Journal: PLoS ONE

Article Title: Ethanol treatment of nanoPGA/PCL composite scaffolds enhances human chondrocyte development in the cellular microenvironment of tissue-engineered auricle constructs

doi: 10.1371/journal.pone.0253149

Figure Lengend Snippet: Following specimen implantation in nude mice for 10 weeks, comparisons were made between tissue-engineered human auricular constructs having their scaffolds either treated with ethanol or left untreated (controls). For treated (specimen number, n = 6) compared to control (n = 4) specimens, quantitative chondrocyte expression levels were found to be significantly increased (*p = 0.040) for SOX5 and equivalent (not statistically significantly different) for COL2A1 (p = 0.080) and ELN (p = 0.331) (upper left panel). There were no significant differences between ethanol-treated and untreated constructs in gene expression of B2M (p = 0.187), CASP8 (p = 0.737) or CASP9 (p = 0.070) while IL1A was significantly decreased (*p = 0.040) (lower left panel). Functionally, viable auricular chondrocytes express genes (boldface type) with appropriate transcription factors (Tfrs, SOX9 ) that lead to the translation of proteins necessary for formation of a cartilaginous extracellular matrix (upper panel right). Cells and tissues normally follow apoptotic and necrotic pathways through different gene pathways (lower right panel). Certain of these genes (boldface type) analyzed in this study are shown in such pathways. These genes represented the major and definitive pathway genes of principal interest in this report, and they precluded examination of additional genes (such as SOX6 , SOX9 , CASP3 , CASP7 ) of slightly less importance in the work or involved in secondary pathways. Error bars represent standard error of the mean for normalized gene expression values. SOX6 or SOX9 = SRY (sex determining region Y)-box 6 or 9.

Article Snippet: Certain genes involved in cartilage matrix formation were analyzed and included type II collagen ( COL2A1 , Hs00264051_m1), elastin ( ELN , Hs00355783_m1), and SRY (sex determining region Y)-box 5 ( SOX5 , Hs00374709_m1).

Techniques: Construct, Control, Expressing, Gene Expression

Journal: PLoS ONE

Article Title: Ethanol treatment of nanoPGA/PCL composite scaffolds enhances human chondrocyte development in the cellular microenvironment of tissue-engineered auricle constructs

doi: 10.1371/journal.pone.0253149

Figure Lengend Snippet: Average gene expression values normalized to P0 for human auricular chondrocytes seeded onto ethanol-treated scaffolds and retrieved from tissue-engineered constructs after 10- or 20-weeks of implantation in nude mice.

Article Snippet: Certain genes involved in cartilage matrix formation were analyzed and included type II collagen ( COL2A1 , Hs00264051_m1), elastin ( ELN , Hs00355783_m1), and SRY (sex determining region Y)-box 5 ( SOX5 , Hs00374709_m1).

Techniques: Gene Expression, Construct

Journal: BioResearch Open Access

Article Title: Gradient Fractionated Separation of Chondrogenically Committed Cells Derived from Human Embryonic Stem Cells

doi: 10.1089/biores.2014.0051

Figure Lengend Snippet: Analysis of the fractionated cell populations. (A) Relative gene expression of OCT4, NANOG, SOX5, SOX6, SOX9, ACAN, COL2A1 , and COL2A1:COL1A1 ratio in all four fractions (F1–F4) after density gradient separation. Vertical axes represent the relative gene expression level. Horizontal axes represent the four fractions (F1–F4) from the discontinuous density gradient for both control- and chondrogenic media. Data are expressed as mean±standard deviation ( n =4). *Significant difference between fractions within the chondrogenic medium ( p <0.05). (B) Monolayer culture of the cellular outcome before gradient separation and the 4 fractionated (F1–F4) cell populations with chondrogenic medium. (C) Histological sections of pelleted cells (F3 and F4) with chondrogenic medium after 28 days visualized by toluidine blue pH 4. Scale bar=150 μm.

