superscript iii reverse transcriptase Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher superscript iii reverse transcriptase
    A. thaliana contains <t>three</t> TER isoforms. ( A ) Diagram of the three TER isoforms in Arabidopsis . ( B ) Primer extension results of total cellular <t>RNA</t> from cell culture using a primer complementary to a region in CR2 (filled arrow in A ). (Lane 1 ) In vitro
    Superscript Iii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 69356 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Thermo Fisher
    Average 90 stars, based on 69356 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    97
    Fisher Scientific superscript iii reverse transcriptase
    Alternative splicing of Arabidopsis HBS1/SKI7 has functional consequences. Arabidopsis HBS1/SKI7 ( At5g10630 ) is alternatively spliced in the nucleus, generating at least <t>three</t> distinct transcripts that are exported to the nucleus. The HBS1 transcript (left) putatitively encodes a translational GTPase, HBS1, that interacts with the decoding factor PELOTA to recognize stalled ribosomes. The SKI7 transcript (center) putatitively encodes SKI7, a protein that associates with the cytosolic <t>RNA</t> exosome, a 3′→5′ exoribonuclease complex that degrades aberrant transcripts. A third splice form (right) encodes a premature translation codon in the fourth exon, presumably triggering NMD after a pioneer round of translation.
    Superscript Iii Reverse Transcriptase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 97/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Fisher Scientific
    Average 97 stars, based on 72 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    TaKaRa superscript iii reverse transcriptase
    Alternative splicing of Arabidopsis HBS1/SKI7 has functional consequences. Arabidopsis HBS1/SKI7 ( At5g10630 ) is alternatively spliced in the nucleus, generating at least <t>three</t> distinct transcripts that are exported to the nucleus. The HBS1 transcript (left) putatitively encodes a translational GTPase, HBS1, that interacts with the decoding factor PELOTA to recognize stalled ribosomes. The SKI7 transcript (center) putatitively encodes SKI7, a protein that associates with the cytosolic <t>RNA</t> exosome, a 3′→5′ exoribonuclease complex that degrades aberrant transcripts. A third splice form (right) encodes a premature translation codon in the fourth exon, presumably triggering NMD after a pioneer round of translation.
    Superscript Iii Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 145 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/TaKaRa
    Average 97 stars, based on 145 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    96
    InvivoGen superscript iii reverse transcriptase
    Activation deficiency of chicken and porcine TLR5 can be partially rescued with respective TLR5 chimeras. HeLa ( A ) or HEK293-T cells ( B ) were transiently transfected with adjusted amounts of plasmid <t>DNA</t> encoding for TLR5 from different species or chimeric receptors (transfected plasmid amounts see Fig. 1 ). 48 h after transfection, cells were coincubated with purified recombinant Salmonella FliC (50 ng/well) or mock-treated for four hours. IL-8 secretion in the cell supernatants was determined by ELISA. IL-8 secretion of hTLR5-transfected, FliC-stimulated cells was set to 100% (reference); relative IL-8 secretion of all constructs with regard to the reference is depicted. Each condition was tested in two independent biological replicates (each in technical triplicates), the results of which are summarized here as mean and standard error. One representative experiment out of <t>three</t> is shown. For all constructs in A and B, except for pEF6-empty, the differences between mock-coincubated and FliC-coincubated condition were highly significant (Student’s t -test, unpaired, two-tailed; p
    Superscript Iii Reverse Transcriptase, supplied by InvivoGen, used in various techniques. Bioz Stars score: 96/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/InvivoGen
    Average 96 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    97
    Millipore superscript iii reverse transcriptase
    Quantitative <t>PCR</t> validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of <t>three</t> independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p
    Superscript Iii Reverse Transcriptase, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Millipore
    Average 97 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    93
    Promega superscript iii reverse transcriptase
    Quantitative <t>PCR</t> validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of <t>three</t> independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p
    Superscript Iii Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 142 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Promega
    Average 93 stars, based on 142 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    97
    Bio-Rad superscript iii reverse transcriptase
    Quantitative <t>PCR</t> validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of <t>three</t> independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p
    Superscript Iii Reverse Transcriptase, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Bio-Rad
    Average 97 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    93
    Becton Dickinson superscript iii reverse transcriptase
    Quantitative <t>PCR</t> validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of <t>three</t> independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p
    Superscript Iii Reverse Transcriptase, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Becton Dickinson
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    93
    Epicentre Biotechnologies superscript iii reverse transcriptase
    Quantitative <t>PCR</t> validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of <t>three</t> independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p
    Superscript Iii Reverse Transcriptase, supplied by Epicentre Biotechnologies, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Epicentre Biotechnologies
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    93
    Stratagene superscript iii reverse transcriptase
    OligoA mutations change CoTC cleavage distribution. ( A ) The hscRACE procedure. Terminator element (black box), exon 3 (grey box) and cleavage sites (lightning bolts) are shown. Biotinylated <t>RNA</t> probe, β3 (tailed box), was hybridized to nuclear RNA isolated from HeLa cells transfected with pβT+ or pβTa- > c and then isolated by magnetic selection. Selected RNA is subjected to oligonucleotide (dotted line)-directed RNAse H digestion releasing RNA from beads. This is ligated and reversed transcribed across the ligated junction. cDNA is then amplified by PCR using gene-specific primers. The PCR products are analysed on a gel, cloned and sequenced. ( B ) Terminator DNA sequence showing the positions of CoTC-derived RNA 3′-ends in pβT+ (black filled arrows) and pβTa- > c (empty arrows). Positions of AA to CC mutations in pβTa- > c are underlined. The numbers above each arrow indicate the number of clones identified for each site. The hscRACE experiment was performed <t>three</t> and seven times for pβT+ and pβTa- > c, respectively, in order to obtain fifty positive colonies for each construct. ( C ) Effect of siRNA-mediated knock down of CPSF73 and CstF64. pβT+ΔpA has a mutated PAS (AATAAA- > GAATTC), known to inactivate β-globin mRNA polyadenylation (Dye and Proudfoot, 1999). This was transfected into CPSF73 and CstF64 siRNA-treated and mock-treated cells. Relative RNA continuity (based on RT/PCR analysis as in Figure 2 A) was assessed and is presented graphically. Error bars denote standard deviation.
    Superscript Iii Reverse Transcriptase, supplied by Stratagene, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Stratagene
    Average 93 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    93
    Keygen Biotech superscript iii reverse transcriptase
    (a) Overall elastin (R2) after fractional carbon dioxide (CO 2 ) laser resurfacing. T1 and T2 are ADSC-CM-treated sites after a single pass of fractionated CO 2 laser energy of 8 and 16 mJ, respectively. C1 and C2 are the DMEM-applied control sites after single passes of 8 and 16 mJ, respectively. D0: before treatment; D1: 1 day after treatment; D3: 3 days after treatment; D7: 7 days after treatment; D14: 14 days after treatment; and D21: 21 days after treatment. (b) HE (1 and 2), Masson-Trichrome (3 and 4), and Gomori's aldehyde fuchsin (5 and 6) staining of biopsy specimen from fractional carbon dioxide laser-treated sites on day 21. Scale bar 50 μ m. (c) Total <t>RNA</t> was extracted from biopsied skin samples of different groups. Procollagen types I and <t>III</t> and elastin mRNA were determined by real-time RT-PCR analysis. Results are shown as means ± SD ( n = 3). The asterisk (∗) indicates a significant difference ( P
    Superscript Iii Reverse Transcriptase, supplied by Keygen Biotech, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Keygen Biotech
    Average 93 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    93
    GE Healthcare superscript iii reverse transcriptase
    (a) Overall elastin (R2) after fractional carbon dioxide (CO 2 ) laser resurfacing. T1 and T2 are ADSC-CM-treated sites after a single pass of fractionated CO 2 laser energy of 8 and 16 mJ, respectively. C1 and C2 are the DMEM-applied control sites after single passes of 8 and 16 mJ, respectively. D0: before treatment; D1: 1 day after treatment; D3: 3 days after treatment; D7: 7 days after treatment; D14: 14 days after treatment; and D21: 21 days after treatment. (b) HE (1 and 2), Masson-Trichrome (3 and 4), and Gomori's aldehyde fuchsin (5 and 6) staining of biopsy specimen from fractional carbon dioxide laser-treated sites on day 21. Scale bar 50 μ m. (c) Total <t>RNA</t> was extracted from biopsied skin samples of different groups. Procollagen types I and <t>III</t> and elastin mRNA were determined by real-time RT-PCR analysis. Results are shown as means ± SD ( n = 3). The asterisk (∗) indicates a significant difference ( P
    Superscript Iii Reverse Transcriptase, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/GE Healthcare
    Average 93 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    97
    Roche superscript iii reverse transcriptase
