shp53plko Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Addgene inc shp53 plko
    Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin <t>RNA</t> of <t>p53</t> under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.
    Shp53 Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 201 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shp53 plko/product/Addgene inc
    Average 95 stars, based on 201 article reviews
    Price from $9.99 to $1999.99
    shp53 plko - by Bioz Stars, 2020-11
    95/100 stars
      Buy from Supplier

    Image Search Results


    Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin RNA of p53 under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.

    Journal: International Journal of Molecular Sciences

    Article Title: Generation of Immortalised But Unstable Cells after hTERT Introduction in Telomere-Compromised and p53-Deficient vHMECs

    doi: 10.3390/ijms19072078

    Figure Lengend Snippet: Scheme of the generation and analysis of different vHMEC cell lines. Young vHMECs were immortalised by transduction with hTERT containing lentivirus at PD20 to generate immortalised vHMECs. In addition, young vHMECs at PD19 were also infected with lentiviral particles containing the short hairpin RNA of p53 under the hU6 constitutive promoter to generate p53 compromised finite vHMECs. After a period of selection with puromycin, the cells were expanded and subsequently immortalised with the hTERT lentivirus at PD24. Cytogenetic analysis was performed at PD22 and PD32 for young and aged vHMECs, respectively. Immortalised vHMECs (vHMEC-hTERT) were karyotyped at PD76 and at PD130 (not shown). Finite but p53-deficient vHMECs (vHMEC-shp53) were analysed at PD29 and the immortalised cell line derivative (vHMEC-shp53-hTERT) at PD47. Phase contrast images of the different cell lines at different PD are shown. Scale bar corresponds to 100 µm.

    Article Snippet: The lentiviral construct for p53 short hairpin RNA (shp53 pLKO.1 puro) was from Bob Weinberg (Addgene plasmid #19119).

    Techniques: Transduction, Infection, shRNA, Selection

    p53 is required for cell death in response to antimalarial treatment (A, B) p53 induction in A549 ( A ) or H460 ( B ) lung cancer cells upon CQ or Q treatment for the indicated times and doses. UT=untreated controls, Et= 50μM etoposide (positive control) (C, D) Immunostaining for p53 in A549 ( C ) and H460 ( D ) xenograft tumors treated for 3d with CQ and Q. Bar, 100μm. Right graphs: Quantification of p53 positive cells from tumors. Data are the mean ± SEM from 4 independent tumors for each condition. (E) LC3-II accumulation in p53 null H358 cells upon 18 h treatment with CQ or Q at indicated doses. (F) Growth curves of H358 cells treated with CQ or Q at indicated doses. Data represent the mean ± SEM from 3 independent experiments. (G) Immunostaining for pHH3 (proliferation) and CC3 (apoptosis) in H358 xenograft tumors treated with Q. Bar, 100μm. Right graphs: Quantification of pHH3 and CC3 positive cells. Data are the mean ± SEM from 6 independent tumors for each condition. (H) Reduced Q-mediated cell death in p53 null H358 cells and upon shRNA-mediated p53 knockdown in A549 and H460 cells. Q=10 μM quinacrine; STS=1μM staurosporine (positive control). Data represent the mean ± SEM from 3 independent experiments. Statistical significance was calculated using Student’s t-test for pair-wise comparisons in (F) or by ANOVA followed by Tukey’s HSD. *P≤0.05, **P≤0.01, ***P≤0.001.

    Journal: Oncogene

    Article Title: Oxidative Pentose Phosphate Pathway Inhibition Is A Key Determinant of Antimalarial Induced Cancer Cell Death