Article Snippet: The following TaqMan ® Gene Expression Assays (4331182, Applied Biosystems) were used: Nanog homeobox; Hs02387400_g1( NANOG ), POU class 5 homebox ( POU5F1 ) ( OCT4 ); Hs03005111_g1, sex determining region Y box 9 ( SOX9 ); Hs00165814_m1, ( SOX6 ); Hs00264525_m1, ( SOX5 ); Hs00753050_s1, collagen type 2 alpha 1 ( COL2A1 ); Hs00264051_m1, collagen type 1 alpha 1 ( COL1A1 ); Hs00164004_m1, collagen type ( COL10 ); Hs00166657_m1, Aggrecan ( ACAN ); and Hs00153936_m1.

Techniques: Gene Expression, Control, Standard Deviation

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: Effect of S-SOX5 on the human SPAG16L promoter activity. 2-kb human SPAG16L promoter construct was transfected to BEAS-2B cells. The cells were also co-transfected with S-SOX5/pcDNA3 or empty pcDNA3 plasmid. The promoter activity was measured by dual luciferase assays after 48 h transfection. Values indicate mean ± S.E. ( error bars ) of the relative luciferase activity (n = 3). * p < 0.05 (Student’s t test) compared to the control

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Activity Assay, Construct, Transfection, Plasmid Preparation, Luciferase, Control

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: Exogenous S-SOX5 up-regulates SPAG16L mRNA expression in BEAS-2B cells. a Western blot analysis of S-SOX5 protein levels in BESA-2B cells stably expressing S-SOX5 ( left ) or infected with AdS-SOX5 ( right ) detected with the Pico system. b Analysis of SPAG16L mRNA expression by real-time PCR. GAPDH was also amplified simultaneously to normalize the results. Values indicate mean ± S.E. ( error bars ) of the relative mRNA level (n = 3). * p < 0.05 (Student’s t test) compared to the controls

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Expressing, Western Blot, Stable Transfection, Infection, Real-time Polymerase Chain Reaction, Amplification

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: Knockdown of S-SOX5 in BEAS-2B cells by RNAi results in decrease of SPAG16L mRNA. a Western blot analysis of S-SOX5 proteins in BEAS-2B cells stably expressing two RNAi constructs. b After RNAi treatment, the levels of S-SOX5 in BEAS-2B cells were estimated by analysing intensity of protein bands using ImageJ software. c Analysis of SPAG16L mRNA expression by real-time PCR in BEAS-2B cells transfected with two SOX5 RNAi constructs. Silencing of S-SOX5 by RNAi reduced expression of SPAG16L. Values indicate mean ± S.E. ( error bars ) of the relative mRNA level (n = 3). * p < 0.05 (Student’s t test) compared to the control

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Knockdown, Western Blot, Stable Transfection, Expressing, Construct, Software, Real-time Polymerase Chain Reaction, Transfection, Control

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: S-SOX5 associates with the human SPAG16L promoter as revealed by ChIP assay. A Schematic representation of the human SPAG16L proximal promoter and the regions ( a – c ) amplified by ChIP primers used in this study. Arrows show the location of the primers. B Representative ChIP assay results with BEAS-2B cells infected by AdS-SOX5 using a control rabbit IgG or an antibody specifically against SOX5. a with a primer set not flanking any potential SOX5 binding sites; b and c , with primer sets flanking potential SOX5 binding sites. C qPCR quantification of ChIP products. DNA recovered from ChIP was used as a template for real-time PCR analysis. Data shown are mean ± S.E. ( error bars ) of three independent replicates. * p < 0.05 (Student’s t test) compared to the normal rabbit IgG pulldown group

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Amplification, Infection, Control, Binding Assay, Real-time Polymerase Chain Reaction

