Journal: Journal of Cell Science

Article Title: Constitutive IP 3 R1-mediated Ca 2+ release reduces Ca 2+ store content and stimulates mitochondrial metabolism in mouse GV oocytes

doi: 10.1242/jcs.225441

Figure Lengend Snippet: IP3R1 channels are responsible for the low [Ca2+]ER content of GV oocytes. (A) Representative Ca2+ responses induced by the potent agonist of IP3R channels, adenophostin A (AdA), in GV oocytes is shown. Loss of IP3R1 expression was confirmed by western blot analysis using antibodies specific to IP3R1 and α-tubulin 6 h after injection of 10 μM AdA. Oocytes undergoing microinjection of AdA (GV-AdA) or buffer (GV) were cultured in the presence of IBMX to maintain the arrest at the GV stage. (B) Representative traces of Ca2+ responses induced by La3+ (La) Ca2+ insulation in AdA-injecting GV oocytes. Ca2+ measurements were performed in Ca2+-free medium containing 1 mM LaCl3. The number of oocytes responding to lanthanide is shown. (C) Representative traces of Ca2+ responses in GV oocytes (black trace) and AdA-injected GV oocytes (red trace) are shown. Ca2+ measurement were performed under normal external Ca2+ concentration (1.7 mM). The percentages of oocytes showing spontaneous Ca2+ oscillations (oocytes showing more than 3 repetitive Ca2+ rises) were compared. Numbers of oocytes showing oscillations/total number of oocytes are indicated. (D) ER Ca2+ store content in in GV oocytes (black trace; n=20), AdA-injecting GV oocytes (red trace; n=14) and MII oocytes (blue trace; n=10), which was estimated by the mean fluorescent (Fura-2) peak after addition of 1 μM ionomycin. Amplitudes of the Ca2+ peak were compared. Error bars represent s.d., and bars with different superscripts are significantly different from each other (P<0.05).

Article Snippet: The SNAP25 mutant (SNAP25 Δ20 ) sequence was amplified by PCR from the mouse SNAP25 expression vector (Origene) and subcloned into a pcDNA6/Myc-His B vector between the EcoRI and XhoI restriction sites.

Techniques: Expressing, Western Blot, Injection, Microinjection, Cell Culture, Insulation, Concentration Assay

Journal: Journal of Cell Science

Article Title: Constitutive IP 3 R1-mediated Ca 2+ release reduces Ca 2+ store content and stimulates mitochondrial metabolism in mouse GV oocytes

doi: 10.1242/jcs.225441

Figure Lengend Snippet: Progression of oocyte maturation causes reduced presence of ORAI1 at the plasma membrane. (A) The subcellular distribution of ORAI1 was analyzed using an mRFP-tagged (top panel) version of the protein. The observations were performed at 0, 2, 4, 8 and 12 h after initiation of in vitro maturation, which corresponded with GV, early GVBD, late GVBD, MI and MII stages, respectively. Square area on the top panels indicate areas magnified to observe ORAI1 plasma membrane presence at the different stages of maturation. Higher magnification views of the selected area (inset panels) are shown to the left of each image where differences in ORAI1 distribution between different maturation stages can be observed. Corresponding DIC images are shown in the bottom panel. Scale bar: 20 µm. (B) Intensity profiles of the line scans drawn in oocytes in A (white lines in insets), representing the distribution of ORAI1–RFP fluorescence from the cytoplasm (Cyto) and across the plasma membrane (PM) at different stages of maturation. (C) Mean±s.d. relative intensity of ORAI1 signal between plasma membrane and cytoplasm is shown.

Article Snippet: The SNAP25 mutant (SNAP25 Δ20 ) sequence was amplified by PCR from the mouse SNAP25 expression vector (Origene) and subcloned into a pcDNA6/Myc-His B vector between the EcoRI and XhoI restriction sites.

Techniques: Clinical Proteomics, Membrane, In Vitro, Fluorescence

Journal: Journal of Cell Science

Article Title: Constitutive IP 3 R1-mediated Ca 2+ release reduces Ca 2+ store content and stimulates mitochondrial metabolism in mouse GV oocytes

doi: 10.1242/jcs.225441

Figure Lengend Snippet: Mitochondrial Ca2+ uptake of IP3R1-mediated Ca2+ release stimulates mitochondrial metabolism in GV oocytes. (A) Confocal images of radiometric pericam-mito fluorescence at 480 nm (F480, green) in GV oocytes, to detect mitochondrial Ca2+. To visualize colocalization with mitochondria, oocytes were stained with MitoTracker (red). Brightfield, BF. Scale bar: 20 µm. (B) The fluorescence intensities of pericam-mito in GV oocytes shifted in opposite directions between the excitation at 405 nm (left axis) and 480 nm (right axis) coinciding with Ca2+ oscillations. (C) Emission ratios (F480:F405) of pericam-mito, which allows estimation of the relative changes in mitochondrial Ca2+ ([Ca2+]mt), were analyzed in GV (black trace; n=9/12) and MII oocytes (red trace; n=0/10) under normal external Ca2+ concentrations (1.7 mM). (D,E) Changes in NADH (left axis) and FAD (right axis) autofluorecence in GV (D; n=8/10) and MII oocytes (E; n=0/9) are reported. The intensities of NADH (360 nm wavelengths) and FAD (480 nm wavelengths) autofluorescence shifted in opposite directions in GV oocytes but not in MII oocytes, reflecting the stimulation of mitochondrial metabolism by the Ca2+ oscillations. (F) Representative traces of [Ca2+]mt in GV oocytes (black trace; n=8/9) and adenophostin A (AdA)-injected GV oocytes (red trace; n=0/9) with reduced IP3R1 expression (Fig. 2) are shown. [Ca2+]mt measurements were performed under normal external Ca2+ concentrations, 1.7 mM, and 6 h after injection of AdA. (G) Comparison of ATP levels between GV oocytes and AdA-injected GV oocytes. The levels of ATP were estimated using the emission ratio of AT1.03 (YFP:CFP). Error bars represent s.d. Oocytes were injected at the GV stage and remained at this stage in media supplemented with IBMX.