    doi: 10.1038/onc.2015.348

    Figure Lengend Snippet: p53 is required for cell death in response to antimalarial treatment (A, B) p53 induction in A549 ( A ) or H460 ( B ) lung cancer cells upon CQ or Q treatment for the indicated times and doses. UT=untreated controls, Et= 50μM etoposide (positive control) (C, D) Immunostaining for p53 in A549 ( C ) and H460 ( D ) xenograft tumors treated for 3d with CQ and Q. Bar, 100μm. Right graphs: Quantification of p53 positive cells from tumors. Data are the mean ± SEM from 4 independent tumors for each condition. (E) LC3-II accumulation in p53 null H358 cells upon 18 h treatment with CQ or Q at indicated doses. (F) Growth curves of H358 cells treated with CQ or Q at indicated doses. Data represent the mean ± SEM from 3 independent experiments. (G) Immunostaining for pHH3 (proliferation) and CC3 (apoptosis) in H358 xenograft tumors treated with Q. Bar, 100μm. Right graphs: Quantification of pHH3 and CC3 positive cells. Data are the mean ± SEM from 6 independent tumors for each condition. (H) Reduced Q-mediated cell death in p53 null H358 cells and upon shRNA-mediated p53 knockdown in A549 and H460 cells. Q=10 μM quinacrine; STS=1μM staurosporine (positive control). Data represent the mean ± SEM from 3 independent experiments. Statistical significance was calculated using Student’s t-test for pair-wise comparisons in (F) or by ANOVA followed by Tukey’s HSD. *P≤0.05, **P≤0.01, ***P≤0.001.

    Article Snippet: The target sequences for hairpins directed against ATG7 (NM_006395) are shATG7 #1 (TRCN0000007584): GCCTGCTGAGGAGCTCTCCA and shATG7 #2 (TRCN0000007587): CCCAGCTATTGGAACACTGTA; the target sequence directed against ATG12 (NM_004707) is shATG12 #1 (TRCN0000007393): TGTTGCAGCTTCCTACTTCAA; and the target sequence directed against p53 (Addgene plasmid 19119) is: CCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAGTCTTTTT.

    Techniques: Positive Control, Immunostaining, shRNA

    Simultaneous genetic targeting of autophagy and the oxPPP is sufficient to trigger apoptosis in p53 null lung cancer cells (A) p53 is induced upon 10 μM Q treatment in A549 and H460 cells and co-immunoprecipitates with G6PD. DX=1μM doxorubicin (positive control). (B, C) Oxidative PPP activity ( B , 14 CO 2 production from 1- 14 C-glucose) and G6PD activity ( C ) following treatment with CQ or Q. (D) CQ promotes cell death upon G6PD knockdown in H358 cells. (E) Q promotes cell death upon G6PD knockdown in H358 cells. (F) Combined RNAi-mediated knockdown of ATG7 and G6PD is sufficient to induce cell death in H358 cells. All data represent the mean ± SEM from 3 independent experiments. Statistical significance was calculated using ANOVA followed by Tukey’s HSD. *P≤0.05, **P≤0.01, ***P≤0.001.

    Journal: Oncogene

    Article Title: Oxidative Pentose Phosphate Pathway Inhibition Is A Key Determinant of Antimalarial Induced Cancer Cell Death

    doi: 10.1038/onc.2015.348

    Figure Lengend Snippet: Simultaneous genetic targeting of autophagy and the oxPPP is sufficient to trigger apoptosis in p53 null lung cancer cells (A) p53 is induced upon 10 μM Q treatment in A549 and H460 cells and co-immunoprecipitates with G6PD. DX=1μM doxorubicin (positive control). (B, C) Oxidative PPP activity ( B , 14 CO 2 production from 1- 14 C-glucose) and G6PD activity ( C ) following treatment with CQ or Q. (D) CQ promotes cell death upon G6PD knockdown in H358 cells. (E) Q promotes cell death upon G6PD knockdown in H358 cells. (F) Combined RNAi-mediated knockdown of ATG7 and G6PD is sufficient to induce cell death in H358 cells. All data represent the mean ± SEM from 3 independent experiments. Statistical significance was calculated using ANOVA followed by Tukey’s HSD. *P≤0.05, **P≤0.01, ***P≤0.001.

    Article Snippet: The target sequences for hairpins directed against ATG7 (NM_006395) are shATG7 #1 (TRCN0000007584): GCCTGCTGAGGAGCTCTCCA and shATG7 #2 (TRCN0000007587): CCCAGCTATTGGAACACTGTA; the target sequence directed against ATG12 (NM_004707) is shATG12 #1 (TRCN0000007393): TGTTGCAGCTTCCTACTTCAA; and the target sequence directed against p53 (Addgene plasmid 19119) is: CCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAGTCTTTTT.