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: Functional analyses of S-SOX5 binding sites in the human SPAG16L promoter. Left maps of the wild-type human SPAG16L promoter construct containing two putative SOX5 binding sites (P-I & P-II) and the constructs with mutations of the potential SOX5 binding sites. Right , effect of S-SOX5 on the function of the wild-type and mutated SPAG16L promoter. BEAS-2B cells were co-transfected with SPAG16L promoter constructs and either pcDNA3 control or S-SOX5/pcDNA3. Relative luciferase activity, normalized to pGL3 control plasmids co-transfected with pcDNA3 vectors. Values are mean ± S.E. ( error bars ) of the relative luciferase activity (n = 3). Bars labeled with different letters are significantly different ( p < 0.05; two-way ANOVA with Tukey’s HSD test)

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Functional Assay, Binding Assay, Construct, Transfection, Control, Luciferase, Activity Assay, Labeling

Journal: BMC Molecular Biology

Article Title: Transcriptional regulation of human sperm-associated antigen 16 gene by S-SOX5

doi: 10.1186/s12867-017-0082-3

Figure Lengend Snippet: Oligonucleotides used in this study

Article Snippet: After blocking in TBS-T buffer (Tris-buffered saline solution containing 5% non-fat dry milk and 0.05% Tween 20) for 1 h, the membranes were incubated with antibodies against SOX5 (Aviva Systems Biology, Santa Cruz, CA) or rabbit β-actin (Cell Signaling Technology, Danvers, MA) overnight at 4 °C.

Techniques: Sequencing, Expressing, Real-time Polymerase Chain Reaction, Mutagenesis, Binding Assay

Journal: Biomedicines

Article Title: Alginate-Agarose Hydrogels Improve the In Vitro Differentiation of Human Dental Pulp Stem Cells in Chondrocytes. A Histological Study

doi: 10.3390/biomedicines9070834

Figure Lengend Snippet: Genes IDs and corresponding assay numbers of transcripts analyzed by real-time RT-PCR.

Article Snippet: SOX5 , SRY-Box Transcription Factor 5 , Hs01552796_m1 , 3D.

Techniques:

Journal: Cell reports

Article Title: SoxD genes are required for adult neural stem cell activation.