    (a) Overall elastin (R2) after fractional carbon dioxide (CO 2 ) laser resurfacing. T1 and T2 are ADSC-CM-treated sites after a single pass of fractionated CO 2 laser energy of 8 and 16 mJ, respectively. C1 and C2 are the DMEM-applied control sites after single passes of 8 and 16 mJ, respectively. D0: before treatment; D1: 1 day after treatment; D3: 3 days after treatment; D7: 7 days after treatment; D14: 14 days after treatment; and D21: 21 days after treatment. (b) HE (1 and 2), Masson-Trichrome (3 and 4), and Gomori's aldehyde fuchsin (5 and 6) staining of biopsy specimen from fractional carbon dioxide laser-treated sites on day 21. Scale bar 50 μ m. (c) Total <t>RNA</t> was extracted from biopsied skin samples of different groups. Procollagen types I and <t>III</t> and elastin mRNA were determined by real-time RT-PCR analysis. Results are shown as means ± SD ( n = 3). The asterisk (∗) indicates a significant difference ( P
    Superscript Iii Reverse Transcriptase, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Roche
    Average 97 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    93
    Meridian Life Science superscript iii reverse transcriptase
    P2X receptor expression in LAD2 cells and HLMCs. <t>RT-PCR</t> on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from <t>three</t> donors. Both types of human mast cells revealed the presence of P2X1, P2X4
    Superscript Iii Reverse Transcriptase, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Meridian Life Science
    Average 93 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    97
    Toyobo superscript iii reverse transcriptase
    P2X receptor expression in LAD2 cells and HLMCs. <t>RT-PCR</t> on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from <t>three</t> donors. Both types of human mast cells revealed the presence of P2X1, P2X4
    Superscript Iii Reverse Transcriptase, supplied by Toyobo, used in various techniques. Bioz Stars score: 97/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Toyobo
    Average 97 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii reverse transcriptase kit
    Expression pattern of IVSPER genes in Hyposoter didymator calyx cells during pupal developmental stages. (A) Mean reads per kilo base per million mapped reads (RPKM) values are given from <t>RNA-seq</t> analyses (transformed by log10). Genes with a similar expression pattern are represented by the same color (genes with stable transcript levels over pupal development time in orange, genes with increasing transcript levels in blue and those with decreased transcript levels in green). See S1 Table for raw values. The <t>three</t> analyzed pupal stages are shown underneath the graph: St1: pupal stage 1; St2: pupal stage 2; St3: pupal stage 3. For each stage, are shown (i) a picture of dissected wasp ovaries; white arrows indicate the calyx where virus particles are produced and (ii) TEM micrographs of calyx cells showing that the first particles are visible at stage 3. N, nucleus; C, cytoplasm; black arrows indicate viral particles. (B) Schematic representation of the different categories of expression profiles observed for IVSPER genes and list of genes in each category (see S4 Table for detail of statistical analyses). NS, no statistical differences of the RPKM values between the 2 compared pupal stages; if p
    Superscript Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6912 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Thermo Fisher
    Average 99 stars, based on 6912 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii reverse transcriptase enzyme
    Expression pattern of IVSPER genes in Hyposoter didymator calyx cells during pupal developmental stages. (A) Mean reads per kilo base per million mapped reads (RPKM) values are given from <t>RNA-seq</t> analyses (transformed by log10). Genes with a similar expression pattern are represented by the same color (genes with stable transcript levels over pupal development time in orange, genes with increasing transcript levels in blue and those with decreased transcript levels in green). See S1 Table for raw values. The <t>three</t> analyzed pupal stages are shown underneath the graph: St1: pupal stage 1; St2: pupal stage 2; St3: pupal stage 3. For each stage, are shown (i) a picture of dissected wasp ovaries; white arrows indicate the calyx where virus particles are produced and (ii) TEM micrographs of calyx cells showing that the first particles are visible at stage 3. N, nucleus; C, cytoplasm; black arrows indicate viral particles. (B) Schematic representation of the different categories of expression profiles observed for IVSPER genes and list of genes in each category (see S4 Table for detail of statistical analyses). NS, no statistical differences of the RPKM values between the 2 compared pupal stages; if p
    Superscript Iii Reverse Transcriptase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 497 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase enzyme/product/Thermo Fisher
    Average 99 stars, based on 497 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase enzyme - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    88
    Meridian Life Science superscript iii reverse transcriptase kit
    Downregulation of p53 is required for DCAF1-dependent cell cycle entry. ( a – d ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 at indicated time points. The cell size measured by flow-cytometry ( a ), the cell proliferation determined by CFSE dilution assay ( b ), the amounts of <t>DNA</t> synthesis measured by BrdU incorporation assay 24 h post activation ( c ), and p53 and c-Myc protein expression assessed by immunoblotting ( d ) were compared. ( e ) Comparison of the proliferation of CD4 + naive T cells of indicated genotypes (lines) to that of wild-type CD4 + T cells (shaded area) determined by CFSE dilution assay at indicated time points post anti-CD3 and anti-CD28 activation in the presence of 4-hydroxy-tamoxifen. ( f , g ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 for 5 days to generate effector T cells in the presence of 4-hydroxy-tamoxifen. Quiescent effector T cells were either re-stimulated with IL-2 for 24 h or remained unstimulated (quiescence). The amounts of DNA synthesis were determined by BrdU incorporation assay ( f ). The protein expression of p53 and c-Myc was analysed by immunoblotting ( g ). In this figure, representative flow-cytometry and immunoblotting results of <t>three</t> experiments are shown. For BrdU incorporation assay results ( c , f ), means±s.d. of three experiments are shown. See also Supplementary Fig. 6 .
    Superscript Iii Reverse Transcriptase Kit, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Meridian Life Science
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    92
    Toyobo superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Toyobo
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    92
    Promega superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Promega
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    88
    Fisher Scientific superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 88/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Fisher Scientific
    Average 88 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    88
    Roche superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Roche
    Average 88 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii reverse transcriptase system
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 563 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase system/product/Thermo Fisher
    Average 99 stars, based on 563 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase system - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    88
    Thermo Fisher superscript iii reverse transcriptase reagent
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase reagent/product/Thermo Fisher
    Average 88 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase reagent - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript ii reverse transcriptase
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Ii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 69851 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 90 stars, based on 69851 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii reverse transcriptase enzyme kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Enzyme Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase enzyme kit/product/Thermo Fisher
    Average 90 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase enzyme kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    96
    Qiagen superscript iii reverse transcriptase
    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of <t>three</t> independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) <t>ChIP-qPCR</t> analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.
    Superscript Iii Reverse Transcriptase, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 147 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Qiagen
    Average 96 stars, based on 147 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    97
    New England Biolabs superscript iii reverse transcriptase
    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of <t>three</t> independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) <t>ChIP-qPCR</t> analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.
    Superscript Iii Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/New England Biolabs
    Average 97 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    93
    Beijing CWBio superscript iii reverse transcriptase
    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of <t>three</t> independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) <t>ChIP-qPCR</t> analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.
    Superscript Iii Reverse Transcriptase, supplied by Beijing CWBio, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Beijing CWBio
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    92
    Qiagen superscript iii reverse transcriptase kit
    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total <t>RNA</t> of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least <t>three</t> experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P
    Superscript Iii Reverse Transcriptase Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 92/100, based on 75 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Qiagen
    Average 92 stars, based on 75 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    88
    Millipore superscript iii reverse transcriptase kit
    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total <t>RNA</t> of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least <t>three</t> experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P
    Superscript Iii Reverse Transcriptase Kit, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Millipore
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    Image Search Results


