|
DeGussa Corporation
aerosil mox80 (bet surface area 80±20 g/m2, average primary particle size 30 nm, sio2 content >98.3%, al2o3 content 0.3-1.3%) Aerosil Mox80 (Bet Surface Area 80±20 G/M2, Average Primary Particle Size 30 Nm, Sio2 Content >98.3%, Al2o3 Content 0.3 1.3%), supplied by DeGussa Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/al2o3/us11548305-324-41-67 Average 90 stars, based on 1 article reviews
aerosil mox80 (bet surface area 80±20 g/m2, average primary particle size 30 nm, sio2 content >98.3%, al2o3 content 0.3-1.3%) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Revvity
il 6 activity Il 6 Activity, supplied by Revvity, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/IL-6/pmc03360474-69-23-14 Average 98 stars, based on 1 article reviews
il 6 activity - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
ATCC
gtgaaaccccgtctctactaaaaatacaaaaa Gtgaaaccccgtctctactaaaaatacaaaaa, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Fusarium+oxysporum+f%2E+sp%2E+betae+(Stewart)+Snyder+et+Hansen/solari_soren__2009__a_unified_anatomical_theory_and_computational_model_of_cognitive_information_processing_in_the_mammalian-86-111-82 Average 90 stars, based on 1 article reviews
gtgaaaccccgtctctactaaaaatacaaaaa - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ppp1r1b hs00938414 m1 Gene Exp Ppp1r1b Hs00938414 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Gene+Exp%2E+PPP1R1B%2C+Hs00938414_m1/pmc01784004-379-33--1 Average 85 stars, based on 1 article reviews
gene exp ppp1r1b hs00938414 m1 - by Bioz Stars,
2026-09
85/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ppp1r1b hs00938410 m1 Gene Exp Ppp1r1b Hs00938410 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Gene+Exp%2E+PPP1R1B%2C+Hs00938410_m1/10__1172_slash_jci30413-272-26--1 Average 85 stars, based on 1 article reviews
gene exp ppp1r1b hs00938410 m1 - by Bioz Stars,
2026-09
85/100 stars
|
Buy from Supplier |
|
R&D Systems
il 32b ![]() Il 32b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Recombinant+Human+IL-32+beta+Protein%2C+CF/pm35143819-110-37-42 Average 94 stars, based on 1 article reviews
il 32b - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
taaatggacgccacgatcac 18s eukaryote x03205 1 applied biosystems gene expression assay endogenous control vic label trypsin digest ![]() Taaatggacgccacgatcac 18s Eukaryote X03205 1 Applied Biosystems Gene Expression Assay Endogenous Control Vic Label Trypsin Digest, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Trypsin/us10695353-359-27-31 Average 99 stars, based on 1 article reviews
taaatggacgccacgatcac 18s eukaryote x03205 1 applied biosystems gene expression assay endogenous control vic label trypsin digest - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Chem Impex International
linker 4 formylphenyl sulfonyl l isoleucine ![]() Linker 4 Formylphenyl Sulfonyl L Isoleucine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/L-Isoleucine/pm30347157-141-21-39 Average 95 stars, based on 1 article reviews
linker 4 formylphenyl sulfonyl l isoleucine - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Becton Dickinson
32 p-labeled actin cdna ![]() 32 P Labeled Actin Cdna, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/32+p+labeled+actin+cdna/pmc01854954-171-12-14 Average 90 stars, based on 1 article reviews
32 p-labeled actin cdna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
DeGussa Corporation
aerosil ® r972 ![]() Aerosil ® R972, supplied by DeGussa Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/aerosil+r972/us07034072-135-40-59 Average 90 stars, based on 1 article reviews
aerosil ® r972 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
sabouraud dextrose agar ![]() Sabouraud Dextrose Agar, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/sabouraud+dextrose+agar/pm16446374-47-11-14 Average 90 stars, based on 1 article reviews
sabouraud dextrose agar - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Chem Impex International
auranofin ![]() Auranofin, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+3%2E2+beta+version/Auranofin/pmc07073294-123-0-2 Average 95 stars, based on 1 article reviews
auranofin - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of investigative dermatology
Article Title: IL-32 Supports the Survival of Malignant T Cells in Cutaneous T-cell Lymphoma.