Article Snippet: The SNAP25 mutant (SNAP25 Δ20 ) sequence was amplified by PCR from the mouse SNAP25 expression vector (Origene) and subcloned into a pcDNA6/Myc-His B vector between the EcoRI and XhoI restriction sites.

Techniques: Fluorescence, Staining, Injection, Expressing, Comparison

Journal: Journal of Neuroscience

Article Title: The SNARE Proteins SNAP25 and Synaptobrevin Are Involved in Endocytosis at Hippocampal Synapses

doi: 10.1523/jneurosci.0301-13.2013

Figure Lengend Snippet: Figure 1. SNAP25 knockdown inhibits endocytosis. A, Western blot of SNAP25, clathrin, dynamin,AP2,endophilin,andactinfromPC12cellsincontrol(left)andincellstransfectedwith SNAP25 shRNA (KD, right). B, Immunostaining of SypH2X (antibody against GFP, left, green) and SNAP25 (middle, red) at neuronal branches with (arrow, green staining) or without (no greenstaining)transfectionofSypH2XandSNAP25shRNA(right:leftandmiddlepanelssuper- imposed).C,TheSypH2XsignalinducedbyTrain10satcontrolboutonstransfectedwithSypH2X (black, n 6 experiments) or with SypH2X and scrambled shRNA (gray, n 4). Data are expressed as the percentage change over the baseline intensity, and plotted as mean SEM (every 10 s, applies to all similar plots). D, The SypH2X signal induced by Train10s at boutons transfected with SypH2X and SNAP25 shRNA (n 12 experiments, SNAP25 KD). E, Traces in C (blackonly)andD(red)arenormalizedtothepeakamplitudeandsuperimposed.F,TheSypH2X signal induced by Train1.5s at control boutons transfected with only SypH2X (black, n 7 experiments)orwithSypH2XandscrambledshRNA(gray,n7).G,TracesinF(blackonly)and D (red) are normalized to the same amplitude and superimposed.

Article Snippet: The sequence of the shRNA against rat SNAP25 in the pRFP-C-RS plasmid (Origene Technologies, Cat. #: TF711123) was AAGATGCTGGCATCAGGACTTTG GTTATG.

Techniques: Knockdown, Western Blot, shRNA, Immunostaining, Staining, Transfection, Control

Journal: Journal of Neuroscience

Article Title: The SNARE Proteins SNAP25 and Synaptobrevin Are Involved in Endocytosis at Hippocampal Synapses

doi: 10.1523/jneurosci.0301-13.2013

Figure Lengend Snippet: Figure2. SNAP25knockdownisspecific.A,WesternblotofSNAP25andactinfromPC12cellsincontrolandincellstransfectedwithSNAP25shRNAandshRNA-resistantSNAP25(SNAP25rescue). B,ImmunostainingofSypH2X(antibodyagainstGFP,left,green)andSNAP25(middle,red)atneuronalbrancheswith(arrow,green)orwithout(nogreenstaining)triple-transfectionofSypH2X, SNAP25 shRNA, and shNRA-resistant SNAP25 (SNAP25 rescue). Right, Left and middle panels superimposed. C, The SypH2X signal induced by Train10s at boutons transfected with only SypH2X (black, control, n 6 experiments) or with SypH2X, SNAP25 shRNA, and shNRA-resistant SNAP25 (SNAP25 rescue, red, n 8 experiments). D, Samples of (Figure legend continues.)

Article Snippet: The sequence of the shRNA against rat SNAP25 in the pRFP-C-RS plasmid (Origene Technologies, Cat. #: TF711123) was AAGATGCTGGCATCAGGACTTTG GTTATG.

Techniques: shRNA, Transfection, Control

Journal: Journal of Neuroscience

Article Title: The SNARE Proteins SNAP25 and Synaptobrevin Are Involved in Endocytosis at Hippocampal Synapses

doi: 10.1523/jneurosci.0301-13.2013

Figure Lengend Snippet: Figure 3. Synaptobrevin knockdown inhibits endocytosis. The arrangements in A–G are the same as those in Figure 1A–G, respectively, except that SNAP25 in all legends and panels is replaced with synaptobrevin (or Syb). C, The trace is the same as the blacktraceinFigure1C.D,n10experimentsfromboutonstransfectedwithSypH2XandSybshRNA(SybKD).F,Thetraceisthe same as the black trace in Figure 1F.

Article Snippet: The sequence of the shRNA against rat SNAP25 in the pRFP-C-RS plasmid (Origene Technologies, Cat. #: TF711123) was AAGATGCTGGCATCAGGACTTTG GTTATG.

Techniques: Knockdown