Journal: Cell & Bioscience

Article Title: An increase in Semaphorin 3A biases the axonal direction and induces an aberrant dendritic arborization in an in vitro model of human neural progenitor differentiation

doi: 10.1186/s13578-022-00916-1

Figure Lengend Snippet: Sema 3A activates the microglia proinflammatory M1 phenotype 48 h after transfection. A Representative immunofluorescence pictures of the percentage of microglia cells transfected with Sema 3A-GFP (Sema 3A) or GFP empty vector (GFP). As control, we used non-transfected microglia cells (Ctrl). Scale bar: 55 µm. 10 × objective. B ELISA assay on media from Sema 3A, GFP and Ctrl microglia 48 h after transfection. Sema 3A levels were expressed as ng/ml and normalized on the number of alive cells (mean ± SEM from 10 different fields) for each experimental point. Data are the mean ± SEM of three independent experiments performed in triplicate. ****P < 0.0001 vs Sema 3A media. C Extent of cell survival obtained by counting the number of DAPI positive nuclei before and after Sema 3A transfection as well as in GFP and Ctrl microglia. Data are the mean ± SEM of three independent experiments in quadruplicate. One-way ANOVA followed by Tukey’s test for multiple comparisons. ****P < 0.0001 vs Sema 3A. D Quantitative analysis of TMEM 119, Iba1, CD86, CD68, and E iNOS and TNFα positive cells. MFI was performed on the entire slide using Zeiss Celldiscoverer7. Values are normalized on the number of DAPI positive cells for each slide and expressed as % of Ctrl. Data are the mean ± SEM of three independent experiments performed in quadruplicate. One-way ANOVA followed by Tukey’s test for multiple comparisons. *P < 0.05; **P < 0.01; ***P < 0.001. Representative images of iNOS (red) and TNFα (red) and Sema 3A or GFP (green) staining are reported in F . Scale bar: 10 µm. 63 × objective

Article Snippet: Sema 3A protein levels in media from microglia overexpressing Sema 3A (Sema 3A media) or GFP (GFP media) or non-transfected (Ctrl media) were assessed using Elisa kit (ELISA, Cusabio, Houston, TX, USA #CSB-E15913h), according to the manufacturer instructions.

Techniques: Transfection, Immunofluorescence, Plasmid Preparation, Control, Enzyme-linked Immunosorbent Assay, Staining

Journal: Experimental eye research

Article Title: Expression of axon guidance ligands and their receptors in the cornea and trigeminal ganglia and their recovery after corneal epithelium injury

doi: 10.1016/j.exer.2022.109054

Figure Lengend Snippet: Antibodies used for immunofluorescence staining of trigeminal ganglia and cornea sections.

Article Snippet: Semaphorin3A , Rabbit , 1:300 , all , Proteintech 21925 , Donkey anti rabbit Cy3 , 1:400 , Jackson Immunoresearch 711-025-152.

Techniques: Immunofluorescence, Staining

Journal: Experimental eye research

Article Title: Expression of axon guidance ligands and their receptors in the cornea and trigeminal ganglia and their recovery after corneal epithelium injury

doi: 10.1016/j.exer.2022.109054

Figure Lengend Snippet: Basal and post-injury expression of axon guidance proteins in mouse cornea. Mice were subjected to corneal epithelium debridement, and the expression of these proteins was followed up in a time-dependent manner. All of these proteins are well-expressed in the uninjured cornea. After debridement, they quickly recovered, and their expression was visible from day 3 to day 14 post-injury. When compared to uninjured corneas, EphrinB1 was highly expressed at all post-injury days, while EphrinB2 and Sema3A where highly expressed from day 7 to day 14. The expression of Sema3F, Netrin-1 and Netrin-4 at day 14 was similar to the basal conditions. Quantification of immunostaining described in Methods is shown in the graphs. Representative images of the central debrided cornea, n = 3 mice per time point. Scale bar = 50 μm.