doi: 10.1016/j.jid.2022.01.009
Figure Lengend Snippet: Figure 2. IL-32 induces CD14D APC that support malignant T-cell survival. (a) Survival of purified T cells versus PBMC from a patient with stage IV CTCL after culture with IL-32 and submitogenic IL-2. (b) IL-32b supported the survival of malignant and benign T cells and CD14þ myeloid cells. Five additional donors showed similar results. (c, d) HTS confirmed the persistence of malignant T cell TCRs in culture. (e) IL-32b enhanced the survival of benign and malignant T cells. (f, g) IL-32b induced the formation of large, activated CD14þ T cells. Similar results were observed in five additional donors. (h) The number of surviving malignant T cells was directly proportional to the number of IL-32beinduced large CD14þ cells. (i) IL-32b enhanced malignant T-cell survival by reducing apoptosis (detected by SYTOX Green). APC, antigen-presenting cell; cyt, cytokine; HTS, high throughput TCR sequencing.
Article Snippet: A total of 300,000e1,000,000 cells in 200 ml per well were cultured in round-bottom 96-well plates in the presence or absence of IL-2 (25 IU/ml, National Cancer Institute, Bethesda, MD), IL-32a (25 ng/ml; number 3040-IL-050, R&D Systems),
Techniques: High Throughput Screening Assay, Sequencing
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: Minimum inhibitory concentration (MIC, µg/mL) of auranofin and linezolid against clinical isolates of vancomycin-resistant E. faecium and E. faecalis at standard and high inocula.
Article Snippet:
Techniques: Concentration Assay
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: Time-kill kinetics assay of auranofin and linezolid against stationary phase vancomycin-resistant Enterococcus faecium NR-31909. Bacteria were incubated with test agents, and samples were collected at 0,12- and 24-h incubation period. The error bars represent standard deviation values obtained from triplicate samples used for each agent studied. (*) represents significant difference from 0 time. # represents significant difference from linezolid (*, # P < 0.05). Data were analyzed with two way ANOVA with post hoc Dunnet’s test.
Article Snippet:
Techniques: Incubation, Standard Deviation
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: Total protease inhibition activity of auranofin and linezolid against vancomycin-resistant E. faecium NR-31909. Data are presented as percent protease production of each drug (tested in sexruplicate). TSB with skim milk served as a negative control. Data were analyzed via unpaired Student t test (p<0.05). Auranofin was compared to untreated (*) and to linezolid (#).
Article Snippet:
Techniques: Inhibition, Activity Assay, Negative Control
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: Lipase inhibition activity of auranofin and linezolid against vancomycin-resistant E. faecium NR-31909. Data are presented as percent lipase production in presence of each drug (tested in sexruplicate). TSB with egg yolk emulsion served as a negative control. Data were analyzed via unpaired Student t test (p<0.05). Auranofin was compared to untreated (*) and to linezolid (#).
Article Snippet:
Techniques: Inhibition, Activity Assay, Negative Control
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: Hemagglutination inhibitory activities of auranofin and linezolid against E. faecalis NR-31909. Sub-inhibitory concentrations (starting from 0.5 µg/mL to 0.015 µg/mL) of the drugs were added with bacterial supernatant and RBCs, and then incubated for 1 hour at 37 °C. Positive hemagglutination inhibition results appear as dots in the center of round-bottomed plates. Negative hemagglutination inhibition results appear as a uniform reddish color across the well.
Article Snippet:
Techniques: Incubation, HI Assay
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: In vivo antibacterial activity of auranofin against E. faecium NR-31909 in the murine septicemia model when administered (A) Orally at 0.125 mg/kg, 0.25 mg/kg and 0.5 mg/kg; and (B) Subcutaneously (S.C.) at 0.0625 mg/kg, 0.125 mg/kg and 0.25 mg/kg compared to the vehicle control and the standard antibiotic linezolid given orally at 20 mg/kg. Mice survival was monitored for 5 days. Results were analyzed for statistical difference utilizing graphpad prism. (*) Denotes significant difference between each treated group and the untreated group (P < 0.05).
Article Snippet:
Techniques: In Vivo, Activity Assay
Journal: International journal of antimicrobial agents
Article Title: Antivirulence activity of auranofin against vancomycin-resistant enterococci: in vitro and in vivo studies
doi: 10.1016/j.ijantimicag.2019.10.009
Figure Lengend Snippet: VRE counts in (A) liver, (B) kidney, and (C) spleen of the infected mice (5/group) orally treated with auranofin, and (D) liver, (E) kidney, and (F) spleen of the infected mice (5/group) treated S.C. after 4 days. Auranofin was compared to untreated (*) and to linezolid (#). (P < 0.05).
Article Snippet:
Techniques: Infection