shp53plko Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore shp53
    p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS <t>shp53</t> cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.
    Shp53, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shp53/product/Millipore
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    shp53 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    88
    Addgene inc shp53 plko
    p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS <t>shp53</t> cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.
    Shp53 Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shp53 plko/product/Addgene inc
    Average 88 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    shp53 plko - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    90
    Addgene inc plasmid shp53 plko
    p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS <t>shp53</t> cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.
    Plasmid Shp53 Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid shp53 plko/product/Addgene inc
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    plasmid shp53 plko - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    93
    Addgene inc lentivirus shp53
    p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS <t>shp53</t> cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.
    Lentivirus Shp53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus shp53/product/Addgene inc
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    lentivirus shp53 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Addgene inc p53 short hairpin rna
    Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin <t>RNA</t> of <t>p53</t> under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.
    P53 Short Hairpin Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p53 short hairpin rna/product/Addgene inc
    Average 93 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    p53 short hairpin rna - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Addgene inc p53 shrna plasmid
    Effect of <t>shRNA-mediated</t> silencing of <t>p53</t> on the sensitivity of Cal-51 cells to the anti-proliferative effects of PARP inhibitors, a Verification by western blotting of shRNA-mediated knockdown of p53 expression in the stably transfected Cal-51 subclone.
    P53 Shrna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p53 shrna plasmid/product/Addgene inc
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    p53 shrna plasmid - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    90
    Addgene inc p53 shrna encoding lentiviral vectors
    Allele-specific silencing of mutp53 increases doxorubicin sensitivity by restoration of wtp53 activity A. MTT assays. HCT116 wt/R248W cells transfected with control , <t>p53</t> , or 248 siRNAs were treated with water (control) or varying concentrations of doxorubicin for 48h, followed by MTT assays. B. PI staining and flow cytometry, using cells transfected with control or 248 <t>siRNA</t> and treated with water (control) or 1.25 μM of doxorubicin (DXR) for 24h. Representative results of flow cytometry (left) and summarized graphs showing sub-G0/G1 apoptotic fraction (right). C. QRT-PCR for p53 target genes, p21, BAX , and PUMA , using HCT116 wt/R248W cells transfected with control (C) , 248, or p53 (P) siRNAs with treatment of water or DXR for 24h. Data are presented as relative values to the water-treated, control siRNA-transfected group normalized by the value to GAPDH . D. Western blotting for p21, BAX, and Vinculin following treatment of control ( C ) or 248 siRNA-transfected HCT116 wt/R248W cells with water or DXR treatment for 24h. Short: short exposure, Long: long exposure. Error bars: means ± S.D. from three independent experiments. *, P
    P53 Shrna Encoding Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p53 shrna encoding lentiviral vectors/product/Addgene inc
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    p53 shrna encoding lentiviral vectors - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Image Search Results


    p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS shp53 cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.

    Journal: Oncotarget

    Article Title: Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    doi:

    Figure Lengend Snippet: p53 deficiency increases secretory the function of the ER through the IRE1α/XBP1 pathway A. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS shp53 cells expressing secreted embryonic alkaline phosphatase (SEAP) were transduced with a pSEAP2 control vector and washed 24 h after transduction. The medium was then changed, and the cells were cultured for another 6 h. Culture media were analyzed for SEAP activity, and luminescence was normalized to cell number. The transfection efficiencies of HCT116 p53 +/+ and HCT116 p53 −/− cells were approximately 80% each (data not shown). B. Overexpression of wild-type p53 inhibited SEAP activity. SEAP activities of cells that constitutively expressed the indicated p53 molecules were analyzed using the same procedure described in (A). C. HCT116 p53 −/− cells that expressed SEAP were transfected with siControl, siATF6, siPERK, or siIRE1α, cultured for 24 h, and following a change of medium, the cells were cultured for another 6 h. Whole cell lysates were analyzed using western blotting with the indicated antibodies, and culture supernatants were analyzed for SEAP activity. Values shown are the mean ± s.d. of three different experiments simultaneously measured. The P value was calculated using two-way ANOVA.

