|
Thermo Fisher
gene exp serpine1 mm00435858 m1 Gene Exp Serpine1 Mm00435858 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pm41888509-123-11-4?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
gene exp serpine1 mm00435858 m1 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Huabio Inc
serpine1 Serpine1, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pm41751765-177-57-59?v=Huabio+Inc Average 86 stars, based on 1 article reviews
serpine1 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Proteintech
polyclonal antibody e Polyclonal Antibody E, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pm37827215-44-130-134?v=Proteintech Average 96 stars, based on 1 article reviews
polyclonal antibody e - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
OriGene
monoclonal mouse anti human pai 1 antibody Monoclonal Mouse Anti Human Pai 1 Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pm27313768-58-53-29?v=OriGene Average 90 stars, based on 1 article reviews
monoclonal mouse anti human pai 1 antibody - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
atccgtttgtgg cgatagcag Atccgtttgtgg Cgatagcag, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pm37830556-71-36-43?v=OriGene Average 91 stars, based on 1 article reviews
atccgtttgtgg cgatagcag - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Addgene inc
human serpine1 ![]() Human Serpine1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pmc09239148-194-7-10?v=Addgene+inc Average 93 stars, based on 1 article reviews
human serpine1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Biorbyt
anti serpine1 ![]() Anti Serpine1, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pmc09603323-118-19-20?v=Biorbyt Average 93 stars, based on 1 article reviews
anti serpine1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Proteintech
anti human serpine1 antibody Figure S6 and Anti Human Serpine1 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pmc12047530-3-0-6?v=Proteintech Average 93 stars, based on 1 article reviews
anti human serpine1 antibody - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Proteintech
pai 1 ![]() Pai 1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pmc12903979-209-31-36?v=Proteintech Average 94 stars, based on 1 article reviews
pai 1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Cusabio
dog plasminogen activator inhibitor 1 serpine1 elisa kit ![]() Dog Plasminogen Activator Inhibitor 1 Serpine1 Elisa Kit, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/10__17221_slash_16_slash_2025___vetmed-34-38-46?v=Cusabio Average 93 stars, based on 1 article reviews
dog plasminogen activator inhibitor 1 serpine1 elisa kit - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
OriGene
agcggctgtactgcaaaaacgg cctttgatagacacaactcctctc serpine1 serpine1 human qpcr primer pair ![]() Agcggctgtactgcaaaaacgg Cctttgatagacacaactcctctc Serpine1 Serpine1 Human Qpcr Primer Pair, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/10__32604_slash_biocell__2025__068743-153-65-73?v=OriGene Average 93 stars, based on 1 article reviews
agcggctgtactgcaaaaacgg cctttgatagacacaactcctctc serpine1 serpine1 human qpcr primer pair - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Atlas Antibodies
anti human serpine1 antibody ![]() Anti Human Serpine1 Antibody, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/serpine1/pmc08571331-153-7-10?v=Atlas+Antibodies Average 92 stars, based on 1 article reviews
anti human serpine1 antibody - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: mBio
Article Title: Serine Protease Inhibitors Restrict Host Susceptibility to SARS-CoV-2 Infections
doi: 10.1128/mbio.00892-22
Figure Lengend Snippet: The investigated serpins reduce SARS-CoV-2 infection by inhibition of TMPRSS2-mediated spike protein cleavage. (A) HEK-293T cells transfected with the indicated expression plasmids for 24 h were infected with SARS-CoV-2 (MOI = 0.1) for 6 h, and viral RNA was measured by qPCR. (B and C) Posttransfection (24 h) HEK293T cells were infected for 2 h (MOI = 1) and then trypsinized, washed with PBS, and lysed, and the RNA was extracted. Levels of viral RNA were quantified from cDNA synthesized with (B) random hexamers (C) or only the forward primer selectively quantifying the negative sense RNA. Data are cumulative of three independent experiments performed in triplicate; mean and SEM are shown, and statistical significance was calculated by unpaired t test (*, P < 0.05; **, P < 0.01; ***, P < 0.001). (D) Surface plasmon resonance analysis of TMPRSS2 binding to individual serpins. A 2-fold dilution series of TMPRSS2 ranging from 125 nM down to 7.8 nM over immobilized SERPINE1 with results shown as response units (RU). Binding kinetics for all serpins are summarized to the right, including the natural target for SERPINE1, tissue plasminogen activator (tPA), as a positive control. (E) TMPRSS2-mediated S-protein cleavage in the presence or absence of individual serpins and the known protease inhibitor nafamostat mesylate. Data from three independent experiments were quantified, and a representative blot is shown. (F) The intensity of bands in panel E corresponding to cleaved S-protein was quantified using ImageJ (Fuji) and normalized to S-protein and TMPRSS2 control. Mean values and SEM are shown; statistical significance was calculated by unpaired t test (*, P < 0.05; **, P < 0.01). (G) HBEC ALI cultures were preincubated apically with recombinant SERPINE1, SERPINA1, or SERPINC1 and infected with SARS-CoV-2 at an MOI of 0.05. The accumulated viral release from the apical side was quantified by qPCR at the indicated time points ( n = 3). Mean and SEM are shown; statistical significance was calculated by unpaired t test (*, P < 0.05; **, P < 0.01). (H) The concentrations of apically released SERPINA1 and SERPINE2 from HBEC ALI cultures from both group high and group low were determined by ELISA. The apical secretions were collected at three time points ( n = 3). Mean and SEM are shown; statistical significance was calculated by unpaired t test (***, P < 0.001).