    A. thaliana contains three TER isoforms. ( A ) Diagram of the three TER isoforms in Arabidopsis . ( B ) Primer extension results of total cellular RNA from cell culture using a primer complementary to a region in CR2 (filled arrow in A ). (Lane 1 ) In vitro

    Journal: Genes & Development

    Article Title: An alternative telomerase RNA in Arabidopsis modulates enzyme activity in response to DNA damage

    doi: 10.1101/gad.202960.112

    Figure Lengend Snippet: A. thaliana contains three TER isoforms. ( A ) Diagram of the three TER isoforms in Arabidopsis . ( B ) Primer extension results of total cellular RNA from cell culture using a primer complementary to a region in CR2 (filled arrow in A ). (Lane 1 ) In vitro

    Article Snippet: Total RNA was extracted using Tri reagent (Sigma), and cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen) as described ( ).

    Techniques: Cell Culture, In Vitro

    The three TER isoforms assemble into distinct RNP complexes. In vitro filter-binding assay results for TERT with TER1, TER2, and TER2 S are shown in A and B . RRL-expressed TERT was incubated with 5 nM or 10 nM radiolabeled RNA as indicated. TRFL4 protein

    Journal: Genes & Development

    Article Title: An alternative telomerase RNA in Arabidopsis modulates enzyme activity in response to DNA damage

    doi: 10.1101/gad.202960.112

    Figure Lengend Snippet: The three TER isoforms assemble into distinct RNP complexes. In vitro filter-binding assay results for TERT with TER1, TER2, and TER2 S are shown in A and B . RRL-expressed TERT was incubated with 5 nM or 10 nM radiolabeled RNA as indicated. TRFL4 protein

    Article Snippet: Total RNA was extracted using Tri reagent (Sigma), and cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen) as described ( ).