    Article Snippet: Wild-type p53, p53-G245S, p53-R248W, p53-R249S, p53-R273H, shp53 (pLKO.1 p53 shRNA-753 and -814 from Sigma-Aldrich (TRCN0000003753)), and shLuc (pLKO.1 Luciferase shRNA Control, Sigma-Aldrich) constructs were introduced into HCT116 p53 +/+ , U2OS, or H1299 cells using lipofection.

    Techniques: Expressing, Transduction, Plasmid Preparation, Cell Culture, Activity Assay, Transfection, Over Expression, Western Blot

    IRE1α expression is regulated by p53 A. Western blot analysis of the expression of endogenous IRE1α in 23 human cancer cell lines. Cell lines were grouped according to expression of wild-type or mutant p53 as indicated. (A well between wt-p53 and mutant-p53 cell lines was cut, from the gel as indicated by a black line, due to the controversial p53 status of the cell line). Right panel: The intensities of the IRE1α bands (left panel) are expressed relative to those of β-actin. Values shown are the mean ± standard deviation (s.d.). The P value was calculated using two-way ANOVA. B. Downregulation of p53 expression induces increased expression of IRE1α. HCT116 p53 +/+ and U2OS cells were transfected with shLuc, shp53 (753), or shp53 (814), and selected using puromycin. Whole cell lysates of a pool of transfectants were analyzed using western blotting with the indicated antibodies. C. Overexpression of wild-type p53 inhibits IRE1α expression in mutant-p53 cell lines. Cell lysates, prepared 48 h after transfection with wild-type p53, were analyzed for the expression of indicated proteins. D. Mutant p53 proteins do not inhibit IRE1α expression. Cell lysates were prepared from cells transfected with p53-G245S, p53-R248W, p53-249S, and p53-R273H expression vectors or from cells that constitutively expressed wild-type p53 and were analyzed for the expression of the indicated proteins.

    Journal: Oncotarget

    Article Title: Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    doi:

    Figure Lengend Snippet: IRE1α expression is regulated by p53 A. Western blot analysis of the expression of endogenous IRE1α in 23 human cancer cell lines. Cell lines were grouped according to expression of wild-type or mutant p53 as indicated. (A well between wt-p53 and mutant-p53 cell lines was cut, from the gel as indicated by a black line, due to the controversial p53 status of the cell line). Right panel: The intensities of the IRE1α bands (left panel) are expressed relative to those of β-actin. Values shown are the mean ± standard deviation (s.d.). The P value was calculated using two-way ANOVA. B. Downregulation of p53 expression induces increased expression of IRE1α. HCT116 p53 +/+ and U2OS cells were transfected with shLuc, shp53 (753), or shp53 (814), and selected using puromycin. Whole cell lysates of a pool of transfectants were analyzed using western blotting with the indicated antibodies. C. Overexpression of wild-type p53 inhibits IRE1α expression in mutant-p53 cell lines. Cell lysates, prepared 48 h after transfection with wild-type p53, were analyzed for the expression of indicated proteins. D. Mutant p53 proteins do not inhibit IRE1α expression. Cell lysates were prepared from cells transfected with p53-G245S, p53-R248W, p53-249S, and p53-R273H expression vectors or from cells that constitutively expressed wild-type p53 and were analyzed for the expression of the indicated proteins.

    Article Snippet: Wild-type p53, p53-G245S, p53-R248W, p53-R249S, p53-R273H, shp53 (pLKO.1 p53 shRNA-753 and -814 from Sigma-Aldrich (TRCN0000003753)), and shLuc (pLKO.1 Luciferase shRNA Control, Sigma-Aldrich) constructs were introduced into HCT116 p53 +/+ , U2OS, or H1299 cells using lipofection.

