGT CAT AGC-3′; #23, 5′-CTA GTG AAC CTC TTC GAG GGA C-3′; primer #31–33 for GluR3 delta7: #31, 5′-CCA ATA CTC CAC AGG GGC AAT TTA TC-3′; #32, 5′-CCG TTG ACT GTT TTG AAT CTC ACA CC-3′; #33, 5′-CTA GTG AAC CTC TTC GAG GGA C-3′).

    Techniques: Mutagenesis, Mouse Assay, Polymerase Chain Reaction, Isolation