sev Search Results


gene exp sev mr04269880 mr  (Thermo Fisher)
89
Thermo Fisher gene exp sev mr04269880 mr
Gene Exp Sev Mr04269880 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/10__1016_slash_j__scr__2026__103977-88-13--1?v=Thermo+Fisher
Average 89 stars, based on 1 article reviews
gene exp sev mr04269880 mr - by Bioz Stars, 2026-07
89/100 stars
  Buy from Supplier
gene exp sev klf4 mr04421256 mr  (Thermo Fisher)
87
Thermo Fisher gene exp sev klf4 mr04421256 mr
Characterization and validation
Gene Exp Sev Klf4 Mr04421256 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pmc10576909-52-5--1?v=Thermo+Fisher
Average 87 stars, based on 1 article reviews
gene exp sev klf4 mr04421256 mr - by Bioz Stars, 2026-07
87/100 stars
  Buy from Supplier
gene exp sev oct3 4 mr04269878 mr  (Thermo Fisher)
85
Thermo Fisher gene exp sev oct3 4 mr04269878 mr
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and <t>Oct4,</t> in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Gene Exp Sev Oct3 4 Mr04269878 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pmc05303871-66-53-7?v=Thermo+Fisher
Average 85 stars, based on 1 article reviews
gene exp sev oct3 4 mr04269878 mr - by Bioz Stars, 2026-07
85/100 stars
  Buy from Supplier
gene exp sev kos mr04421257 mr  (Thermo Fisher)
86
Thermo Fisher gene exp sev kos mr04421257 mr
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and <t>Oct4,</t> in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Gene Exp Sev Kos Mr04421257 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pm41023835-50-12-47?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp sev kos mr04421257 mr - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
gene exp sev cmyc mr04269876 mr  (Thermo Fisher)
88
Thermo Fisher gene exp sev cmyc mr04269876 mr
Reagents details
Gene Exp Sev Cmyc Mr04269876 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pmc10576909-115-174--1?v=Thermo+Fisher
Average 88 stars, based on 1 article reviews
gene exp sev cmyc mr04269876 mr - by Bioz Stars, 2026-07
88/100 stars
  Buy from Supplier
gene exp sev sox2 mr04269881 mr  (Thermo Fisher)
85
Thermo Fisher gene exp sev sox2 mr04269881 mr
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, <t>Sox2</t> and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Gene Exp Sev Sox2 Mr04269881 Mr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pmc05303871-66-57-7?v=Thermo+Fisher
Average 85 stars, based on 1 article reviews
gene exp sev sox2 mr04269881 mr - by Bioz Stars, 2026-07
85/100 stars
  Buy from Supplier
noninfectious sev particle expressing envf (nvp-envf)  (ID Pharma Co Ltd)
90
ID Pharma Co Ltd noninfectious sev particle expressing envf (nvp-envf)
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, <t>Sox2</t> and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Noninfectious Sev Particle Expressing Envf (Nvp Envf), supplied by ID Pharma Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pm38734900-144-30-49?v=ID+Pharma+Co+Ltd
Average 90 stars, based on 1 article reviews
noninfectious sev particle expressing envf (nvp-envf) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
sendai virus vectors cytotune-ips for blood cells  (DNAVEC Inc)
90
DNAVEC Inc sendai virus vectors cytotune-ips for blood cells
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, <t>Sox2</t> and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Sendai Virus Vectors Cytotune Ips For Blood Cells, supplied by DNAVEC Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pmc05312248-102-6-13?v=DNAVEC+Inc
Average 90 stars, based on 1 article reviews
sendai virus vectors cytotune-ips for blood cells - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
notum-gal4 line–s168-gal4  (Basler)
90
Basler notum-gal4 line–s168-gal4
Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, <t>Sox2</t> and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).
Notum Gal4 Line–S168 Gal4, supplied by Basler, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sev/pm16914498-106-2-6?v=Basler
Average 90 stars, based on 1 article reviews
notum-gal4 line–s168-gal4 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Characterization and validation

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Characterization and validation

Article Snippet: , SEV-KLF4 , 67 , Mr04421256_mr , .

Techniques: Expressing, Flow Cytometry, Mutagenesis, Sequencing, Southern Blot, Virus, Reverse Transcription Polymerase Chain Reaction

Reagents details

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Reagents details

Article Snippet: , SEV-KLF4 , 67 , Mr04421256_mr , .

Techniques: Flow Cytometry, Immunohistochemistry, Mutagenesis, Sequencing, Control

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet:

Article Snippet: , SEV-KLF4 , 67 , Mr04421256_mr , .