    Techniques: Expressing, Western Blot, Mutagenesis, Standard Deviation, Transfection, Over Expression

    The IRE1α inhibitor (STF-083010) suppresses the growth in vitro and in vivo of p53-deficient human cancer cells A. Effects of an IRE1α inhibitor on cell viability and on Tm-induced cell death in p53-deficient cells. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS shp53 cells were treated with Tm (0.5 mg/mL), STF-083010 (50 μM), or both for 24 h. Cell viability was determined using an MTT assay. Values shown are the mean ± s.d. of three different experiments measured simultaneously. B. An IRE1α inhibitor selectively suppresses the growth of p53-deficient tumors in nude mice. HCT116 p53 +/+ and HCT116 p53 −/− cells were used to engraft nude mice, and 4 days after injecting the cells, DMSO or STF-083010 (40 mg/kg) was intraperitoneally administered once every 3 days. Tumor volume was measured on the indicated days. After 15 days, the weights of the tumors (left panel) were measured. Values shown are the mean ± standard error of the mean of eight mice from each group. The P value was calculated using two-way ANOVA.

    Journal: Oncotarget

    Article Title: Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    doi:

    Figure Lengend Snippet: The IRE1α inhibitor (STF-083010) suppresses the growth in vitro and in vivo of p53-deficient human cancer cells A. Effects of an IRE1α inhibitor on cell viability and on Tm-induced cell death in p53-deficient cells. HCT116 p53 +/+ or HCT116 p53 −/− cells, MEF p53 +/+ or MEF p53 −/− cells, and U2OS shLuc or U2OS shp53 cells were treated with Tm (0.5 mg/mL), STF-083010 (50 μM), or both for 24 h. Cell viability was determined using an MTT assay. Values shown are the mean ± s.d. of three different experiments measured simultaneously. B. An IRE1α inhibitor selectively suppresses the growth of p53-deficient tumors in nude mice. HCT116 p53 +/+ and HCT116 p53 −/− cells were used to engraft nude mice, and 4 days after injecting the cells, DMSO or STF-083010 (40 mg/kg) was intraperitoneally administered once every 3 days. Tumor volume was measured on the indicated days. After 15 days, the weights of the tumors (left panel) were measured. Values shown are the mean ± standard error of the mean of eight mice from each group. The P value was calculated using two-way ANOVA.

    Article Snippet: Wild-type p53, p53-G245S, p53-R248W, p53-R249S, p53-R273H, shp53 (pLKO.1 p53 shRNA-753 and -814 from Sigma-Aldrich (TRCN0000003753)), and shLuc (pLKO.1 Luciferase shRNA Control, Sigma-Aldrich) constructs were introduced into HCT116 p53 +/+ , U2OS, or H1299 cells using lipofection.

    Techniques: In Vitro, In Vivo, MTT Assay, Mouse Assay

    ER stress response in p53-deficient or knockdown cells A. HCT116 p53 +/+ or HCT116 p53 −/− cells, B. MEF p53 +/+ or MEF p53 −/− cells, and C . U2OS shLuc or U2OS shp53 cells were incubated with Tm (0.5 μg/mL) or BFA (1 μg/mL) for the times indicated. Cell lysates were analyzed using western blotting with the indicated antibodies. The blot was cut based on the size of proteins or stripped. Total RNAs were extracted and subjected to RT-PCR analysis using specific primer sets for XBP1(U) and XBP1(S). Cell lysates were analyzed using western blotting with indicated antibodies.

    Journal: Oncotarget

    Article Title: Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    doi:

    Figure Lengend Snippet: ER stress response in p53-deficient or knockdown cells A. HCT116 p53 +/+ or HCT116 p53 −/− cells, B. MEF p53 +/+ or MEF p53 −/− cells, and C . U2OS shLuc or U2OS shp53 cells were incubated with Tm (0.5 μg/mL) or BFA (1 μg/mL) for the times indicated. Cell lysates were analyzed using western blotting with the indicated antibodies. The blot was cut based on the size of proteins or stripped. Total RNAs were extracted and subjected to RT-PCR analysis using specific primer sets for XBP1(U) and XBP1(S). Cell lysates were analyzed using western blotting with indicated antibodies.