Article Snippet: Semaphorin3A , Rabbit , 1:300 , all , Proteintech 21925 , Donkey anti rabbit Cy3 , 1:400 , Jackson Immunoresearch 711-025-152.

Techniques: Expressing, Immunostaining

Journal: Experimental eye research

Article Title: Expression of axon guidance ligands and their receptors in the cornea and trigeminal ganglia and their recovery after corneal epithelium injury

doi: 10.1016/j.exer.2022.109054

Figure Lengend Snippet: Variable gene expression recovery of axon guidance proteins in injured mouse cornea. Mouse corneal epithelium was harvested from uninjured mice corneas or animals that received cornea epithelium debridement. Gene expression was analyzed as described in Materials and Methods. We found that 3 days after injury, only the expression of EphrinB2 was significantly upregulated, while all other axon guidance ligands were downregulated. At later time points, Sema3A, EphrinB1, and EphrinB2 were upregulated as well, while Sema3F, Netrin-1 and Netrin-4 were downregulated. In general, all of these proteins trend to normalize their expression to the basal level, and only EphrinB1 was still showing high level of expression after 4 weeks post-injury. N = 5 mice per time point. * = p < 0.05.

Article Snippet: Semaphorin3A , Rabbit , 1:300 , all , Proteintech 21925 , Donkey anti rabbit Cy3 , 1:400 , Jackson Immunoresearch 711-025-152.

Techniques: Gene Expression, Expressing

Journal: Experimental eye research

Article Title: Expression of axon guidance ligands and their receptors in the cornea and trigeminal ganglia and their recovery after corneal epithelium injury

doi: 10.1016/j.exer.2022.109054

Figure Lengend Snippet: Axon guidance proteins accelerated corneal epithelial wound closure. Human corneal limbal epithelial (HCLE) cells were grown to confluency on a 24-well plate and then a scratch was performed using a scratcher tip as described in Methods. Cells were then treated with recombinant Sema3A, EphrinB2, Netrin-4 or left untreated as control. Cells were immediately placed in a chamber incubator on a microscope and images were collected every 20 min for 15 h and analyzed using Fiji software. All the axon guidance proteins accelerated the wound closure when compared to control. (A) Representative images of scratch area. Sema3A (B) and EphrinB2 (C) induced faster healing with complete closure at 8 h, while Netrin-4 (D) did at 10 h, still faster than control. Each treatment was performed in triplicate and 3 images were obtained per treatment. Experiments were performed three times. Scale bar = 400 μm. * = p < 0.05; ** = p < 0.01. Values are mean ± S.E.M.

Article Snippet: Semaphorin3A , Rabbit , 1:300 , all , Proteintech 21925 , Donkey anti rabbit Cy3 , 1:400 , Jackson Immunoresearch 711-025-152.

Techniques: Recombinant, Control, Microscopy, Software

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Highly expressed Sema3C is correlated with stemness features in HCC. a Identification of Sema3C with integrative analysis of public datasets, including genes up-regulated in both cirrhosis and HCC (GSE14323 and GSE6764) and in sorafenib-resistant HCC xenografts (GSE121153). b Correlation analysis between Sema3C expression and pathological stage. c The expression of Sema3C in peripheral blood of HCC patients and healthy individuals was determined by ELISA, n = 5. d Kaplan‒Meier survival analysis for overall survival in TCGA-LIHC dataset based on Sema3C median expression. e qRT-RCR analysis of Sema3C expression in DEN+CCl 4 -induced HCC model at various stages. 8w indicates normal liver, 16-19w indicates fibrotic liver, and 22w indicates HCC. f IF staining for Sema3C and EpCAM in DEN+CCl 4 -induced HCC tissues (22w). Cell nuclei were counterstained with DAPI. Scale bar, 50 μm. g The mRNA and protein expression of Sema3C in sorafenib-sensitive and sorafenib-resistant Huh7 and HepG2 cells. h Sema3C is highly upregulated in non-differentiated HCC cell lines compared to differentiated HCC cell lines from the GSE36133 database. i Correlation between Sema3C expression and stemness-associated genes in HCC using the HCCDB datasets. The dots in the figure indicate p < 0.05. The color intensity and size of the circle are proportional to the correlation coefficients. j Expression of Sema3C in EpCAM - and EpCAM + cells from the GSE5975 database. k Cumulative relapse event analysis to predict HCC recurrence based on Sema3C median expression from the GSE14520 dataset. Kaplan‒Meier survival analysis for overall survival in TCGA-LIHC dataset based on Sema3C expression and OCT4 + ( l ) or SOX9 + ( m ) expression, respectively. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Expressing, Enzyme-linked Immunosorbent Assay, Staining