Article Snippet: Expression plasmids encoding the precursor ectodomain of
Techniques: Infection, Inhibition, Transfection, Expressing, Synthesized, SPR Assay, Binding Assay, Positive Control, Protease Inhibitor, Control, Recombinant, Enzyme-linked Immunosorbent Assay
Journal: mBio
Article Title: Serine Protease Inhibitors Restrict Host Susceptibility to SARS-CoV-2 Infections
doi: 10.1128/mbio.00892-22
Figure Lengend Snippet: Single-cell RNA sequencing shows distinct expression patterns of serpins in primary lung cells. (A) Schematic illustration of cell types annotated in the single-cell RNA analysis of HBEC ALI cultures. (B) UMAP plot (bidimensional), colored by annotated cell clusters. (C) Coarse-grained graph showing mean cell cluster group expression for SERPINA1, SERPINE1, and SERPINE2. (D) Infection levels analyzed by qPCR and shown as fold increase over 12-h input. (E) Heatmap displaying the mean expression of SERPINA1, SERPINE1, and SERPINE2 upon SARS-CoV-2 infection (±, MOI = 0.05) in HBEC ALI cultures from a group high (H) and a group low (L) donor.
Article Snippet: Expression plasmids encoding the precursor ectodomain of
Techniques: RNA Sequencing, Expressing, Infection
Figure S6 and Journal: Cell Reports Medicine
Article Title: A spatially resolved transcriptome landscape during thyroid cancer progression
doi: 10.1016/j.xcrm.2025.102043
Figure Lengend Snippet: Cell-cell communications in thyroid cancer (A) Bubble plot illustrating the spatial correlations of dysregulated ligand-receptor pairs between PTC, LPTC, or ATC and PT samples in the ST data. (B and C) Bar plots showing fold changes in ligand (B) and receptor (C) expression in PTC, LPTC, and ATC samples compared to PT samples. (D) Spatial feature plots highlighting SERPINE1 (ligand) and PLAUR (receptor) expression in representative samples (PT-2, PTC-2, LPTC-2, and ATC-3). (E and F) Expression levels of SERPINE1 (E) and PLAUR (F) across various cell types. (G) SERPINE1 expression within fibroblasts, with the inset indicating enrichment of fibroblast subpopulations stratified by SERPINE1 expression levels. (H) PLAUR expression within macrophages, with the inset showing enrichment of macrophage subpopulations stratified by PLAUR expression levels. (I) Multiplex immunofluorescence staining for Fib-12 fibroblast markers ( CXCL8 , CXCL1 , and SERPINE1 ) and Mac-11 macrophages ( CXCL12 , STAB1 , and PLAUR ) in PTC, LPTC, and ATC samples. Scale bar: 40 μm. (J) Boxplot comparing SERPINE1 expression in cancer ( n = 58) versus paired NAT ( n = 58) samples from the TCGA thyroid carcinoma (THCA) cohort. (K) Kaplan-Meier survival curve from the TCGA THCA cohort ( n = 510) showing patient survival based on median SERPINE1 expression levels. See also
Article Snippet:
Techniques: Expressing, Multiplex Assay, Immunofluorescence, Staining
Journal: Cell Reports Medicine
Article Title: A spatially resolved transcriptome landscape during thyroid cancer progression
doi: 10.1016/j.xcrm.2025.102043
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Software
Journal: Advanced Science
Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1
doi: 10.1002/advs.202505256
Figure Lengend Snippet: EEAR prevents EMT and collagen deposition via the TGF‐β1/Smad2/3 pathway. The Beas‐2B cells pre‐incubated with EEAR for 1h, followed co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cell viabilities were assayed by MTT ( n = 5 per group). (B) qRT‐PCR assay for TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative western blots for TGF‐β1, p‐Smad2/3 and Smad2/3 protein expression and the quantification of TGF‐β1, p‐Smad2/3 and Smad2/3 western blots ( n = 3 per group). (D) Expression of α‐SMA protein was determined by western blot analysis ( n = 3 per group). (E) Fibronectin gene expression in the Beas‐2B cells was qualified by qRT‐PCR ( n = 3 per group). (F) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantitatives of Collagen I expression in Beas‐2B cells ( n = 3 per group). (G) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantitatives of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (H) Expression of MMP‐12, TIMP‐1, and PAI‐1 proteins were determined by western blot analysis ( n = 3 per group). (I) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.
Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig),
Techniques: Incubation, Quantitative RT-PCR, Expressing, Western Blot, Gene Expression, Migration, Control
Journal: Advanced Science
Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1
doi: 10.1002/advs.202505256
Figure Lengend Snippet: RA inhibits TGF‐β1‐induced EMT and collagen deposition by binding to TGF‐β1. (A) Binding affinity analysis of RA with TGF‐β1 was performed by SPR. (B) Binding affinity analysis of RA with TGF‐β1 was performed by CETSA assay ( n = 3 per group). (C) Molecular docking of RA with TGF‐β1 (1KLA) by MOE software. (D) The change of RMSD with time in a molecular dynamics simulation. (E) RMSF was calculated using the molecular dynamics simulation trajectory. (F) Binding free energies and energy components were predicted by MM/GBSA. 50 µg/mL RA was pre‐mixed with or without 5 ng/mL TGF‐β1 in vitro for 1 h, and then the mixture induced Beas‐2B cells for 24 h. (G) Immunoblotting analysis for TGF‐β1 protein and its ubiquitination levels ( n = 3 per group). (H) The TGF‐β1 mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (I) The TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I protein levels in Beas‐2B cells were detected by Immunoblotting analysis. (J) Quantification of TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I proteins western blots ( n = 3 per group). (K) The fibronectin mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (L) The changes of MMP‐2, MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells ( n = 3 per group). (M) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the TGF‐β1 group.
Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig),
Techniques: Binding Assay, Software, In Vitro, Western Blot, Ubiquitin Proteomics, Expressing, Quantitative RT-PCR, Migration, Control
Journal: Advanced Science
Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1
doi: 10.1002/advs.202505256
Figure Lengend Snippet: TGF‐β1 and its GlyA46 site are important targets for RA in inhibiting EMT and collagen deposition. Following plasmid transfection, Beas‐2B cells were treated with 50 µg/mL RA in the presence or absence of 5% CSE for 24 h. (A) Western Blot analysis of TGF‐β1 expression in TGF‐β1‐knockdown in Beas‐2B cells and quantification analysis ( n = 3 per group). (B) qPCR analysis of TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells with or without TGF‐β1 knockdown ( n = 3 per group). (D) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (E) and fibronectin (F) mRNA expression in Beas‐2B cells ( n = 3 per group). After plasmid transfection and mutation of specific amino acids to alanine, Beas‐2B cells were treated with 50 µg/mL RA for 24 h. (G) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells ( n = 3 per group). (H) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (I) and fibronectin (J) mRNA expression in Beas‐2B cells ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test, * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig),
Techniques: Plasmid Preparation, Transfection, Western Blot, Expressing, Knockdown, Migration, Mutagenesis
Journal: Advanced Science
Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1
doi: 10.1002/advs.202505256
Figure Lengend Snippet: RA prevents CSE‐induced EMT and collagen deposition via the TGF‐β1‐Smad2/3 pathway. The Beas‐2B cells were pre‐incubated with RA for 1 h, followed by co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cells viability was assayed by MTT ( n = 5 per group). (B) Representative western blots for α‐SMA, p‐Smad2/3, and Smad2/3 protein expression and the quantification of α‐SMA, p‐Smad2/3, and Smad2/3 western blots ( n = 3 per group). (C) The fibronectin mRNA expression in Beas‐2B cells was assessed by qRT‐PCR ( n = 3 per group). (D) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantification of Collagen I expression in Beas‐2B cells ( n = 3 per group). (E) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantification of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (F) The MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells were assessed by western blotting ( n = 3 per group). (G) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.
Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig),
Techniques: Incubation, Western Blot, Expressing, Quantitative RT-PCR, Migration, Control
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Western blot analysis. Affinity-purified glutathione- S -transferase (GST; lane 1) and GST-tagged full length SERPINE1 proteins (lane 2) were electrophoresed with sodium dodecyl sulfate–polyacrylamide (11%) gels, followed by staining with Coomassie Brilliant Blue. ( a ). Western blotting using anti-GST antibody ( b ) and anti-SERPINE1 antibody ( c ). Serum samples of patients with acute cerebral infarction (#7074) ( d ), a transient ischemic attack (#7096) ( e ), and of a healthy donor (#7021) ( f ). Electrophoresed molecular weight markers are also shown in ( a ) (lane M), and the sizes are shown in the left. The asterisk represents degradation products of SERPINE1 after electrophoresis. The number after # is the anonymized patient number and indicates which patient’s serum was used.