doi: 10.1016/j.celrep.2022.110313

Figure Lengend Snippet: Figure 1. Sox5 and Sox6 are expressed predominantly in RGLs in the adult DG (A and B) Confocal images showing immunohistochemistry with the indicated marker in coronal sections of dorsal DG from 2-month-old mice. (A) Sox5 and Sox6 are co-expressed in the majority of Sox2+ cells. (B) Sox5 and Sox6 are expressed in RGLs in Sox2-EGFP mice (yellow arrows; higher magnification in box). (C) Sox6 is expressed in a subset of Tbr2+ IPCs (higher magnification in boxes). (D) Sox5 and Sox6 are expressed in few Dcx+ iGNs (yellow arrows). (E) Sox5 and Sox6 are expressed in S100+ astrocytes (yellow arrows). (F) Quantification of the percentage of cells that express the indicated cell type-specific maker in Sox5+ cells or Sox6+ cells (top; >300 cells/marker) and the percentage of Sox5+ or Sox6+ cells among cells expressing the indicated cell-type marker (bottom; >300 cells/marker). (G) Confocal images showing RGLs in Sox2-creERT2/Rosa-YFP mice expressing YFP, MCM2, and Sox5 (yellow arrows). (H) Violin plot representing the intensity of Sox5 immunofluorescence in GFAP+MCM2 qRGLs (n = 65) and in GFAP+MCM2+ aRGLs (n = 31), relative to Sox5 expression levels in qRGLs in Sox2-creERT2/Rosa-YFP mice. (I) Summary of Sox5- and Sox6-expressing cells in the SGZ. In all panels, nuclei were counterstained with bisbenzimide (blue). n = 3–5 mice and n = 3–6 sections/animal for each immunostaining. A, astrocyte; GN, granular neuron; GCL, granule cell layer; Hi, hilus; iGN, immature granular neuron; IPC, intermediate progenitor cell; SGZ, subgranular zone. Data are represented as mean ± SEM. Unpaired two-tailed Student’s t test: ***p = 1.001 3 106. Scale bars represent 35 mm (A and C), 20 mm (B, D, and E), and 15 mm (G). See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HBSS Fisher Scientific Cat#24020117 Papain Worthington Cat#33H14332L Cysteine Sigma Aldrich Cat#C7352 Poly-L-ornithin Sigma Aldrich Cat#P3655 Fibronectin Invitrogen Cat#33010-018 Insulin Sigma Aldrich Cat#16634 Corn Oil Sigma Aldrich Cat#C8267 Critical commercial assays Effectene Transfection Reagent Quiagen Cat#301425 P3 Primary Cell 4D-NucleofectorTM X Kit Lonza Cat#V4XP-3012 Dual Luciferase Reporter Assay System Promega Cat#E1910 QuickGene RNA tissue Kit S Kurabo Cat#RT-S2 SuperScriptTM IV First-Stand Synthesis System Invitrogen Cat#18091050 TaqMan Fast Advanced Master Mix Applied Biosystems Cat#A44360 Experimental models: Organisms/strains Mouse: C57Bl/6 Charles River Laboratories N/A Mouse: Sox2:CreERT2 S. Nicolis (U. Milano-Biccoca); (Favaro et al., 2009) http://www.informatics.jax.org/ allele/MGI:4397776 Mouse: Sox2-EGFP F. Gage (Salk Institute); (Suh et al.,2007) N/A Mouse: Sox5flox/flox V. Lefebvre (Philadelphia); (Dy et al., 2008) http://www.informatics.jax.org/ allele/MGI:3799354 Mouse: Sox6 flox/flox V. Lefebvre (Philadelphia); (Dumitriu et al., 2006) http://www.informatics.jax.org/ allele/MGI:3641205 Mouse: Rosa26lox-stop-lox-YFP The Jackson Laboratory https://www.jax.org/strain/006148 Oligonucleotides Ascl1 Probe Applied Biosystems Mm03058063_m1 Bmpr1a Probe Applied Biosystems Mm00477650_m1 Bmpr1b Probe Applied Biosystems Mm03023971_m1 Gapdh Probe Applied Biosystems Mm99999915_g1 Id2 Probe Applied Biosystems Mm00711781_m1 Id4 Probe Applied Biosystems Mm00499701_m1 Pgk1 Probe Applied Biosystems Mm00435617_m1 Sox5 Probe Applied Biosystems Mm01264584_m1 Sox6 Probe Applied Biosystems Mm00488393_m1 Primer sequences: Ascl1 Fw: CGCTCCTGTCGCTGAGGTGTTTC Sigma Forward Primer Primer sequences: Ascl1 Rv: GCTTCCCCCTCACAATCACAGG Sigma Reverse Primer Recombinant DNA Plasmid pCIG-Sox5 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox6 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox2 J. Muhr (Karolinska); (Kurtsdotter et al., 2017) N/A Plasmid pRP-Enh-Ascl1-Luciferase Vector Builder Company ID: VB210601-1396nca (Continued on next page) e2 Cell Reports 38, 110313, February 1, 2022

Techniques: Immunohistochemistry, Marker, Expressing, Immunostaining, Two Tailed Test

Journal: Cell reports

Article Title: SoxD genes are required for adult neural stem cell activation.