    Article Snippet: Wild-type p53, p53-G245S, p53-R248W, p53-R249S, p53-R273H, shp53 (pLKO.1 p53 shRNA-753 and -814 from Sigma-Aldrich (TRCN0000003753)), and shLuc (pLKO.1 Luciferase shRNA Control, Sigma-Aldrich) constructs were introduced into HCT116 p53 +/+ , U2OS, or H1299 cells using lipofection.

    Techniques: Incubation, Western Blot, Reverse Transcription Polymerase Chain Reaction

    Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin RNA of p53 under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.

    Journal: International Journal of Molecular Sciences

    Article Title: Generation of Immortalised But Unstable Cells after hTERT Introduction in Telomere-Compromised and p53-Deficient vHMECs

    doi: 10.3390/ijms19072078

    Figure Lengend Snippet: Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin RNA of p53 under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.

    Article Snippet: Lentiviral Vectors, Lentivirus Production and Transduction The lentiviral construct for p53 short hairpin RNA (shp53 pLKO.1 puro) was from Dr Bob Weinberg (Addgene plasmid #19119) and the hTERT lentivirus was supplied by the Viral Vector Facility, CNIC, Madrid, Spain.

    Techniques: Transduction, Infection, shRNA, Selection

    Effect of shRNA-mediated silencing of p53 on the sensitivity of Cal-51 cells to the anti-proliferative effects of PARP inhibitors, a Verification by western blotting of shRNA-mediated knockdown of p53 expression in the stably transfected Cal-51 subclone.

    Journal: Breast cancer research and treatment

    Article Title: Differential anti-proliferative activities of poly(ADP-ribose) polymerase (PARP) inhibitors in triple-negative breast cancer cells

    doi: 10.1007/s10549-012-2106-5

    Figure Lengend Snippet: Effect of shRNA-mediated silencing of p53 on the sensitivity of Cal-51 cells to the anti-proliferative effects of PARP inhibitors, a Verification by western blotting of shRNA-mediated knockdown of p53 expression in the stably transfected Cal-51 subclone.

    Article Snippet: To generate p53-deficient cells, the p53 wild-type Cal-51 cells were transfected with a p53 shRNA plasmid (shp53 pLKO.l puro; Addgene) or the Non-Target shRNA Control Vector (CCGGCAACAAGATGAAGAG CACCAACTCAGTTGGTGCTCTTCATCTTGTTGTTTTT; Sigma-Aldrich).

    Techniques: shRNA, Western Blot, Expressing, Stable Transfection, Transfection

    Allele-specific silencing of mutp53 increases doxorubicin sensitivity by restoration of wtp53 activity A. MTT assays. HCT116 wt/R248W cells transfected with control , p53 , or 248 siRNAs were treated with water (control) or varying concentrations of doxorubicin for 48h, followed by MTT assays. B. PI staining and flow cytometry, using cells transfected with control or 248 siRNA and treated with water (control) or 1.25 μM of doxorubicin (DXR) for 24h. Representative results of flow cytometry (left) and summarized graphs showing sub-G0/G1 apoptotic fraction (right). C. QRT-PCR for p53 target genes, p21, BAX , and PUMA , using HCT116 wt/R248W cells transfected with control (C) , 248, or p53 (P) siRNAs with treatment of water or DXR for 24h. Data are presented as relative values to the water-treated, control siRNA-transfected group normalized by the value to GAPDH . D. Western blotting for p21, BAX, and Vinculin following treatment of control ( C ) or 248 siRNA-transfected HCT116 wt/R248W cells with water or DXR treatment for 24h. Short: short exposure, Long: long exposure. Error bars: means ± S.D. from three independent experiments. *, P

