|
Genecopoeia
sgrna Sgrna, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/Scrambled+sgRNA+control+for+pCRISPR-LvSG03/10__1158_slash_1541___7786__mcr___21___0199-71-14-15 Average 93 stars, based on 1 article reviews
sgrna - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pu6 sgrna ef1α puro t2a mcherry vector Pu6 Sgrna Ef1α Puro T2a Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/pU6-sgRNA+EF1Alpha-puro-T2A-BFP%2EControl+(Plasmid+%23128749)/bio_rxiv__64898__2025__12__29__696402-248-23-26 Average 93 stars, based on 1 article reviews
pu6 sgrna ef1α puro t2a mcherry vector - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Synthego Inc
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/control+non+ntc+sgrna+targeting/pm40769148-750-28-35 Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Genecopoeia
pcrispr cg04 Pcrispr Cg04, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/Scrambled+sgRNA+control+for+pCRISPR-CG04/bio_rxiv__2021__09__28__462124-188-17-24 Average 93 stars, based on 1 article reviews
pcrispr cg04 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Genecopoeia
sgrna control Sgrna Control, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/Scrambled+sgRNA+control+for+TALE-TF/10__7554_slash_elife__73360-237-17-29 Average 90 stars, based on 1 article reviews
sgrna control - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Genecopoeia
sgrna control pcrispr cg12 Sgrna Control Pcrispr Cg12, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/Scrambled+sgRNA+control+for+pCRISPR-CG12/pmc09652615-738-14-26 Average 93 stars, based on 1 article reviews
sgrna control pcrispr cg12 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Genecopoeia
sgrna control plasmid Sgrna Control Plasmid, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/Scrambled+sgRNA+control+for+pCRISPR-SG01/us11725056-1696-29-33 Average 93 stars, based on 1 article reviews
sgrna control plasmid - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
SG Controls Ltd
sik1 sgrna guides ![]() Sik1 Sgrna Guides, supplied by SG Controls Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/sik1+sgrna+guides/pmc06825547-179-50-65 Average 90 stars, based on 1 article reviews
sik1 sgrna guides - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
gfp-targeting or pxpr-515 control sgrna ![]() Gfp Targeting Or Pxpr 515 Control Sgrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/gfp+targeting+or+pxpr+515+control+sgrna/10__1128_slash_mbio__01530___21-293-6-1 Average 90 stars, based on 1 article reviews
gfp-targeting or pxpr-515 control sgrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
CustomArray Inc
nontargeting control sgrnas ![]() Nontargeting Control Sgrnas, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/nontargeting+control+sgrnas/pmc06936709-352-33-50 Average 90 stars, based on 1 article reviews
nontargeting control sgrnas - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
lentiviruses carrying hjurp single guide rna (sgrna) and control sgrna ![]() Lentiviruses Carrying Hjurp Single Guide Rna (Sgrna) And Control Sgrna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/lentiviruses+carrying+hjurp+single+guide+rna++sgrna++and+control+sgrna/pm39405980-161-8-13 Average 90 stars, based on 1 article reviews
lentiviruses carrying hjurp single guide rna (sgrna) and control sgrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
dnas encoding sgrnas (trans-activating rna-crisper rna chimera) under the control of the u6 promoter ![]() Dnas Encoding Sgrnas (Trans Activating Rna Crisper Rna Chimera) Under The Control Of The U6 Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+control/dnas+encoding+sgrnas++trans+activating+rna+crisper+rna+chimera++under+the+control+of+the+u6+promoter/pm28646206-209-12-17 Average 90 stars, based on 1 article reviews
dnas encoding sgrnas (trans-activating rna-crisper rna chimera) under the control of the u6 promoter - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cancer discovery
Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.
doi: 10.1158/2159-8290.CD-18-1261
Figure Lengend Snippet: (A) Schematic of the experimental design using pSECC lentivirus to deliver Cre-recombinase, Cas9 and a Sik1 or Sik3 sgRNA as a single payload to the lungs of KrasG12D-mice (K) and Kras-Sik1 floxed mice (KSik1) after intratracheal virus delivery.
Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with
Techniques: Virus
Journal: Cancer discovery
Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.
doi: 10.1158/2159-8290.CD-18-1261
Figure Lengend Snippet: (A) Schematic of the experimental design using pSECC lentivirus to deliver Cre-recombinase, Cas9 and a sgRNA of choice as a single payload to the lungs of KrasG12D-mice (K) and Kras-p53 floxed mice (KP) after intratracheal virus delivery.
Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with
Techniques: Virus
Journal: Cancer discovery
Article Title: The AMPK-related kinases SIK1 and SIK3 mediate key tumor suppressive effects of LKB1 in NSCLC.
doi: 10.1158/2159-8290.CD-18-1261
Figure Lengend Snippet: (A) ELISA analysis of IL-6 secretion in mouse KP lines. KP cells lines were transduced with a sgRNA guide targeting Lkb1 or with two independent sets of guides to target Sik1 and Sik3 simultaneously. 500,000 control or KO cells were seeded in 6 well plates and supernatant was collected at 48hrs to quantitate the amount of IL6 released by the cells into the media.
Article Snippet: As a cohort, KPSik1 mice showed an increase from 10% to 28% in tumor burden over KP mice, (a 2.8-fold increase) compared to a tumor burden of 52% in the KPL mice (5.25-fold increase over KP) , and this was consistent with the results observed in KP mice treated with
Techniques: Enzyme-linked Immunosorbent Assay, Transduction, Control
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions
doi: 10.1073/pnas.1909720116
Figure Lengend Snippet: The p16INK4A-P2A-mCherry reporter allele recapitulates endogenous transcription of p16INK4A. (A) Schematic diagram of the transcriptional repression of p16INK4A by the CRISPR interference system. The dCas9-KRAB fusion protein was guided to the p16INK4A promoter with 3 individual sgRNAs. (B) qRT-PCR was performed on the p16mCherry/+;dCas9-KRAB cells with 3 different p16INK4A-sgRNAs using primers targeting coding sequences of mCherry and p16INK4A. (C) Flow cytometry analysis was performed on the p16mCherry/+;dCas9-KRAB cells with 2 p16INK4A-sgRNAs. The mean value of the mCherry density in each group was calculated and obtained by 3 replicates. The P value was calculated by a 2-tailed t test. (D) The correlation of transcription reduction in mCherry and p16INK4A in response to dCas9-KRAB–mediated transcription repression (from B) was calculated by Pearson’s correlation test (n = 6). (E) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of p16INK4A. Three biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of mCherry. Three biological replicates were performed. The P value was calculated by a 2-tailed t test.
Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20
Techniques: CRISPR, Quantitative RT-PCR, Flow Cytometry, Sequencing
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions
doi: 10.1073/pnas.1909720116
Figure Lengend Snippet: Noncoding pooled CRISPR screening identified a distal repressive element of p16INK4A residing within the ARF locus. (A) Schematic diagram of a working model of dCas9-KRAB– and Cas9-mediated noncoding screening. (B) The global correlation of sgRNA distribution in dCas9-KRAB and Cas9 screens in the p16mCherry/+ reporter cell line. (C) The global distribution of all sgRNAs in a selected region of the INK4/ARF locus from 3 screens in the p16mCherry/+ reporter cell line using dCas9-KRAB, Cas9, and no effector control. The red arrow indicates the most enriched sgRNAs in a 42-bp region of the ARF exon1β and intron 1. (D) Two candidate sgRNAs binding to the plus and minus strands of the most enriched 42-bp core DNA sequence near the ARF promoter were designed for validation (ARF-sgRNA-3 and -4). The red arrows indicate the orientation of the sgRNA binding sequences. (E) Western blotting analysis of ARF and p16INK4A in dCas9-KRAB– and Cas9-expressing SEM cells infected with ARF-sgRNA-3, -4, and the nontargeting sgRNA control.
Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20
Techniques: CRISPR, Control, Binding Assay, Sequencing, Biomarker Discovery, Western Blot, Expressing, Infection
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions
doi: 10.1073/pnas.1909720116
Figure Lengend Snippet: Physical interactions between ARF, p16INK4A, and p15INK4B were detected by 3C. (A) Next-generation Capture-C was performed on parental human SEM cells for 2 replicates. Two specific anchor probes (Bait 1 and Bait 2) were designed to hybridize to the H3K27ac peaks that overlap each of the promoters of p16INK4A, ARF, and p15INK4B to capture chromatin interactions with the respective promoters within the INK4/ARF locus. (B) CUT&RUN was performed on p16mCherry/+;dCas9-KRAB cells infected individually with 2 sgRNAs targeting the p16INK4A repressive element adjacent to the ARF promoter and 2 sgRNAs targeting the p16INK4A promoter. A Cas9 antibody that recognizes dCas9 was used for a pull-down assay. ChIP-seq tracks of CTCF and H3K27ac were included to indicate the open chromatin status of the locus.
Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20
Techniques: Capture-C, Infection, Pull Down Assay, ChIP-sequencing
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions
doi: 10.1073/pnas.1909720116
Figure Lengend Snippet: The ARF/p16INK4A chromatin interaction and transcriptional regulation is functionally detected in NBL cells. (A) qRT-PCR analysis of p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. NT-sgRNA is a nontargeting sgRNA control. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (B) qRT-PCR analysis of ARF in the human NBL cell SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (C) Western blotting analysis of ARF and p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNA-3 and -4 compared to NT-infected controls. (D) Representative image of SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA at day 3. (E) Quantification of cell proliferation by cell number count. Two biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) Next-generation Capture-C was performed on SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA. Anchor probes that hybridized to the p16INK4A promoter were utilized to capture chromatin interactions. Boxes 2 and 3 highlight ARF and p15INK4B promoters which were interacting with the indicated p16INK4A anchor regions. Box 1 indicates a negative control noncoding region. (G) Quantification of interaction frequency between the anchor regions to Boxes 1, 2, and 3. Signal value from the .bw file of Capture-C was normalized by probe signal for each experiment.
Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20
Techniques: Quantitative RT-PCR, Infection, Control, Western Blot, Stable Transfection, Expressing, Capture-C, Negative Control
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions
doi: 10.1073/pnas.1909720116
Figure Lengend Snippet: Loss-of-function CRISPR screening of human transcriptional factors in the p16INK4A reporter cell line. (A) Schematic diagram of a working model of Cas9-mediated CRISPR screening targeting 1,639 human TFs. (B) Gene ranking of looping factors (YY1, first; CTCF, 1,001st) enriched from screening. The enrichment score of 7 sgRNAs against each TF was combined by MAGeCK algorithm. (C, Top) The overall distribution of all sgRNAs from the screening. (C, Bottom) The Log2[Fold Change (top10/bottom10)] ratio for all sgRNAs targeting CTCF, YY1, and the top 10 negative regulators from D and NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 gRNAs; TF: 7 sgRNAs/each. (D) Gene ranking of top 10 negative candidate regulators enriched from screening analysis by MAGeCK algorithm. (E) Immunoblotting of YY1 in p16mCherry/+;Cas9 cells targeted individually with 2 sgRNAs against the coding sequence of human YY1. GAPDH was probed as a loading control. (F) The p16mCherry/+;Cas9 cells were targeted with Cas9 and 2 sgRNAs identified from TF screening targeting the coding region of human YY1. Flow cytometry analysis of mCherry reporter activity was subsequently conducted in YY1-targeted cells compared with NT control. (G) YY1-binding motif prediction by JASPAR algorithm. (H) CUT&RUN of YY1 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA for 2 replicates. Tracks were shown at the viewpoint of the INK4/ARF locus. (I) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks were shown at the viewpoint of the INK4/ARF locus. (J) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks of ZNF217 were shown for viewpoint at a randomly chosen locus.
Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20
Techniques: CRISPR, Western Blot, Sequencing, Control, Flow Cytometry, Activity Assay, Binding Assay, Infection