doi: 10.1016/j.celrep.2022.110313

Figure Lengend Snippet: Figure 2. Sox5 and Sox6 are required for the activation of adult RGLs (A) Generation of mice harboring a Sox5 or Sox6 inducible conditional null allele in the adult brain. TAM intraperitoneal (i.p.) injection was performed in 2- to 3-month-old mice on 5 consecutive days, and after 7, 14, or 30 days post-TAM injection (dpi), brains were collected. (B) Confocal image showing YFP+ cells that un- derwent recombination 30 dpi in a control mouse (Sox2-creERT2/Rosa-YFP). (C) Confocal images showing YFP, MCM2, and radial GFAP (rGFP) at 30 dpi in adult control, Sox5icKO, and Sox6icKO mice. White arrows indi- cate YFP+rGFAP+MCM2 cells and yellow arrows YFP+rGFAP+MCM2+ cells. (D) Quantitation of the number of rGFAP+ cells among YFP+ cells and of proliferating rGFAP+MCM2+ cells among rGFAP+YFP+ cells in the indicated mice at 30 dpi. Each symbol repre- sents an independent biological replicate. (E) Quantitation of the number of rGFAP+ cells in YFP+ cells and proliferating rGFAP+MCM2+ cells in rGFAP+ YFP+ cells in mice at 7dpi (n = 5, 4, and 4 for control, Sox5icKO, and Sox6icKO, respectively), 14 dpi (n = 5, 9, and 6) and 30 dpi (n = 6, 5, and 6). Data represent mean value ± SEM. n > 100 cells for each quantification. Unpaired two-tailed Student’s t test comparing each group with control: *p < 0.05, **p < 0.01, and *** p < 0.001. Scale bars, 100 mm (B) and 20 mm (C). See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HBSS Fisher Scientific Cat#24020117 Papain Worthington Cat#33H14332L Cysteine Sigma Aldrich Cat#C7352 Poly-L-ornithin Sigma Aldrich Cat#P3655 Fibronectin Invitrogen Cat#33010-018 Insulin Sigma Aldrich Cat#16634 Corn Oil Sigma Aldrich Cat#C8267 Critical commercial assays Effectene Transfection Reagent Quiagen Cat#301425 P3 Primary Cell 4D-NucleofectorTM X Kit Lonza Cat#V4XP-3012 Dual Luciferase Reporter Assay System Promega Cat#E1910 QuickGene RNA tissue Kit S Kurabo Cat#RT-S2 SuperScriptTM IV First-Stand Synthesis System Invitrogen Cat#18091050 TaqMan Fast Advanced Master Mix Applied Biosystems Cat#A44360 Experimental models: Organisms/strains Mouse: C57Bl/6 Charles River Laboratories N/A Mouse: Sox2:CreERT2 S. Nicolis (U. Milano-Biccoca); (Favaro et al., 2009) http://www.informatics.jax.org/ allele/MGI:4397776 Mouse: Sox2-EGFP F. Gage (Salk Institute); (Suh et al.,2007) N/A Mouse: Sox5flox/flox V. Lefebvre (Philadelphia); (Dy et al., 2008) http://www.informatics.jax.org/ allele/MGI:3799354 Mouse: Sox6 flox/flox V. Lefebvre (Philadelphia); (Dumitriu et al., 2006) http://www.informatics.jax.org/ allele/MGI:3641205 Mouse: Rosa26lox-stop-lox-YFP The Jackson Laboratory https://www.jax.org/strain/006148 Oligonucleotides Ascl1 Probe Applied Biosystems Mm03058063_m1 Bmpr1a Probe Applied Biosystems Mm00477650_m1 Bmpr1b Probe Applied Biosystems Mm03023971_m1 Gapdh Probe Applied Biosystems Mm99999915_g1 Id2 Probe Applied Biosystems Mm00711781_m1 Id4 Probe Applied Biosystems Mm00499701_m1 Pgk1 Probe Applied Biosystems Mm00435617_m1 Sox5 Probe Applied Biosystems Mm01264584_m1 Sox6 Probe Applied Biosystems Mm00488393_m1 Primer sequences: Ascl1 Fw: CGCTCCTGTCGCTGAGGTGTTTC Sigma Forward Primer Primer sequences: Ascl1 Rv: GCTTCCCCCTCACAATCACAGG Sigma Reverse Primer Recombinant DNA Plasmid pCIG-Sox5 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox6 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox2 J. Muhr (Karolinska); (Kurtsdotter et al., 2017) N/A Plasmid pRP-Enh-Ascl1-Luciferase Vector Builder Company ID: VB210601-1396nca (Continued on next page) e2 Cell Reports 38, 110313, February 1, 2022

