single-stranded dna probes Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher single stranded dna probe
    Single Stranded Dna Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded dna probe/product/Thermo Fisher
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    single stranded dna probe - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore biotinylated single stranded dna probes
    Biotinylated Single Stranded Dna Probes, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated single stranded dna probes/product/Millipore
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    biotinylated single stranded dna probes - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    88
    Stratagene single stranded dna probes
    Single Stranded Dna Probes, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded dna probes/product/Stratagene
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    single stranded dna probes - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    85
    DuPont de Nemours nen dupont single stranded dna probe
    Nen Dupont Single Stranded Dna Probe, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nen dupont single stranded dna probe/product/DuPont de Nemours
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    nen dupont single stranded dna probe - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    88
    CEM Corporation single stranded dna probes
    Single Stranded Dna Probes, supplied by CEM Corporation, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded dna probes/product/CEM Corporation
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    single stranded dna probes - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    85
    Sangon Biotech fluorescence labeled single stranded dna probe
    Fluorescence Labeled Single Stranded Dna Probe, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescence labeled single stranded dna probe/product/Sangon Biotech
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    fluorescence labeled single stranded dna probe - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    85
    Boehringer Mannheim single stranded digoxigenin dig labeled dna probes
    Single Stranded Digoxigenin Dig Labeled Dna Probes, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded digoxigenin dig labeled dna probes/product/Boehringer Mannheim
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    single stranded digoxigenin dig labeled dna probes - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    86
    Sangon Biotech single stranded deoxyribonucleic acid dna probe 5 sh ch2 6 gattgaaaggtctgtttttggggttggtttgggtcaata
    Single Stranded Deoxyribonucleic Acid Dna Probe 5 Sh Ch2 6 Gattgaaaggtctgtttttggggttggtttgggtcaata, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded deoxyribonucleic acid dna probe 5 sh ch2 6 gattgaaaggtctgtttttggggttggtttgggtcaata/product/Sangon Biotech
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    single stranded deoxyribonucleic acid dna probe 5 sh ch2 6 gattgaaaggtctgtttttggggttggtttgggtcaata - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    85
    Microsynth single stranded antisera dna oligomer probes
    Single Stranded Antisera Dna Oligomer Probes, supplied by Microsynth, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded antisera dna oligomer probes/product/Microsynth
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    single stranded antisera dna oligomer probes - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    98
    Millipore single stranded probe dna
    Single Stranded Probe Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded probe dna/product/Millipore
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    single stranded probe dna - by Bioz Stars, 2020-09
    98/100 stars
      Buy from Supplier

    95
    GE Healthcare strand specific single stranded dna probes
    Strand Specific Single Stranded Dna Probes, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strand specific single stranded dna probes/product/GE Healthcare
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    strand specific single stranded dna probes - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    Image Search Results