Journal: Genes & Development

Article Title: Human nonsense-mediated RNA decay initiates widely by endonucleolysis and targets snoRNA host genes

doi: 10.1101/gad.246538.114

Figure Lengend Snippet: NMD-specific endonucleolytic cleavage sites are revealed by 5′ end-seq. ( A ) Schematic outline of the sample preparation steps for the massive parallel sequencing procedures used in this study (see the text and Supplemental Fig. S1 for details). ( B ) Northern blotting analysis of total RNA isolated from HEK293-β-39 cells depleted for the indicated factors. The Northern membrane was hybridized with a probe directed against the region shown in C . GAPDH levels were detected as an internal loading standard. ( C ) Overview of the stably integrated β-39 gene illustrating the sequencing data used in the analyses. From top to bottom , the tracks display (1) RNA-seq coverage over the major exons as well as leading and trailing intronic sequences determined from control, XRN1-depleted, SMG6/XRN1-depleted, and UPF1/XRN1-depleted samples (in all figures, data from the control, XRN1-depleted, SMG6/XRN1-depleted, and UPF1/XRN1-depleted samples are depicted in red, blue, green, and orange, respectively). (2) 5′-RACE-mapped 5′ end of the transcript (black; below RNA-seq axis). For all endogenous genes, 5′ ends were determined by CAGE. (3) Schematic representation of the major exons expressed from the gene (exons and intronic sequences are represented as light-green boxes and red lines, respectively; see the Materials and Methods for details). The position of the probe used for Northern blotting is shown as a black bar above the transcript model. The PTC is indicated by a vertical dashed line. (4) 5′ end-seq-determined 5′ end signals displayed in individual tracks but on the same scale for control, XRN1-depleted, SMG6/XRN1-depleted, and UPF1/XRN1-depleted samples. To allow simultaneous visualization of decapping and endocleavage peaks (indicated by black and purple arrowheads, respectively), the 5′ end-seq tracks were scaled up by a factor of 4 in the region covering exon 2 of the β-39 RNA (indicated by a gray rectangle and a magnifying glass). ( D ) Histogram showing total signal in the decapping peaks ( left ) and NMD-specific endocleavage sites ( right ). ( E , G ) As in C , but for the HNRNPH3 and GADD45A loci. The open triangle in G indicates a transcript 5′ end determined by CAGE for which no decapping signal was detected. ( F ) Histogram showing the RNA-seq coverage over the exon–exon junctions indicated in E . ( H ) As in B , but the membranes were hybridized with probes directed against HNRNPH3 ( top panel) and GADD45A ( bottom panel) RNA species (see E and G for positions of probes). See also Supplemental Figure S2.

Article Snippet: Spike-in RNAs were added to 10 µg of purified total RNA and subjected to an RNA ligation reaction with 50 pmol of RNA adapter (sequence, ACACUCUUUCCCUACACGACGCUCUUCCGAUCU; 20 U of T4 RNA Ligase 1 [New England Biolabs], 5% [w/v] PEG-8000, 1 mM ATP, 10 U of RiboLock [Fermentas] in a total volume of 25 µL of reaction buffer).

Techniques: Sample Prep, Sequencing, Northern Blot, Isolation, Stable Transfection, RNA Sequencing Assay

Journal: Translational oncology

Article Title: Circulating Exosomal miR-17-5p and miR-92a-3p Predict Pathologic Stage and Grade of Colorectal Cancer.

doi: 10.1016/j.tranon.2017.12.012

Figure Lengend Snippet: Figure 3. MiRNA expressions profiles of exosomes. (A) Profiling of small RNAs in exosome samples. (B) A Venn diagram showing the co-expressed and specifically expressed miRNAs in exosomes. (C) Heat map of sequencing results. Gene expression data obtained using next-generation sequencing on the Illumina HiSeq 2500 platform. P b .05 and fold change N 2 were considered significant

Article Snippet: Libraries were then amplified and sequenced ing HiSeq Rapid SBS Kit V2 (50 cycles) and HiSeq Rapid SR luster Kit V2 at the HiSeqTM 2500 system (Illumina). mall RNA Sequence Analysis Obtained sequences were aligned with sequences in database iRBase) to verify known miRNAs.

Techniques: Sequencing, Gene Expression, Next-Generation Sequencing

Journal: Molecular Therapy. Methods & Clinical Development

Article Title: Universal Template-Assisted, Cloning-free Method for the Generation of Small RNA-Expressing Dumbbell-Shaped DNA Vectors

doi: 10.1016/j.omtm.2019.08.008

Figure Lengend Snippet: Scheme for Universal Template (UT)-Assisted Cloning-free Dumbbell Production The universal DNA template is a 262-bp double-stranded DNA that comprises an inverted repeat of the 99-bp minimal H1 promoter (mH1), a polymerase III transcriptional terminator (T 5 ), and the hsa-miR-30 precursor stem. The inverted repeats are separated by four T’s (plus strand). The protocol for dumbbell generation and purification comprises four steps. Step 1: PCR amplification of the universal template using 5′ phosphorylated forward (Fw) and/or reverse (Rv) primers, both introducing either the antisense or sense strand of a shRNA together with half of the shRNA loop sequence; blocking oligos block 1 and block 2 are added into the reaction to suppress template refolding and to facilitate primer binding. Dotted lines represent plasmid sequences beyond the UT. Step 2: for dumbbell structure prefolding, the PCR product is diluted, heat-denatured, and slowly cooled down to room temperature. Step 3: dumbbell structures are covalently closed using a single-strand DNA ligase. Step 4: treatment with T7 DNA polymerase removes oligos and non-ligated dumbbell DNA, yielding covalently closed dumbbell vector DNA. Dotted arrows indicate transcribed sequences. All steps, cyan, (+) strand UT DNA; magenta, (−) minus strand UT DNA; gray, blocking oligos; green, shRNA sense (s) sequence; yellow, shRNA antisense (as) sequence.

Article Snippet: PCR amplification of the universal template and appendage of shRNA encoding DNA was carried out using 1 U Taq DNA polymerase (Invitrogen), 1.0 μM of each primer and blocking ODNs, 0.2 mM of each 2’-deoxyribonucleoside 5’-triphosphate (dNTP; Invitrogen), 100 ng of Hind III/ Bam HI cleaved pVax1-UT, 5% v/v DMSO (Thermo Fisher Scientific, Waltham, MA, USA) in a reaction volume of 30–50 μL in 1× Taq DNA polymerase buffer (Invitrogen).

Techniques: Cloning, Purification, Amplification, shRNA, Sequencing, Blocking Assay, Binding Assay, Plasmid Preparation