seq id Search Results


91
Thermo Fisher cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id
Cg06712013 Spats2 Atggttggagtagatgagat Acaccactacactccaccct Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

86
GenScript corporation seq id
Seq Id, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq id/product/GenScript corporation
Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Medicago seq id
Seq Id, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq id/product/Medicago
Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

91
Thermo Fisher cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id
Cg08913523 Na Ggttttgtgggttggaagttag Accaccccctccttcaacta Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

90
Carl Zeiss gxxx-fniii9-10 (seq id no:20)
Gxxx Fniii9 10 (Seq Id No:20), supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gxxx-fniii9-10 (seq id no:20)/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
gxxx-fniii9-10 (seq id no:20) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
MBL Life science cmv pp65 peptides for hla-a*02:01 or hla-a*24:02
Cmv Pp65 Peptides For Hla A*02:01 Or Hla A*24:02, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cmv pp65 peptides for hla-a*02:01 or hla-a*24:02/product/MBL Life science
Average 90 stars, based on 1 article reviews
cmv pp65 peptides for hla-a*02:01 or hla-a*24:02 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation recombinant hpv e6 proteins
Recombinant Hpv E6 Proteins, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant hpv e6 proteins/product/GenScript corporation
Average 90 stars, based on 1 article reviews
recombinant hpv e6 proteins - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation peptides siy (siyryygl)
Peptides Siy (Siyryygl), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/peptides siy (siyryygl)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
peptides siy (siyryygl) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation peptides asn (asnenmeth, from influenza a nucleoprotein)
Peptides Asn (Asnenmeth, From Influenza A Nucleoprotein), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/peptides asn (asnenmeth, from influenza a nucleoprotein)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
peptides asn (asnenmeth, from influenza a nucleoprotein) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TriLink lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3)
Lps Free 1018 Cpg Odn (5 Tgactgtgaacgttcgagatga 3), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3)/product/TriLink
Average 90 stars, based on 1 article reviews
lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Hybrigenics sa clone name type seq gene name (best match) start..stop (nt) frame sense %id 5p %id 3p
Clone Name Type Seq Gene Name (Best Match) Start..Stop (Nt) Frame Sense %Id 5p %Id 3p, supplied by Hybrigenics sa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/clone name type seq gene name (best match) start..stop (nt) frame sense %id 5p %id 3p/product/Hybrigenics sa
Average 90 stars, based on 1 article reviews
clone name type seq gene name (best match) start..stop (nt) frame sense %id 5p %id 3p - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10)
Two Udp Glycosyltransferase Sequences: Hv1 (Seq Id No:8) And Ugt76g1 (Seq Id No:10), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results