Techniques: Activation Assay, Injection, Control, Quantitation Assay, Two Tailed Test

Journal: Cell reports

Article Title: SoxD genes are required for adult neural stem cell activation.

doi: 10.1016/j.celrep.2022.110313

Figure Lengend Snippet: Figure 3. Loss of Sox5 favors quiescent state in RGLs and BMP4 inhibit Sox5 expression (A) Confocal images showing immunostaining for YFP, BrdU, and GFAP of control and Sox5icKO

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HBSS Fisher Scientific Cat#24020117 Papain Worthington Cat#33H14332L Cysteine Sigma Aldrich Cat#C7352 Poly-L-ornithin Sigma Aldrich Cat#P3655 Fibronectin Invitrogen Cat#33010-018 Insulin Sigma Aldrich Cat#16634 Corn Oil Sigma Aldrich Cat#C8267 Critical commercial assays Effectene Transfection Reagent Quiagen Cat#301425 P3 Primary Cell 4D-NucleofectorTM X Kit Lonza Cat#V4XP-3012 Dual Luciferase Reporter Assay System Promega Cat#E1910 QuickGene RNA tissue Kit S Kurabo Cat#RT-S2 SuperScriptTM IV First-Stand Synthesis System Invitrogen Cat#18091050 TaqMan Fast Advanced Master Mix Applied Biosystems Cat#A44360 Experimental models: Organisms/strains Mouse: C57Bl/6 Charles River Laboratories N/A Mouse: Sox2:CreERT2 S. Nicolis (U. Milano-Biccoca); (Favaro et al., 2009) http://www.informatics.jax.org/ allele/MGI:4397776 Mouse: Sox2-EGFP F. Gage (Salk Institute); (Suh et al.,2007) N/A Mouse: Sox5flox/flox V. Lefebvre (Philadelphia); (Dy et al., 2008) http://www.informatics.jax.org/ allele/MGI:3799354 Mouse: Sox6 flox/flox V. Lefebvre (Philadelphia); (Dumitriu et al., 2006) http://www.informatics.jax.org/ allele/MGI:3641205 Mouse: Rosa26lox-stop-lox-YFP The Jackson Laboratory https://www.jax.org/strain/006148 Oligonucleotides Ascl1 Probe Applied Biosystems Mm03058063_m1 Bmpr1a Probe Applied Biosystems Mm00477650_m1 Bmpr1b Probe Applied Biosystems Mm03023971_m1 Gapdh Probe Applied Biosystems Mm99999915_g1 Id2 Probe Applied Biosystems Mm00711781_m1 Id4 Probe Applied Biosystems Mm00499701_m1 Pgk1 Probe Applied Biosystems Mm00435617_m1 Sox5 Probe Applied Biosystems Mm01264584_m1 Sox6 Probe Applied Biosystems Mm00488393_m1 Primer sequences: Ascl1 Fw: CGCTCCTGTCGCTGAGGTGTTTC Sigma Forward Primer Primer sequences: Ascl1 Rv: GCTTCCCCCTCACAATCACAGG Sigma Reverse Primer Recombinant DNA Plasmid pCIG-Sox5 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox6 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox2 J. Muhr (Karolinska); (Kurtsdotter et al., 2017) N/A Plasmid pRP-Enh-Ascl1-Luciferase Vector Builder Company ID: VB210601-1396nca (Continued on next page) e2 Cell Reports 38, 110313, February 1, 2022