    Journal: Oncotarget

    Article Title: Allele-specific silencing of mutant p53 attenuates dominant-negative and gain-of-function activities

    doi: 10.18632/oncotarget.6634

    Figure Lengend Snippet: Allele-specific silencing of mutp53 increases doxorubicin sensitivity by restoration of wtp53 activity A. MTT assays. HCT116 wt/R248W cells transfected with control , p53 , or 248 siRNAs were treated with water (control) or varying concentrations of doxorubicin for 48h, followed by MTT assays. B. PI staining and flow cytometry, using cells transfected with control or 248 siRNA and treated with water (control) or 1.25 μM of doxorubicin (DXR) for 24h. Representative results of flow cytometry (left) and summarized graphs showing sub-G0/G1 apoptotic fraction (right). C. QRT-PCR for p53 target genes, p21, BAX , and PUMA , using HCT116 wt/R248W cells transfected with control (C) , 248, or p53 (P) siRNAs with treatment of water or DXR for 24h. Data are presented as relative values to the water-treated, control siRNA-transfected group normalized by the value to GAPDH . D. Western blotting for p21, BAX, and Vinculin following treatment of control ( C ) or 248 siRNA-transfected HCT116 wt/R248W cells with water or DXR treatment for 24h. Short: short exposure, Long: long exposure. Error bars: means ± S.D. from three independent experiments. *, P

    Article Snippet: Sphere and tumor formation assays Cancer cells were infected with control vectors or p53 shRNA-encoding lentiviral vectors (shp53 pLKO.1 puro for human p53 and pSicoR p53 for mouse p53, Addgene, Cambridge, MA, USA).

    Techniques: Activity Assay, MTT Assay, Transfection, Staining, Flow Cytometry, Cytometry, Quantitative RT-PCR, Western Blot

    Mutp53 downregulation by p53 shRNA inhibited malignant properties of cancer cells A. Sphere formation assays were performed using KHOS/NP (p53 R156P ) and 318-1 (p53 R172H ) cells infected with control empty or p53 shRNA-encoding lentiviral vectors. Graph showing % of sphere formation (# of spheres formed/# of cells seeded) and representative western blotting for p53 and Vinculin is below the graphs. B. Control ( Control , filled circle) or p53-downregulated ( p53sh , open circle) KHOS/NP cells (1,000,000) were subcutaneously injected into NIH-III nude mice, and tumor sizes were measured three-dimensionally 3-4 times a week for 3 weeks ( n = 6). Representative images of formed tumors are shown in the panel. Error bars: means ± S.D. * P

    Journal: Oncotarget

    Article Title: Allele-specific silencing of mutant p53 attenuates dominant-negative and gain-of-function activities

    doi: 10.18632/oncotarget.6634

    Figure Lengend Snippet: Mutp53 downregulation by p53 shRNA inhibited malignant properties of cancer cells A. Sphere formation assays were performed using KHOS/NP (p53 R156P ) and 318-1 (p53 R172H ) cells infected with control empty or p53 shRNA-encoding lentiviral vectors. Graph showing % of sphere formation (# of spheres formed/# of cells seeded) and representative western blotting for p53 and Vinculin is below the graphs. B. Control ( Control , filled circle) or p53-downregulated ( p53sh , open circle) KHOS/NP cells (1,000,000) were subcutaneously injected into NIH-III nude mice, and tumor sizes were measured three-dimensionally 3-4 times a week for 3 weeks ( n = 6). Representative images of formed tumors are shown in the panel. Error bars: means ± S.D. * P

    Article Snippet: Sphere and tumor formation assays Cancer cells were infected with control vectors or p53 shRNA-encoding lentiviral vectors (shp53 pLKO.1 puro for human p53 and pSicoR p53 for mouse p53, Addgene, Cambridge, MA, USA).

    Techniques: shRNA, Infection, Western Blot, Injection, Mouse Assay