    Techniques: Positive Control, Activity Assay

    NF-YA loss activates a p53-dependent transcriptional response A. Pscan analysis of Transcription Factors Binding Sites (TFBS) with relative p-values in down-regulated genes following NF-YA inactivation by shRNA. B. KEGG analysis of up- and down-regulated genes retrieved from gene expression profiles of NF-YA-inactivated cells. C. Heat map of p53-target genes upon NF-YA abrogation.

    Journal: Oncotarget

    Article Title: NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription

    doi: 10.18632/oncotarget.9974

    Figure Lengend Snippet: NF-YA loss activates a p53-dependent transcriptional response A. Pscan analysis of Transcription Factors Binding Sites (TFBS) with relative p-values in down-regulated genes following NF-YA inactivation by shRNA. B. KEGG analysis of up- and down-regulated genes retrieved from gene expression profiles of NF-YA-inactivated cells. C. Heat map of p53-target genes upon NF-YA abrogation.

    Article Snippet: A combination of two different PLKO1 shRNAs (Sigma Aldrich) targeting exons 8 and 10 of NF-YA was used (MOI=6 for each shRNA) ( ). p53 inactivation was achieved by infecting cells with PLKO1 p53-targeting shRNA (Addgene, #19119) (MOI=8).

    Techniques: Binding Assay, shRNA, Expressing

    53BP1 and USP28, but not TRIM37, are essential for activating p53 in response to prolonged mitotic duration. (A) Analysis of p53 and p21 levels after induction of DNA damage with doxorubicin; schematic describes experimental protocol and GAPDH serves as a loading control. (B) Analysis of cytokinesis failure–induced division arrest; schematic describes experimental protocol. Red dots show results from two independent experiments. Immunoblot confirms efficient p53 depletion. (C) Analysis of extended mitotic duration–induced division arrest; schematic describes experimental protocol. Vertical bars represent individual daughter cells. Bar height shows the time the mother cells spent in mitosis, and bar color indicates whether they arrested (red) or divided (gray). Black dashed line marks the mitotic duration cutoff in control RPE1 cells, after which resulting daughter cells arrest in G1. (D) Schematic shows two possible models for how centrosome loss might trigger p53 activation, either directly (left) or indirectly through successive prolonged mitoses (right).

    Journal: The Journal of Cell Biology

    Article Title: 53BP1 and USP28 mediate p53 activation and G1 arrest after centrosome loss or extended mitotic duration

    doi: 10.1083/jcb.201604081

    Figure Lengend Snippet: 53BP1 and USP28, but not TRIM37, are essential for activating p53 in response to prolonged mitotic duration. (A) Analysis of p53 and p21 levels after induction of DNA damage with doxorubicin; schematic describes experimental protocol and GAPDH serves as a loading control. (B) Analysis of cytokinesis failure–induced division arrest; schematic describes experimental protocol. Red dots show results from two independent experiments. Immunoblot confirms efficient p53 depletion. (C) Analysis of extended mitotic duration–induced division arrest; schematic describes experimental protocol. Vertical bars represent individual daughter cells. Bar height shows the time the mother cells spent in mitosis, and bar color indicates whether they arrested (red) or divided (gray). Black dashed line marks the mitotic duration cutoff in control RPE1 cells, after which resulting daughter cells arrest in G1. (D) Schematic shows two possible models for how centrosome loss might trigger p53 activation, either directly (left) or indirectly through successive prolonged mitoses (right).

    Article Snippet: To knock down TP53 (p53), RPE-1 cells were infected with a lentivirus containing sh-p53 made using the plasmid shp53 pLKO.1 puro (19119; Addgene; ).

    Techniques: Activation Assay

    Genome-wide CRISPR/Cas9 screen for genes involved in activating p53 upon centrosome loss. (A, top) Immunofluorescence images of RPE1 cells, stained for DNA (red) and the centrosomal protein Cep192 (green), after treatment with DMSO or centrinone for 5 d. Bar, 10 µm. (bottom) Schematic highlighting the two classes of genes that would be identified in a centrinone-resistance screen. (B) Summary of the screen designed to identify genes that activate p53 in response to centrosome loss. (C) Table summarizing the results of two independent screens. All 15 colonies had one of the three listed genes deleted; no colony had more than one. (D) Schematic of the three proteins 53BP1, USP28, and TRIM37, identified by the screen.