    Techniques: In Vitro, Filter-binding Assay, Incubation

    The saxE gene was required for Pst growth in leaf extracts and in planta . A. A schematic diagram of the complementary tests pinpointing the minimal region required for rescuing the growth of 25D12 mutant in plant leaf extracts. Filled arrows indicate genes annotated by the sequencing project marked with locus tags on the top. The filled triangle shows the insertion site of Ω‐Km transposon in mutant 25D12 . Genomic DNA fragments downstream the transposon insertion site were tested for the ability to confer tolerance to leaf extracts. B. The minimal region that protected 25D12 in leaf extracts also rescued the growth of the mutant on Arabidopsis plant. Bacterial inocula were infiltrated into Arabidopsis leaves at OD 600 = 0.001. Samples were taken at 0 and 3 dpi for colony counts. The saxE orf was required for bacterial virulence on Arabidopsis (C) and tomato (D) plants. Wild‐type Pst , Pst ▵saxE and the complemented strain Pst ▵saxE ‐ saxEhis were infiltrated into Arabidopsis (C) and tomato (D) leaves at OD 600 = 0.001. Samples were taken at 0 and 3 dpi for colony counts. All experiments were repeated at least three times, and similar results were observed. Data shown are means ± SD. ** indicates significant difference ( t ‐test, P

    Journal: Microbial Biotechnology

    Article Title: Pseudomonas bacteriocin syringacin M released upon desiccation suppresses the growth of sensitive bacteria in plant necrotic lesions

    doi: 10.1111/1751-7915.13367

    Figure Lengend Snippet: The saxE gene was required for Pst growth in leaf extracts and in planta . A. A schematic diagram of the complementary tests pinpointing the minimal region required for rescuing the growth of 25D12 mutant in plant leaf extracts. Filled arrows indicate genes annotated by the sequencing project marked with locus tags on the top. The filled triangle shows the insertion site of Ω‐Km transposon in mutant 25D12 . Genomic DNA fragments downstream the transposon insertion site were tested for the ability to confer tolerance to leaf extracts. B. The minimal region that protected 25D12 in leaf extracts also rescued the growth of the mutant on Arabidopsis plant. Bacterial inocula were infiltrated into Arabidopsis leaves at OD 600 = 0.001. Samples were taken at 0 and 3 dpi for colony counts. The saxE orf was required for bacterial virulence on Arabidopsis (C) and tomato (D) plants. Wild‐type Pst , Pst ▵saxE and the complemented strain Pst ▵saxE ‐ saxEhis were infiltrated into Arabidopsis (C) and tomato (D) leaves at OD 600 = 0.001. Samples were taken at 0 and 3 dpi for colony counts. All experiments were repeated at least three times, and similar results were observed. Data shown are means ± SD. ** indicates significant difference ( t ‐test, P

    Article Snippet: Recombinant RNase‐free DNase I (Takara, Kusatsu, Japan) and SuperScript III Reverse Transcriptase (Invitrogen) were used to remove genomic DNA and synthesize the first‐strand cDNA respectively.

    Techniques: Mutagenesis, Sequencing

    Analysis of APP RNA and protein expression induced by IGK. (A) Western blots of the APP expression in HEK293T and SK-N-SH neuroblastoma cells treated by IGK at different doses. (B) Schematic diagram of three major APP RNA transcripts (770, 751, and 695). (C) Western blot to show APP form change in IGK treatment. Samples were from HEK293T cell lysates. The loading amount of IGK samples was serially reduced so that the APP expression level is close to that of the DMSO control for clearer protein pattern comparison. Proteins on the membrane after electrotransfer during western blotting were stained by Ponceau S. (D) RT-PCR of APP mRNA in IGK treatment. Forward primer targets exon 6 and the reverse primer targets exon 9. All samples received the same RT-PCR protocol. After 25 amplification cycles, the DNA products of each sample were taken for separation and visualization on the 1% agarose gel. This was repeated every three cycles until the DNA bands started to be visible, so that the difference in their relative abundance would not diminish due to over amplification. The results shown were from PCR after 31 cycles.

    Journal: ACS Omega

    Article Title: Effects of RNA Splicing Inhibitors on Amyloid Precursor Protein Expression

    doi: 10.1021/acsomega.7b02073

    Figure Lengend Snippet: Analysis of APP RNA and protein expression induced by IGK. (A) Western blots of the APP expression in HEK293T and SK-N-SH neuroblastoma cells treated by IGK at different doses. (B) Schematic diagram of three major APP RNA transcripts (770, 751, and 695). (C) Western blot to show APP form change in IGK treatment. Samples were from HEK293T cell lysates. The loading amount of IGK samples was serially reduced so that the APP expression level is close to that of the DMSO control for clearer protein pattern comparison. Proteins on the membrane after electrotransfer during western blotting were stained by Ponceau S. (D) RT-PCR of APP mRNA in IGK treatment. Forward primer targets exon 6 and the reverse primer targets exon 9. All samples received the same RT-PCR protocol. After 25 amplification cycles, the DNA products of each sample were taken for separation and visualization on the 1% agarose gel. This was repeated every three cycles until the DNA bands started to be visible, so that the difference in their relative abundance would not diminish due to over amplification. The results shown were from PCR after 31 cycles.

    Article Snippet: RT-PCR The RNA was extracted from HEK293T cells using an RNeasy Mini Kit (74104, Qiagen) and synthesized into the first DNA strand by SuperScript III reverse transcriptase (18080-051, Life Technologies).

    Techniques: Expressing, Western Blot, Electrotransfer, Staining, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Alternative splicing of Arabidopsis HBS1/SKI7 has functional consequences. Arabidopsis HBS1/SKI7 ( At5g10630 ) is alternatively spliced in the nucleus, generating at least three distinct transcripts that are exported to the nucleus. The HBS1 transcript (left) putatitively encodes a translational GTPase, HBS1, that interacts with the decoding factor PELOTA to recognize stalled ribosomes. The SKI7 transcript (center) putatitively encodes SKI7, a protein that associates with the cytosolic RNA exosome, a 3′→5′ exoribonuclease complex that degrades aberrant transcripts. A third splice form (right) encodes a premature translation codon in the fourth exon, presumably triggering NMD after a pioneer round of translation.

    Journal: Frontiers in Plant Science

    Article Title: A Two-Headed Monster to Avert Disaster: HBS1/SKI7 Is Alternatively Spliced to Build Eukaryotic RNA Surveillance Complexes

    doi: 10.3389/fpls.2018.01333

    Figure Lengend Snippet: Alternative splicing of Arabidopsis HBS1/SKI7 has functional consequences. Arabidopsis HBS1/SKI7 ( At5g10630 ) is alternatively spliced in the nucleus, generating at least three distinct transcripts that are exported to the nucleus. The HBS1 transcript (left) putatitively encodes a translational GTPase, HBS1, that interacts with the decoding factor PELOTA to recognize stalled ribosomes. The SKI7 transcript (center) putatitively encodes SKI7, a protein that associates with the cytosolic RNA exosome, a 3′→5′ exoribonuclease complex that degrades aberrant transcripts. A third splice form (right) encodes a premature translation codon in the fourth exon, presumably triggering NMD after a pioneer round of translation.