Techniques: Virus, Modification, Mutagenesis

Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Derivative Assay, Cell Culture, Staining, Quantitative RT-PCR, Gene Expression, Immunofluorescence

Pluripotent marker expression analysis of hOB-iPSCs and hFB-iPSCs. (a) hOB-iPSC and hFB-iPSC qRT-PCR expression of endogenous pluripotent genes, Sox2, Oct4, Nanog, and hTERT ( ∗ P < 0.01). (b) Immunofluorescence of hOB-iPSC for pluripotency markers, TRA-1-60, Oct4, Nanog, Sox2, and IgG-FITC control (scale bars = 30 μ m). ( ∗ indicates nonstaining MEF background.)

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Pluripotent marker expression analysis of hOB-iPSCs and hFB-iPSCs. (a) hOB-iPSC and hFB-iPSC qRT-PCR expression of endogenous pluripotent genes, Sox2, Oct4, Nanog, and hTERT ( ∗ P < 0.01). (b) Immunofluorescence of hOB-iPSC for pluripotency markers, TRA-1-60, Oct4, Nanog, Sox2, and IgG-FITC control (scale bars = 30 μ m). ( ∗ indicates nonstaining MEF background.)

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Marker, Expressing, Quantitative RT-PCR, Immunofluorescence, Control

Induced osteoprogenitors (iOPs) cells differentiated from hOB-iPSC. (a) Flow cytometry analysis of iOPs and hMSCs revealed that the cells were positive for mesenchymal markers (CD29, CD44, CD90, CD105, and CD166) and negative for hematopoietic markers (CD14, CD31, and CD45) (black: CD marker expression, red: isotype control, and blue: unstained control). (b) Significantly ( P < 0.05) faster growth kinetics of the hOB-iOPs and hFB-iOPs, as compared to hOBs and hMSCs in either 20% serum-containing media or Xenofree StemPro media at all time points. (c) Differentiation time of hOB-iPSCs to iOPs was assayed using flow cytometry for mesenchymal cell markers, CD44 and CD105. (d) iOPs were found to have similar levels of osteogenic related genes, RUNX2, BMP2, osteocalcin, and COL1A1 as compared to hMSCs ∗ indicates significant difference from the hOB-iOPs ( P < 0.05). iOPs downregulated all pluripotency genes, Oct4, Sox2, Nanog, and hTERT indicating successful differentiations. ∗ indicates significant difference from the iPSC ( P < 0.05).

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Induced osteoprogenitors (iOPs) cells differentiated from hOB-iPSC. (a) Flow cytometry analysis of iOPs and hMSCs revealed that the cells were positive for mesenchymal markers (CD29, CD44, CD90, CD105, and CD166) and negative for hematopoietic markers (CD14, CD31, and CD45) (black: CD marker expression, red: isotype control, and blue: unstained control). (b) Significantly ( P < 0.05) faster growth kinetics of the hOB-iOPs and hFB-iOPs, as compared to hOBs and hMSCs in either 20% serum-containing media or Xenofree StemPro media at all time points. (c) Differentiation time of hOB-iPSCs to iOPs was assayed using flow cytometry for mesenchymal cell markers, CD44 and CD105. (d) iOPs were found to have similar levels of osteogenic related genes, RUNX2, BMP2, osteocalcin, and COL1A1 as compared to hMSCs ∗ indicates significant difference from the hOB-iOPs ( P < 0.05). iOPs downregulated all pluripotency genes, Oct4, Sox2, Nanog, and hTERT indicating successful differentiations. ∗ indicates significant difference from the iPSC ( P < 0.05).

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Flow Cytometry, Marker, Expressing, Control

Reagents details

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Reagents details

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Flow Cytometry, Immunohistochemistry, Mutagenesis, Sequencing, Control

Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Characterization and reprogramming of donor-derived osteoblasts. (a) Example of donor bone chip in media (arrow) with osteoblasts emerging onto culture flask (asterisk). Osteoblasts were cultured in growth (b) or osteogenic induction media (c) and the resulting calcium deposits were stained with Alizarin Red S and imaged (scale bars = 30 μ m and inserts are at 1x). (d) The donor-derived osteoblasts were assayed with qRT-PCR for osteoblast markers, osteocalcin, osteopontin, RUNX2, BMP2, and COL1A1 and compared to a commercially available osteoblast cell line (NHOst). (e) qRT-PCR analysis of pluripotent gene expression, Sox2 and Oct4, in the hOBs compared to neonatal BJ fibroblasts. ( ∗ P < 0.05). (f) Alkaline phosphatase staining of primary reprogramming plate of hOB-iPSC. (g) TRA-1-81 immunofluorescence of initial hOB-iPSC colony (scale bars = 30 μ m).