    Journal: The Journal of Cell Biology

    Article Title: 53BP1 and USP28 mediate p53 activation and G1 arrest after centrosome loss or extended mitotic duration

    doi: 10.1083/jcb.201604081

    Figure Lengend Snippet: Genome-wide CRISPR/Cas9 screen for genes involved in activating p53 upon centrosome loss. (A, top) Immunofluorescence images of RPE1 cells, stained for DNA (red) and the centrosomal protein Cep192 (green), after treatment with DMSO or centrinone for 5 d. Bar, 10 µm. (bottom) Schematic highlighting the two classes of genes that would be identified in a centrinone-resistance screen. (B) Summary of the screen designed to identify genes that activate p53 in response to centrosome loss. (C) Table summarizing the results of two independent screens. All 15 colonies had one of the three listed genes deleted; no colony had more than one. (D) Schematic of the three proteins 53BP1, USP28, and TRIM37, identified by the screen.

    Article Snippet: To knock down TP53 (p53), RPE-1 cells were infected with a lentivirus containing sh-p53 made using the plasmid shp53 pLKO.1 puro (19119; Addgene; ).

    Techniques: Genome Wide, CRISPR, Immunofluorescence, Staining

    Loss of TP53BP1, USP28, or TRIM37 suppresses p53 elevation and proliferation arrest triggered by centrosome loss. (A, top) Outline of the procedure used to generate RPE1 knockouts. (A, bottom) Immunoblots of extracts from control (Ctrl) and knockout RPE1 lines. Bands corresponding to each protein (arrowheads) and nonspecific bands (asterisks) are indicated. α-Tubulin serves as a loading control. (B) Outline of cell proliferation analysis and assessment of p53 and p21 levels after acute treatment with centrinone or Mdm2i. (C) Graphs plotting the results of passaging assays monitoring the growth of control and knockout RPE1 cell lines after addition at day 0 of DMSO (vehicle), centrinone, or Mdm2i. (D) Immunoblots probed with the indicated antibodies after addition of Mdm2i (left) or centrinone (right). α-Tubulin (α-tub) serves as a loading control. (E) Immunofluorescence analysis of Cep192 and p53 after 5-d centrinone treatment. Representative images (left) and graph (right) plotting the distributions of nuclear p53 fluorescence for one of three experiments (for quantification of the other two experiments, see Fig. S2 E ). Graph shows 5–95% box-and-whiskers plots. Bar, 10 µm.

    Journal: The Journal of Cell Biology

    Article Title: 53BP1 and USP28 mediate p53 activation and G1 arrest after centrosome loss or extended mitotic duration

    doi: 10.1083/jcb.201604081

    Figure Lengend Snippet: Loss of TP53BP1, USP28, or TRIM37 suppresses p53 elevation and proliferation arrest triggered by centrosome loss. (A, top) Outline of the procedure used to generate RPE1 knockouts. (A, bottom) Immunoblots of extracts from control (Ctrl) and knockout RPE1 lines. Bands corresponding to each protein (arrowheads) and nonspecific bands (asterisks) are indicated. α-Tubulin serves as a loading control. (B) Outline of cell proliferation analysis and assessment of p53 and p21 levels after acute treatment with centrinone or Mdm2i. (C) Graphs plotting the results of passaging assays monitoring the growth of control and knockout RPE1 cell lines after addition at day 0 of DMSO (vehicle), centrinone, or Mdm2i. (D) Immunoblots probed with the indicated antibodies after addition of Mdm2i (left) or centrinone (right). α-Tubulin (α-tub) serves as a loading control. (E) Immunofluorescence analysis of Cep192 and p53 after 5-d centrinone treatment. Representative images (left) and graph (right) plotting the distributions of nuclear p53 fluorescence for one of three experiments (for quantification of the other two experiments, see Fig. S2 E ). Graph shows 5–95% box-and-whiskers plots. Bar, 10 µm.

    Article Snippet: To knock down TP53 (p53), RPE-1 cells were infected with a lentivirus containing sh-p53 made using the plasmid shp53 pLKO.1 puro (19119; Addgene; ).

    Techniques: Western Blot, Knock-Out, Passaging, Immunofluorescence, Fluorescence