    Article Snippet: RT-PCR and TOPO Cloning RNA was isolated from Ler Arabidopsis plants with the Spectrum Plant Total RNA (Sigma-Aldrich) kit with on-column DNase I digestion (New England Biolabs). cDNA was synthesized from RNA using oligo (dT)18 primers and SuperScript III reverse transcriptase (Fisher Scientific).

    Techniques: Functional Assay

    Arabidopsis HBS1/SKI7 is alternatively spliced. (A) The human HBS1/SKI7 locus, called HBS1L , produces three primary splice forms: HBS1L splice form 1, a long splice form with 18 exons; HBS1L splice form 2, a slightly shorter splice form skipping exon 3; and HBS1L splice form 3, which selects an alternative exon 5 followed by transcription termination. HBS1Lv3 includes sequences that promote interaction of the protein with the RNA exosome (yellow and red; see Figure 4A ). (B) RNA-Seq of light-grown seedlings shows that At5g10630 is alternatively spliced into three major splice forms ( Cheng et al., 2017 ). Cumulative RNA-Seq reads are shown in black (top panel), and select individual aligned reads are shown in green (bottom panel), with spliced sequences indicated by a black line. Note that reads for the fourth exon are ∼20% of the level of reads for the other coding sequence exons. (C) At5g10630 forms three major splice forms. A short splice form (top) skips exon 4 (yellow), yielding a transcript that encodes HBS1 (A) . A long splice form (middle) includes exon 4 (yellow), yielding a transcript that encodes SKI7 (A) . Rarely, an alternative acceptor site is selected for exon 4, adding five amino acids with no apparently functional consequence. A nonsense splice form (bottom) retains intron 4, which includes two codons, yielding a transcript that is likely subject to NMD. Exons are colored to match protein models in subsequent figures; UTRs are indicated with narrow, white bars.

    Journal: Frontiers in Plant Science

    Article Title: A Two-Headed Monster to Avert Disaster: HBS1/SKI7 Is Alternatively Spliced to Build Eukaryotic RNA Surveillance Complexes

    doi: 10.3389/fpls.2018.01333

    Figure Lengend Snippet: Arabidopsis HBS1/SKI7 is alternatively spliced. (A) The human HBS1/SKI7 locus, called HBS1L , produces three primary splice forms: HBS1L splice form 1, a long splice form with 18 exons; HBS1L splice form 2, a slightly shorter splice form skipping exon 3; and HBS1L splice form 3, which selects an alternative exon 5 followed by transcription termination. HBS1Lv3 includes sequences that promote interaction of the protein with the RNA exosome (yellow and red; see Figure 4A ). (B) RNA-Seq of light-grown seedlings shows that At5g10630 is alternatively spliced into three major splice forms ( Cheng et al., 2017 ). Cumulative RNA-Seq reads are shown in black (top panel), and select individual aligned reads are shown in green (bottom panel), with spliced sequences indicated by a black line. Note that reads for the fourth exon are ∼20% of the level of reads for the other coding sequence exons. (C) At5g10630 forms three major splice forms. A short splice form (top) skips exon 4 (yellow), yielding a transcript that encodes HBS1 (A) . A long splice form (middle) includes exon 4 (yellow), yielding a transcript that encodes SKI7 (A) . Rarely, an alternative acceptor site is selected for exon 4, adding five amino acids with no apparently functional consequence. A nonsense splice form (bottom) retains intron 4, which includes two codons, yielding a transcript that is likely subject to NMD. Exons are colored to match protein models in subsequent figures; UTRs are indicated with narrow, white bars.

    Article Snippet: RT-PCR and TOPO Cloning RNA was isolated from Ler Arabidopsis plants with the Spectrum Plant Total RNA (Sigma-Aldrich) kit with on-column DNase I digestion (New England Biolabs). cDNA was synthesized from RNA using oligo (dT)18 primers and SuperScript III reverse transcriptase (Fisher Scientific).

    Techniques: RNA Sequencing Assay, Sequencing, Functional Assay

    Activation deficiency of chicken and porcine TLR5 can be partially rescued with respective TLR5 chimeras. HeLa ( A ) or HEK293-T cells ( B ) were transiently transfected with adjusted amounts of plasmid DNA encoding for TLR5 from different species or chimeric receptors (transfected plasmid amounts see Fig. 1 ). 48 h after transfection, cells were coincubated with purified recombinant Salmonella FliC (50 ng/well) or mock-treated for four hours. IL-8 secretion in the cell supernatants was determined by ELISA. IL-8 secretion of hTLR5-transfected, FliC-stimulated cells was set to 100% (reference); relative IL-8 secretion of all constructs with regard to the reference is depicted. Each condition was tested in two independent biological replicates (each in technical triplicates), the results of which are summarized here as mean and standard error. One representative experiment out of three is shown. For all constructs in A and B, except for pEF6-empty, the differences between mock-coincubated and FliC-coincubated condition were highly significant (Student’s t -test, unpaired, two-tailed; p

    Journal: Scientific Reports

    Article Title: Functional expression of TLR5 of different vertebrate species and diversification in intestinal pathogen recognition

    doi: 10.1038/s41598-018-29371-0

    Figure Lengend Snippet: Activation deficiency of chicken and porcine TLR5 can be partially rescued with respective TLR5 chimeras. HeLa ( A ) or HEK293-T cells ( B ) were transiently transfected with adjusted amounts of plasmid DNA encoding for TLR5 from different species or chimeric receptors (transfected plasmid amounts see Fig. 1 ). 48 h after transfection, cells were coincubated with purified recombinant Salmonella FliC (50 ng/well) or mock-treated for four hours. IL-8 secretion in the cell supernatants was determined by ELISA. IL-8 secretion of hTLR5-transfected, FliC-stimulated cells was set to 100% (reference); relative IL-8 secretion of all constructs with regard to the reference is depicted. Each condition was tested in two independent biological replicates (each in technical triplicates), the results of which are summarized here as mean and standard error. One representative experiment out of three is shown. For all constructs in A and B, except for pEF6-empty, the differences between mock-coincubated and FliC-coincubated condition were highly significant (Student’s t -test, unpaired, two-tailed; p

    Article Snippet: 1 µg of total DNA-free RNA was used for cDNA synthesis with Superscript III reverse transcriptase (Invivogen) and oligo(dT) primers (Invivogen).