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Derivative Assay, Cell Culture, Staining, Quantitative RT-PCR, Gene Expression, Immunofluorescence

Pluripotent marker expression analysis of hOB-iPSCs and hFB-iPSCs. (a) hOB-iPSC and hFB-iPSC qRT-PCR expression of endogenous pluripotent genes, Sox2, Oct4, Nanog, and hTERT ( ∗ P < 0.01). (b) Immunofluorescence of hOB-iPSC for pluripotency markers, TRA-1-60, Oct4, Nanog, Sox2, and IgG-FITC control (scale bars = 30 μ m). ( ∗ indicates nonstaining MEF background.)

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Pluripotent marker expression analysis of hOB-iPSCs and hFB-iPSCs. (a) hOB-iPSC and hFB-iPSC qRT-PCR expression of endogenous pluripotent genes, Sox2, Oct4, Nanog, and hTERT ( ∗ P < 0.01). (b) Immunofluorescence of hOB-iPSC for pluripotency markers, TRA-1-60, Oct4, Nanog, Sox2, and IgG-FITC control (scale bars = 30 μ m). ( ∗ indicates nonstaining MEF background.)

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Marker, Expressing, Quantitative RT-PCR, Immunofluorescence, Control

Induced osteoprogenitors (iOPs) cells differentiated from hOB-iPSC. (a) Flow cytometry analysis of iOPs and hMSCs revealed that the cells were positive for mesenchymal markers (CD29, CD44, CD90, CD105, and CD166) and negative for hematopoietic markers (CD14, CD31, and CD45) (black: CD marker expression, red: isotype control, and blue: unstained control). (b) Significantly ( P < 0.05) faster growth kinetics of the hOB-iOPs and hFB-iOPs, as compared to hOBs and hMSCs in either 20% serum-containing media or Xenofree StemPro media at all time points. (c) Differentiation time of hOB-iPSCs to iOPs was assayed using flow cytometry for mesenchymal cell markers, CD44 and CD105. (d) iOPs were found to have similar levels of osteogenic related genes, RUNX2, BMP2, osteocalcin, and COL1A1 as compared to hMSCs ∗ indicates significant difference from the hOB-iOPs ( P < 0.05). iOPs downregulated all pluripotency genes, Oct4, Sox2, Nanog, and hTERT indicating successful differentiations. ∗ indicates significant difference from the iPSC ( P < 0.05).

Journal: Stem Cells International

Article Title: Preferential Lineage-Specific Differentiation of Osteoblast-Derived Induced Pluripotent Stem Cells into Osteoprogenitors

doi: 10.1155/2017/1513281

Figure Lengend Snippet: Induced osteoprogenitors (iOPs) cells differentiated from hOB-iPSC. (a) Flow cytometry analysis of iOPs and hMSCs revealed that the cells were positive for mesenchymal markers (CD29, CD44, CD90, CD105, and CD166) and negative for hematopoietic markers (CD14, CD31, and CD45) (black: CD marker expression, red: isotype control, and blue: unstained control). (b) Significantly ( P < 0.05) faster growth kinetics of the hOB-iOPs and hFB-iOPs, as compared to hOBs and hMSCs in either 20% serum-containing media or Xenofree StemPro media at all time points. (c) Differentiation time of hOB-iPSCs to iOPs was assayed using flow cytometry for mesenchymal cell markers, CD44 and CD105. (d) iOPs were found to have similar levels of osteogenic related genes, RUNX2, BMP2, osteocalcin, and COL1A1 as compared to hMSCs ∗ indicates significant difference from the hOB-iOPs ( P < 0.05). iOPs downregulated all pluripotency genes, Oct4, Sox2, Nanog, and hTERT indicating successful differentiations. ∗ indicates significant difference from the iPSC ( P < 0.05).

Article Snippet: All qPCR was performed with Taq-man probes (Thermofisher, Sox 2; Hs01053049_s1, Oct4 (POU5F1); Hs00999634_gH, NANOG; Hs04260366_g1, hTERT; Hs00972656_m1, BMP7; Hs00233476_m1, Actin A2; Hs00426835_g1, PPAR γ ; Hs01115513_m1, LEP; Hs00174877_m1, LPL; Hs00173425_m1, ADIPOQ; Hs00605917_m1, osteocalcin (BGLAP); Hs01587814_g1, Osteopontin (GZMB); Hs01554355_m1, RUNX2; Hs00231692_m1, BMP4; Hs03676628_s1, COMP; Hs00164359_m1, ACAN; Hs00153936_m1, COL10A1; Hs00166657_m1, Sendai Virus Detection; Mr04269876_mr, Mr04269878_mr, Mr04269879_mr, Mr04269880_mr, and Mr04269881_mr).

Techniques: Flow Cytometry, Marker, Expressing, Control