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C promotes HCC stemness and initiation. a Sema3C protein expression levels in various HCC cell lines, hepatic stellate cells (LX-2) and normal liver cells (MIHA) were detected by Western blotting. b Sema3C protein expression levels were determined by Western blotting in Sema3C overexpressed and knockdown HCC cells. c Sema3C mRNA expression level in spheroids and non-spheroids cells of HepG2 and Huh7 cells. d The mRNA expression of stemness-associated genes in Sema3C-overexpressing HCC and control cells was determined by qRT-PCR analysis. The effect of Sema3C overexpression ( e ) or knockdown ( f ) on HCC cell chemoresistance was assessed by an MTT assay. The effect of Sema3C overexpression ( g ) or knockdown ( h ) on HCC cells self-renewal was evaluated by sphere formation assay. Scale bar, 100 μm. i Limiting dilution assay was conducted using HepG2 cells with Sema3C knockdown (shSema3C) or Hep3B cells infected with lentivirus-OE-Sema3C or empty vector in BALB/c nude mice (n = 5 per group). Student’s t test was used for comparing two groups and extreme limiting dilution analysis (ELDA) was used for limiting dilution assay. OE overexpression, NC nontarget control. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Expressing, Western Blot, Knockdown, Control, Quantitative RT-PCR, Over Expression, MTT Assay, Tube Formation Assay, Limiting Dilution Assay, Infection, Plasmid Preparation

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C drives HCC initiation via a dysregulated AKT/Gli1/c-Myc signaling axis. a KEGG pathway analysis found Sema3C to be highly correlated with PI3K-AKT signaling in HCC patients based on the TCGA-LIHC database. b GSEA identified an enrichment of genes involved in PI3K/AKT and Hedgehog signaling pathways in the high-Sema3C-expressing HCC group. c Western blotting analyses of the β-catenin and phosphorylated-YAP levels in Sema3C-overexpressing MHCC-97L cells. d The mRNA expression of Gli1, Gli2, c-Myc , and CCND1 in MHCC-97L cells transfected with OE-Sema3C or vector control and HepG2 cells transfected with sh-Sema3C or NC. e The protein expression levels of total AKT, p-AKT, Gli1, and c-Myc in MHCC-97L cells and HepG2 cells. Sema3C-overexpressing Hep3B and MHCC-97L cells were treated with MK2206 (AKT inhibitor) as indicated, and the cell viability was analyzed by an MTT assay ( f ), the ability of self-renewal was determined by a sphere formation assay, scale bar, 100 μm ( g ); the levels of Gli1, p-AKT, AKT, and c-Myc were determined by western blotting ( h ). i H&E and IHC staining for Ki67, c-Myc, p-AKT (Ser473) and Gli1 in HepG2 xenograft tumors. NC nontarget control; H&E hematoxylin-eosin; IHC immunohistochemistry; Data are presented as means ± SD. ns, not significantly; *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Protein-Protein interactions, Expressing, Western Blot, Transfection, Plasmid Preparation, Control, MTT Assay, Tube Formation Assay, Immunohistochemistry