Techniques: Expressing, Immunostaining, Control

Journal: Cell reports

Article Title: SoxD genes are required for adult neural stem cell activation.

doi: 10.1016/j.celrep.2022.110313

Figure Lengend Snippet: Figure 4. Sox5 and Sox6 are required for the generation of newborn neurons and are not essential for astrogliogenesis (A) Confocal images showing YFP, Dcx, and Tbr2 in the SGZ at 30 dpi in 3-month-old control, Sox5icKO, and Sox6icKO mice. White arrows indi- cate Dcx+ YFP+ cells. (B) Quantitation of Dcx+ cells number among YFP+

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HBSS Fisher Scientific Cat#24020117 Papain Worthington Cat#33H14332L Cysteine Sigma Aldrich Cat#C7352 Poly-L-ornithin Sigma Aldrich Cat#P3655 Fibronectin Invitrogen Cat#33010-018 Insulin Sigma Aldrich Cat#16634 Corn Oil Sigma Aldrich Cat#C8267 Critical commercial assays Effectene Transfection Reagent Quiagen Cat#301425 P3 Primary Cell 4D-NucleofectorTM X Kit Lonza Cat#V4XP-3012 Dual Luciferase Reporter Assay System Promega Cat#E1910 QuickGene RNA tissue Kit S Kurabo Cat#RT-S2 SuperScriptTM IV First-Stand Synthesis System Invitrogen Cat#18091050 TaqMan Fast Advanced Master Mix Applied Biosystems Cat#A44360 Experimental models: Organisms/strains Mouse: C57Bl/6 Charles River Laboratories N/A Mouse: Sox2:CreERT2 S. Nicolis (U. Milano-Biccoca); (Favaro et al., 2009) http://www.informatics.jax.org/ allele/MGI:4397776 Mouse: Sox2-EGFP F. Gage (Salk Institute); (Suh et al.,2007) N/A Mouse: Sox5flox/flox V. Lefebvre (Philadelphia); (Dy et al., 2008) http://www.informatics.jax.org/ allele/MGI:3799354 Mouse: Sox6 flox/flox V. Lefebvre (Philadelphia); (Dumitriu et al., 2006) http://www.informatics.jax.org/ allele/MGI:3641205 Mouse: Rosa26lox-stop-lox-YFP The Jackson Laboratory https://www.jax.org/strain/006148 Oligonucleotides Ascl1 Probe Applied Biosystems Mm03058063_m1 Bmpr1a Probe Applied Biosystems Mm00477650_m1 Bmpr1b Probe Applied Biosystems Mm03023971_m1 Gapdh Probe Applied Biosystems Mm99999915_g1 Id2 Probe Applied Biosystems Mm00711781_m1 Id4 Probe Applied Biosystems Mm00499701_m1 Pgk1 Probe Applied Biosystems Mm00435617_m1 Sox5 Probe Applied Biosystems Mm01264584_m1 Sox6 Probe Applied Biosystems Mm00488393_m1 Primer sequences: Ascl1 Fw: CGCTCCTGTCGCTGAGGTGTTTC Sigma Forward Primer Primer sequences: Ascl1 Rv: GCTTCCCCCTCACAATCACAGG Sigma Reverse Primer Recombinant DNA Plasmid pCIG-Sox5 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox6 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox2 J. Muhr (Karolinska); (Kurtsdotter et al., 2017) N/A Plasmid pRP-Enh-Ascl1-Luciferase Vector Builder Company ID: VB210601-1396nca (Continued on next page) e2 Cell Reports 38, 110313, February 1, 2022

Techniques: Control, Quantitation Assay

Journal: Cell reports

Article Title: SoxD genes are required for adult neural stem cell activation.