    Techniques: Activation Assay, Transfection, Plasmid Preparation, Purification, Recombinant, Enzyme-linked Immunosorbent Assay, Construct, Two Tailed Test

    Quantitative PCR validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of three independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p

    Journal: European Journal of Nutrition

    Article Title: Antitumor activity and expression profiles of genes induced by sulforaphane in human melanoma cells

    doi: 10.1007/s00394-017-1527-7

    Figure Lengend Snippet: Quantitative PCR validation of 12 DEGs in A375 cells treated with SFN. Relative fold expression of candidate genes was normalized against GADPH expression. The data represent the mean ± SD of three independent replicates. The black bars represent untreated cells at time 0, and the grey bars represent the relative fold change after SFN treatment. Statistical analysis was performed by paired two-tailed Student’s test (* p

    Article Snippet: Quantitative real-time PCR (qPCR) cDNA was synthesized using Superscript III Reverse Transcriptase (Sigma) according to the manufacturer’s instructions. qPCR was performed in 96-well plates using iQ™ SYBR Green Supermix (Bio-Rad) and an I-cycler iQ Real-Time PCR instrument (Bio-Rad).

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Two Tailed Test

    OligoA mutations change CoTC cleavage distribution. ( A ) The hscRACE procedure. Terminator element (black box), exon 3 (grey box) and cleavage sites (lightning bolts) are shown. Biotinylated RNA probe, β3 (tailed box), was hybridized to nuclear RNA isolated from HeLa cells transfected with pβT+ or pβTa- > c and then isolated by magnetic selection. Selected RNA is subjected to oligonucleotide (dotted line)-directed RNAse H digestion releasing RNA from beads. This is ligated and reversed transcribed across the ligated junction. cDNA is then amplified by PCR using gene-specific primers. The PCR products are analysed on a gel, cloned and sequenced. ( B ) Terminator DNA sequence showing the positions of CoTC-derived RNA 3′-ends in pβT+ (black filled arrows) and pβTa- > c (empty arrows). Positions of AA to CC mutations in pβTa- > c are underlined. The numbers above each arrow indicate the number of clones identified for each site. The hscRACE experiment was performed three and seven times for pβT+ and pβTa- > c, respectively, in order to obtain fifty positive colonies for each construct. ( C ) Effect of siRNA-mediated knock down of CPSF73 and CstF64. pβT+ΔpA has a mutated PAS (AATAAA- > GAATTC), known to inactivate β-globin mRNA polyadenylation (Dye and Proudfoot, 1999). This was transfected into CPSF73 and CstF64 siRNA-treated and mock-treated cells. Relative RNA continuity (based on RT/PCR analysis as in Figure 2 A) was assessed and is presented graphically. Error bars denote standard deviation.

    Journal: Nucleic Acids Research

    Article Title: AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

    doi: 10.1093/nar/gks1335

    Figure Lengend Snippet: OligoA mutations change CoTC cleavage distribution. ( A ) The hscRACE procedure. Terminator element (black box), exon 3 (grey box) and cleavage sites (lightning bolts) are shown. Biotinylated RNA probe, β3 (tailed box), was hybridized to nuclear RNA isolated from HeLa cells transfected with pβT+ or pβTa- > c and then isolated by magnetic selection. Selected RNA is subjected to oligonucleotide (dotted line)-directed RNAse H digestion releasing RNA from beads. This is ligated and reversed transcribed across the ligated junction. cDNA is then amplified by PCR using gene-specific primers. The PCR products are analysed on a gel, cloned and sequenced. ( B ) Terminator DNA sequence showing the positions of CoTC-derived RNA 3′-ends in pβT+ (black filled arrows) and pβTa- > c (empty arrows). Positions of AA to CC mutations in pβTa- > c are underlined. The numbers above each arrow indicate the number of clones identified for each site. The hscRACE experiment was performed three and seven times for pβT+ and pβTa- > c, respectively, in order to obtain fifty positive colonies for each construct. ( C ) Effect of siRNA-mediated knock down of CPSF73 and CstF64. pβT+ΔpA has a mutated PAS (AATAAA- > GAATTC), known to inactivate β-globin mRNA polyadenylation (Dye and Proudfoot, 1999). This was transfected into CPSF73 and CstF64 siRNA-treated and mock-treated cells. Relative RNA continuity (based on RT/PCR analysis as in Figure 2 A) was assessed and is presented graphically. Error bars denote standard deviation.

    Article Snippet: RNA analysis One microgram of RNA was reverse transcribed with Superscript III Reverse Transcriptase (Stratagene) followed by quantitative PCR with a QuantiTect SYBR green kit (Qiagen) on a Corbett Rotor Gene 3000 machine using primers listed ( Supplementary Table S1 ).

    Techniques: Isolation, Transfection, Selection, Amplification, Polymerase Chain Reaction, Clone Assay, Sequencing, Derivative Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Standard Deviation

    (a) Overall elastin (R2) after fractional carbon dioxide (CO 2 ) laser resurfacing. T1 and T2 are ADSC-CM-treated sites after a single pass of fractionated CO 2 laser energy of 8 and 16 mJ, respectively. C1 and C2 are the DMEM-applied control sites after single passes of 8 and 16 mJ, respectively. D0: before treatment; D1: 1 day after treatment; D3: 3 days after treatment; D7: 7 days after treatment; D14: 14 days after treatment; and D21: 21 days after treatment. (b) HE (1 and 2), Masson-Trichrome (3 and 4), and Gomori's aldehyde fuchsin (5 and 6) staining of biopsy specimen from fractional carbon dioxide laser-treated sites on day 21. Scale bar 50 μ m. (c) Total RNA was extracted from biopsied skin samples of different groups. Procollagen types I and III and elastin mRNA were determined by real-time RT-PCR analysis. Results are shown as means ± SD ( n = 3). The asterisk (∗) indicates a significant difference ( P