Article Snippet: The specimens were incubated with a monoclonal
Techniques: Western Blot, Affinity Purification, Staining, Molecular Weight, Electrophoresis
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Comparison of serum SERPINE1 antibody levels between the HDs and the ischemic groups. ( a ) Serum antibody levels against SERPINE1 protein quantified using amplified luminescence proximity homogeneous assay-linked immunosorbent assay (AlphaLISA) and compared between the HDs and the patients in the TIA, aCI, and cCI groups. The Alpha photon counts represent the antibody levels and are shown using a box-whisker plot. Horizontal lines represent medians, and boxes represent the 25th and 75th percentiles. Whiskers represent the 10th and 90th percentiles, and dots represent outliers. Differences were examined using Dunn’s multiple comparison test with type I error adjustment using the Bonferroni procedure. HDs, healthy donors; TIA, transient ischemic attack; aCI, acute cerebral infarction; cCI, chronic cerebral infarction; * p < 0.05; ** p < 0.001; n.s., not significant. The antibody level of SERPINE1 was analyzed on the basis of the receiver-operating characteristic (ROC) curve for comparison between TIA ( b ) and aCI ( c ). The numbers in the figures indicate the area under the curve (AUC), cutoff values, sensitivity, and specificity.
Article Snippet: The specimens were incubated with a monoclonal
Techniques: Comparison, Amplification, Whisker Assay
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Positive predictive value for TIA and aCI.
Article Snippet: The specimens were incubated with a monoclonal
Techniques:
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Spearman correlation analysis between the serum SERPINE1 antibody levels and clinical features.
Article Snippet: The specimens were incubated with a monoclonal
Techniques:
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Association between SERPINE1 antibody levels and clinical data. The associations between SERPINE1 antibody levels and clinical parameters such as old age ( a ); sex ( b ); hypertension ( c ), diabetes ( d ), hyperlipidemia ( e ), cardiovascular disease ( f ); body mass index (BMI) ( g ); history of smoking ( h ); and alcohol consumption ( i ) were examined. The SERPINE1 antibody levels determined using AlphaLISA are shown in the box-whisker plots. The p values were calculated using the Kruskal–Wallis test.
Article Snippet: The specimens were incubated with a monoclonal
Techniques: Whisker Assay
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Logistic regression analysis of the predictors of transient ischemic attack.
Article Snippet: The specimens were incubated with a monoclonal
Techniques:
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Logistic regression analysis of predictors of acute cerebral infarction.
Article Snippet: The specimens were incubated with a monoclonal
Techniques:
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Positive predictive value including the factors associated with the prediction of acute cerebral infarction.
Article Snippet: The specimens were incubated with a monoclonal
Techniques:
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Immunohistochemical staining for SERPINE1 in an arteriosclerotic plaque. Immunohistochemical staining of atherosclerotic plaques samples from nine patients at the Chiba Cerebral and Cardiovascular Center was performed. A representative case is presented here. These samples were obtained from a different cohort than that from which the sera were collected. Atherosclerotic plaque resected during carotid endarterectomy was immunostained using anti-CD31 ( a ) or anti-SERPINE1 antibodies ( b ). Arrows indicate vascular endothelial cells labeled with CD31 antibody, and correspondingly, SERPINE1 was stained by anti-SERPINE1 antibody.
Article Snippet: The specimens were incubated with a monoclonal
Techniques: Immunohistochemical staining, Staining, Labeling
Journal: Scientific Reports
Article Title: Serum anti-SERPINE1 antibody as a potential biomarker of acute cerebral infarction
doi: 10.1038/s41598-021-01176-8
Figure Lengend Snippet: Comparison of serum SERPINE1 antigen levels between the aCI and HDs groups. ( a ) Serum SERPINE1 antigen levels were examined using sandwich enzyme-linked immunosorbent assay in healthy donors and patients with acute cerebral infarction. The results are shown in a box-whisker plot. The p values were calculated using the Kruskal–Wallis test. ( b ) SERPINE1 antibody levels were plotted against SERPINE1 antigen levels in a scattered plot. The correlation coefficient ( r value) and p value were calculated using the Pearson product–moment correlation coefficient.
Article Snippet: The specimens were incubated with a monoclonal
Techniques: Comparison, Sandwich ELISA, Whisker Assay