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C drives stemness maintenance and signaling via NRP1 and ITGB1. a Scheme displaying the procedure used for identifying the potential receptors that can bind to Sema3C and NRP1. b Co-IP analysis for validation of ITGB1 as a binding protein of Sema3C or NRP1 in Huh7 cells. c NRP1 and ITGB1 were knocked down in Huh7 cells respectively, and the interaction between Sema3C, NRP1 and ITGB1 was detected by Co-IP. d ITGB1 expression was detected in HCC cells when Sema3C was overexpressed or knocked down. e Correlation between ITGB1 expression and stemness-associated genes in HCC using the HCCDB datasets. The dots in the figure indicate p < 0.05. The color intensity and size of the circle are proportional to the correlation coefficients. f The expression levels of ITGB1 were determined by western blotting in ITGB1 knockdown Huh7 cells. Huh7 cells transfected with siITGB1. The chemoresistant effect was investigated by an MTT assay ( g ). The ability of self-renewal was determined by a sphere formation assay, scale bar, 100 μm ( h ). i Limiting dilution assay of Huh7 cells with or without ITGB1 knockdown (shITGB1) in BALB/c nude mice (n = 5 per group). Huh7 cells were transfected with OE-Sema3C or siITGB1. The chemoresistant effect was investigated by an MTT assay ( j ). The ability of self-renewal was determined by a sphere formation assay, scale bar, 100 μm ( k ). The protein expression levels of Gli1, p-AKT, AKT, and c-Myc were validated by western blotting ( l ). m Kaplan–Meier survival analysis for overall survival of HCC patients segregated according to high or low gene signatures for Sema3C + NRP1 + ITGB1. Co-IP Coimmunoprecipitation. OE overexpression. NC nontarget control. Data are presented as means ± SD. ns, not significantly *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Co-Immunoprecipitation Assay, Biomarker Discovery, Binding Assay, Expressing, Western Blot, Knockdown, Transfection, MTT Assay, Tube Formation Assay, Limiting Dilution Assay, Over Expression, Control

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C is involved in the ECM remodeling and induces the HSCs activation. a GO analysis based on intersection proteins binding to Sema3C and NRP1. b Representative images of collagen gel contraction assays with MHCC-97L cells in either MHCC-97L supernatants or OE-Sema3C-MHCC-97L supernatants. Graph quantifying the change in the percentages of gel contraction by MHCC-97L cells in different conditions. Scale bar, 5 mm. c Representative images showing H&E, Masson’s trichrome and picrosirius red staining, and IHC staining for α-SMA and collagen I expression in serial sections of orthotopic liver xenograft tumors of BALB/C nude mice injected with MHCC-97L-Vector or MHCC-97L-OE-Sema3C cells. Gross tissue image scale bar, 1 cm, microscope image scale bar, 200 μm. d Percent of collagen fibers and α-SMA per field were counted in at least three random fields per animal, (n = 5). e Representative immunofluorescence images for α-SMA and collagen I in HSCs treated with dosage rhSema3C or supernatants of different Sema3C expression levels. Scale bar, 50 μm. LX-2 cells were treated with a gradient dose of rhSema3C or supernatants from Sema3C-overexpressed Hep3B and MHCC-97L cells. The α-SMA expression levels were detected by western blotting analysis ( f ). The TGF-β1 secretion was examined by ELISA assay ( g ). The chemoresistance ability was reflected by an MTT assay ( h ). The ability of migration and invasion was performed by Transwell assays, scale bar, 200 μm ( i ). 5 × 10 5 Hep3B cells or OE-Sema3C Hep3B cells were injected subcutaneously into nude mice alone or mixed with LX-2 cells in a 1:1 ratio. The mice were sacrificed, and the xenograft tumors were excised 32 days after inoculation ( j ). The bar chart showed the tumor weight in each treatment group ( k ). The tumor volumes were monitored for 32 days ( l ). n = 5 per group. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Activation Assay, Binding Assay, Staining, Immunohistochemistry, Expressing, Injection, Plasmid Preparation, Microscopy, Immunofluorescence, Western Blot, Enzyme-linked Immunosorbent Assay, MTT Assay, Migration