    Journal: BioMed Research International

    Article Title: The Effect of Conditioned Media of Adipose-Derived Stem Cells on Wound Healing after Ablative Fractional Carbon Dioxide Laser Resurfacing

    doi: 10.1155/2013/519126

    Figure Lengend Snippet: (a) Overall elastin (R2) after fractional carbon dioxide (CO 2 ) laser resurfacing. T1 and T2 are ADSC-CM-treated sites after a single pass of fractionated CO 2 laser energy of 8 and 16 mJ, respectively. C1 and C2 are the DMEM-applied control sites after single passes of 8 and 16 mJ, respectively. D0: before treatment; D1: 1 day after treatment; D3: 3 days after treatment; D7: 7 days after treatment; D14: 14 days after treatment; and D21: 21 days after treatment. (b) HE (1 and 2), Masson-Trichrome (3 and 4), and Gomori's aldehyde fuchsin (5 and 6) staining of biopsy specimen from fractional carbon dioxide laser-treated sites on day 21. Scale bar 50 μ m. (c) Total RNA was extracted from biopsied skin samples of different groups. Procollagen types I and III and elastin mRNA were determined by real-time RT-PCR analysis. Results are shown as means ± SD ( n = 3). The asterisk (∗) indicates a significant difference ( P

    Article Snippet: Total RNA was extracted from biopsy skin samples by using TRIzol (Invitrogen, USA). cDNA was synthesized from the isolated RNA using SuperScript III Reverse Transcriptase (Keygen, China).

    Techniques: Staining, Quantitative RT-PCR

    P2X receptor expression in LAD2 cells and HLMCs. RT-PCR on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from three donors. Both types of human mast cells revealed the presence of P2X1, P2X4

    Journal: British Journal of Pharmacology

    Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells

    doi: 10.1111/j.1476-5381.2009.00287.x

    Figure Lengend Snippet: P2X receptor expression in LAD2 cells and HLMCs. RT-PCR on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from three donors. Both types of human mast cells revealed the presence of P2X1, P2X4

    Article Snippet: For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation

    Expression pattern of IVSPER genes in Hyposoter didymator calyx cells during pupal developmental stages. (A) Mean reads per kilo base per million mapped reads (RPKM) values are given from RNA-seq analyses (transformed by log10). Genes with a similar expression pattern are represented by the same color (genes with stable transcript levels over pupal development time in orange, genes with increasing transcript levels in blue and those with decreased transcript levels in green). See S1 Table for raw values. The three analyzed pupal stages are shown underneath the graph: St1: pupal stage 1; St2: pupal stage 2; St3: pupal stage 3. For each stage, are shown (i) a picture of dissected wasp ovaries; white arrows indicate the calyx where virus particles are produced and (ii) TEM micrographs of calyx cells showing that the first particles are visible at stage 3. N, nucleus; C, cytoplasm; black arrows indicate viral particles. (B) Schematic representation of the different categories of expression profiles observed for IVSPER genes and list of genes in each category (see S4 Table for detail of statistical analyses). NS, no statistical differences of the RPKM values between the 2 compared pupal stages; if p

    Journal: PLoS Pathogens

    Article Title: RNA interference identifies domesticated viral genes involved in assembly and trafficking of virus-derived particles in ichneumonid wasps

    doi: 10.1371/journal.ppat.1008210

    Figure Lengend Snippet: Expression pattern of IVSPER genes in Hyposoter didymator calyx cells during pupal developmental stages. (A) Mean reads per kilo base per million mapped reads (RPKM) values are given from RNA-seq analyses (transformed by log10). Genes with a similar expression pattern are represented by the same color (genes with stable transcript levels over pupal development time in orange, genes with increasing transcript levels in blue and those with decreased transcript levels in green). See S1 Table for raw values. The three analyzed pupal stages are shown underneath the graph: St1: pupal stage 1; St2: pupal stage 2; St3: pupal stage 3. For each stage, are shown (i) a picture of dissected wasp ovaries; white arrows indicate the calyx where virus particles are produced and (ii) TEM micrographs of calyx cells showing that the first particles are visible at stage 3. N, nucleus; C, cytoplasm; black arrows indicate viral particles. (B) Schematic representation of the different categories of expression profiles observed for IVSPER genes and list of genes in each category (see S4 Table for detail of statistical analyses). NS, no statistical differences of the RPKM values between the 2 compared pupal stages; if p

    Article Snippet: Reverse-transcriptase quantitative real-time PCR (RT-qPCR) For RT-qPCRs, 400 ng of purified RNA were reverse-transcripted with the SuperScript III Reverse Transcriptase kit (Life Technologies) and oligo(dT)15 primer (Promega).

    Techniques: Expressing, RNA Sequencing Assay, Transformation Assay, Produced, Transmission Electron Microscopy, IF-P

    Downregulation of p53 is required for DCAF1-dependent cell cycle entry. ( a – d ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 at indicated time points. The cell size measured by flow-cytometry ( a ), the cell proliferation determined by CFSE dilution assay ( b ), the amounts of DNA synthesis measured by BrdU incorporation assay 24 h post activation ( c ), and p53 and c-Myc protein expression assessed by immunoblotting ( d ) were compared. ( e ) Comparison of the proliferation of CD4 + naive T cells of indicated genotypes (lines) to that of wild-type CD4 + T cells (shaded area) determined by CFSE dilution assay at indicated time points post anti-CD3 and anti-CD28 activation in the presence of 4-hydroxy-tamoxifen. ( f , g ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 for 5 days to generate effector T cells in the presence of 4-hydroxy-tamoxifen. Quiescent effector T cells were either re-stimulated with IL-2 for 24 h or remained unstimulated (quiescence). The amounts of DNA synthesis were determined by BrdU incorporation assay ( f ). The protein expression of p53 and c-Myc was analysed by immunoblotting ( g ). In this figure, representative flow-cytometry and immunoblotting results of three experiments are shown. For BrdU incorporation assay results ( c , f ), means±s.d. of three experiments are shown. See also Supplementary Fig. 6 .