doi: 10.1016/j.celrep.2022.110313

Figure Lengend Snippet: Figure 6. Sox5 loss hinders RGL activation in response to environmental enrichment (A) Confocal images showing YFP, MCM2, and GFAP at 14 dpi in control and in Sox5icKO mice exposed to conventional (basic) or enriched (EE) environmental conditions. White arrows indicate YFP+ rGFAP+ MCM2 cells and yellow arrows YFP+ rGFAP+ MCM2+ cells. (B) Experimental design for control and Sox5icKO mice in which TAM i.p. injection was performed at P60 on 5 consecutive days, and after 7 days animals were exposed to an enriched environment for 8 days, changing objects every other day. (C) Quantitation of the number of radial GFAP in YFP+ cells in control and Sox5icKO mice. (D) Quantitation of the number of rGFAP+ MCM2+ in rGFAP+ YFP+ cells. Results are shown as mean value ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001 by unpaired Student’s t test. Scale bar, 25 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HBSS Fisher Scientific Cat#24020117 Papain Worthington Cat#33H14332L Cysteine Sigma Aldrich Cat#C7352 Poly-L-ornithin Sigma Aldrich Cat#P3655 Fibronectin Invitrogen Cat#33010-018 Insulin Sigma Aldrich Cat#16634 Corn Oil Sigma Aldrich Cat#C8267 Critical commercial assays Effectene Transfection Reagent Quiagen Cat#301425 P3 Primary Cell 4D-NucleofectorTM X Kit Lonza Cat#V4XP-3012 Dual Luciferase Reporter Assay System Promega Cat#E1910 QuickGene RNA tissue Kit S Kurabo Cat#RT-S2 SuperScriptTM IV First-Stand Synthesis System Invitrogen Cat#18091050 TaqMan Fast Advanced Master Mix Applied Biosystems Cat#A44360 Experimental models: Organisms/strains Mouse: C57Bl/6 Charles River Laboratories N/A Mouse: Sox2:CreERT2 S. Nicolis (U. Milano-Biccoca); (Favaro et al., 2009) http://www.informatics.jax.org/ allele/MGI:4397776 Mouse: Sox2-EGFP F. Gage (Salk Institute); (Suh et al.,2007) N/A Mouse: Sox5flox/flox V. Lefebvre (Philadelphia); (Dy et al., 2008) http://www.informatics.jax.org/ allele/MGI:3799354 Mouse: Sox6 flox/flox V. Lefebvre (Philadelphia); (Dumitriu et al., 2006) http://www.informatics.jax.org/ allele/MGI:3641205 Mouse: Rosa26lox-stop-lox-YFP The Jackson Laboratory https://www.jax.org/strain/006148 Oligonucleotides Ascl1 Probe Applied Biosystems Mm03058063_m1 Bmpr1a Probe Applied Biosystems Mm00477650_m1 Bmpr1b Probe Applied Biosystems Mm03023971_m1 Gapdh Probe Applied Biosystems Mm99999915_g1 Id2 Probe Applied Biosystems Mm00711781_m1 Id4 Probe Applied Biosystems Mm00499701_m1 Pgk1 Probe Applied Biosystems Mm00435617_m1 Sox5 Probe Applied Biosystems Mm01264584_m1 Sox6 Probe Applied Biosystems Mm00488393_m1 Primer sequences: Ascl1 Fw: CGCTCCTGTCGCTGAGGTGTTTC Sigma Forward Primer Primer sequences: Ascl1 Rv: GCTTCCCCCTCACAATCACAGG Sigma Reverse Primer Recombinant DNA Plasmid pCIG-Sox5 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox6 AV Morales (I. Cajal); (Quiroga et al., 2015) N/A Plasmid pCIG-Sox2 J. Muhr (Karolinska); (Kurtsdotter et al., 2017) N/A Plasmid pRP-Enh-Ascl1-Luciferase Vector Builder Company ID: VB210601-1396nca (Continued on next page) e2 Cell Reports 38, 110313, February 1, 2022

Techniques: Activation Assay, Control, Injection, Quantitation Assay