    Journal: Nature Communications

    Article Title: DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    doi: 10.1038/ncomms10307

    Figure Lengend Snippet: Downregulation of p53 is required for DCAF1-dependent cell cycle entry. ( a – d ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 at indicated time points. The cell size measured by flow-cytometry ( a ), the cell proliferation determined by CFSE dilution assay ( b ), the amounts of DNA synthesis measured by BrdU incorporation assay 24 h post activation ( c ), and p53 and c-Myc protein expression assessed by immunoblotting ( d ) were compared. ( e ) Comparison of the proliferation of CD4 + naive T cells of indicated genotypes (lines) to that of wild-type CD4 + T cells (shaded area) determined by CFSE dilution assay at indicated time points post anti-CD3 and anti-CD28 activation in the presence of 4-hydroxy-tamoxifen. ( f , g ) CD4 + naive T cells of different genotypes were activated by anti-CD3 and anti-CD28 for 5 days to generate effector T cells in the presence of 4-hydroxy-tamoxifen. Quiescent effector T cells were either re-stimulated with IL-2 for 24 h or remained unstimulated (quiescence). The amounts of DNA synthesis were determined by BrdU incorporation assay ( f ). The protein expression of p53 and c-Myc was analysed by immunoblotting ( g ). In this figure, representative flow-cytometry and immunoblotting results of three experiments are shown. For BrdU incorporation assay results ( c , f ), means±s.d. of three experiments are shown. See also Supplementary Fig. 6 .

    Article Snippet: RNA preparation and real-time PCR Total RNA was prepared from T cells using TRIzol reagent (Invitrogen, 15596-026) as per manufacturer's instructions, and was reverse-transcribed into complementary DNA with Superscript III reverse transcriptase kit (Bioline, BIO-65054).

    Techniques: Flow Cytometry, Cytometry, Dilution Assay, DNA Synthesis, BrdU Incorporation Assay, Activation Assay, Expressing

    DCAF1 is essential for cell cycle entry. ( a ) DCAF1 protein expression in CD4 + T cells of different genotypes at indicated time points after TCR activation and 4-hydroxy-tamoxifen treatment, analysed by immunoblotting. The immunoblotting is representative of at least three experiments. ( b – d ) Equal numbers of wild-type (CD45.1 + ) and ERCre ; Dcaf1 fl/fl (CD45.2 + ) CD4 + T cells were mixed and activated with anti-CD3 and anti-CD28 in the presence of 4-hydroxy-tamoxifen. At indicated time points after activation, the cell sizes ( b ), the proliferation ( c ) and the amount of DNA synthesis (measured by BrdU incorporation assay) ( d ) of the T cells of different genotypes were assessed and compared. Results are representative of at least three experiments. ( e , f ) CD4 + T cells from wild-type (CD45.1 + ) and ERCre ; Dcaf1 fl/fl (CD45.2 + ) mice were mixed and activated by anti-CD3 and anti-CD28 in the presence of 4-hydroxy-tamoxfin for 5 days for them to become effector T cells. Quiescent effector T cells were either re-stimulated with IL-2 or remained unstimulated (quiescence). The amount of DNA synthesis (measured by BrdU incorporation assay) ( e ) and the sizes ( f ) of the cells of different origins were compared. The bar graphs show the means±s.d. of data from four experiments (* P

    Journal: Nature Communications

    Article Title: DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    doi: 10.1038/ncomms10307

    Figure Lengend Snippet: DCAF1 is essential for cell cycle entry. ( a ) DCAF1 protein expression in CD4 + T cells of different genotypes at indicated time points after TCR activation and 4-hydroxy-tamoxifen treatment, analysed by immunoblotting. The immunoblotting is representative of at least three experiments. ( b – d ) Equal numbers of wild-type (CD45.1 + ) and ERCre ; Dcaf1 fl/fl (CD45.2 + ) CD4 + T cells were mixed and activated with anti-CD3 and anti-CD28 in the presence of 4-hydroxy-tamoxifen. At indicated time points after activation, the cell sizes ( b ), the proliferation ( c ) and the amount of DNA synthesis (measured by BrdU incorporation assay) ( d ) of the T cells of different genotypes were assessed and compared. Results are representative of at least three experiments. ( e , f ) CD4 + T cells from wild-type (CD45.1 + ) and ERCre ; Dcaf1 fl/fl (CD45.2 + ) mice were mixed and activated by anti-CD3 and anti-CD28 in the presence of 4-hydroxy-tamoxfin for 5 days for them to become effector T cells. Quiescent effector T cells were either re-stimulated with IL-2 or remained unstimulated (quiescence). The amount of DNA synthesis (measured by BrdU incorporation assay) ( e ) and the sizes ( f ) of the cells of different origins were compared. The bar graphs show the means±s.d. of data from four experiments (* P

    Article Snippet: RNA preparation and real-time PCR Total RNA was prepared from T cells using TRIzol reagent (Invitrogen, 15596-026) as per manufacturer's instructions, and was reverse-transcribed into complementary DNA with Superscript III reverse transcriptase kit (Bioline, BIO-65054).

    Techniques: Expressing, Activation Assay, DNA Synthesis, BrdU Incorporation Assay, Mouse Assay

    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Journal: International Journal of Molecular Sciences

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    doi: 10.3390/ijms19124017

    Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction

    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of three independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) ChIP-qPCR analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.

    Journal: PLoS Genetics

    Article Title: Stage-Dependent and Locus-Specific Role of Histone Demethylase Jumonji D3 (JMJD3) in the Embryonic Stages of Lung Development

    doi: 10.1371/journal.pgen.1004524

    Figure Lengend Snippet: Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of three independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) ChIP-qPCR analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.

    Article Snippet: A total of 1 µg of RNA was converted to cDNA using Superscript III Reverse Transcriptase (Qiagen) with random hexamer primers. qPCR was carried out using SYBR Green mix on the ABI 7000 PCR machine.

    Techniques: Methylation, Chromatin Immunoprecipitation, Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Real-time Polymerase Chain Reaction, Expressing

    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Journal: Journal of Immunology Research

    Article Title: TLR3 Modulates the Response of NK Cells against Schistosoma japonicum

    doi: 10.1155/2018/7519856

    Figure Lengend Snippet: Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Article Snippet: 1 μ g of total RNA was transcribed to cDNA by using a SuperScript III Reverse Transcriptase Kit (Qiagen, Valencia, CA).

    Techniques: Expressing, Infection, Mouse Assay, Isolation, Flow Cytometry, Cytometry, FACS, Real-time Polymerase Chain Reaction