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: IL-6 and cholesterol biosynthesis are responsible for Sema3C-mediated HSCs activation. a The volcano map showed the differentially expressed genes of LX-2 cells treated with rhSema3C or PBS in vitro. HSCs were treated with rhSema3C or supernatants of MHCC-97L cells with different Sema3C expression levels. mRNA levels of IL6 and IL8 were detected using qRT-PCR ( b ). ELISA was used to examine the IL6 secretion level ( c ). d GSEA identified an enrichment of genes involved in the NF-κB pathway in rhSema3C-treated LX-2 cells. e Western blotting showed phosphorylated and total p65 protein expression levels in LX-2 cells treated with rhSema3C. LX-2 cells were pre-treated with Bay 11-7082 and subsequently stimulated with rhSema3C, the levels of phosphorylated p65, total p65, and α-SMA expression were determined by western blotting ( f ), and IL6 secretion levels were examined by ELISA assay ( g ). h LX-2 cells were treated with OE-Sema3C-Hep3B cell-derived supernatants, Co-IP assay was used to detect the interaction between ITGB1 and NRP1. LX-2 cells were transfected with siNRP1 and subsequently stimulated with rhSema3C, IL6 secretion levels were detected by ELISA ( i ). The phosphorylated p65, total p65, α-SMA, and HMGCR expression levels were determined by using western blotting ( j ). k LX-2 cells were treated with a dosage of rhSema3C or supernatants of Sema3C-overexpressed HCC cells, and ITGB1 protein expression was determined by western blotting. LX-2 cells were transfected with siITGB1 and subsequently stimulated with rhSema3C, and the IL6 secretion levels were detected by ELISA assay ( l ), the phosphorylated p65, total p65, and α-SMA expression levels were determined by using Western blotting ( m ). LX-2 cells were treated with siNRP1, siITGB1 or rhSema3C as indicated, the secretion of TGF-β1 in each group was detected by ELISA ( n ), the chemotherapy resistance of LX-2 cells was evaluated by MTT assay ( o ), and migration and invasion were performed by Transwell assay, scale bar, 200 μm ( p ). rhSema3C recombinant human Sema3C; Data are presented as means ± SD. ns not significantly; *P < 0.05, **P < 0.01, and ***P < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Activation Assay, In Vitro, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot, Derivative Assay, Co-Immunoprecipitation Assay, Transfection, MTT Assay, Migration, Transwell Assay, Recombinant

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C expression is closely correlated with CAFs in HCC and is mediated by CAFs-derived TGF-β1. a Correlation between Sema3C expression and CAFs-associated genes ( ACTA2, VIM, FAP, PDGFRB , and S100A4 ) and collagen-associated genes ( COL1A1, COL1A2, FLNA, ELN , and LOX ) in HCC using the HCCDB datasets. The dots in the figure indicate p < 0.05. The color intensity and size of the circle are proportional to the correlation coefficients. b Representative images of IF staining for low or high Sema3C expression (red) with different degrees of stromal infiltration (α-SMA-green) in HCC tissues or DEN+CCl 4 -induced mouse liver tissues. Cell nuclei were stained with DAPI (blue). c The correlation analysis revealed a positive correlation between high Sema3C expression and the stromal percentage in patients with HCC (total n = 27). d TCGA-LIHC analysis of the correlation between patients with T stage or stage and FAP high /Sema3C low or FAP high /Sema3C high in HCC. e Western blotting showed that treatment with CAFs-conditioned media (CAFs-CM) significantly increased Sema3C expression compared with the control in HCC cells. f AP1 (including c-Jun/c-Fos) transcriptional binding sites in the Sema3C gene promoter. g , h MHCC-97L and Huh7 cells were transfected with si-c-Fos or si-c-Jun as indicated and the levels of Sema3C, c-Fos, and c-Jun were validated by western blotting. i ChIP-qPCR analysis showed that TGF-β1 stimulation facilitated the binding of phosphorylated c-Jun (p-c-Jun) and phosphorylated c-Fos (p-c-Fos) to the Sema3C gene promoter. j The levels of Sema3C, phosphorylated c-Jun (p-c-Jun), total c-Jun, p-c-Fos, and total c-Fos in MHCC-97L and Huh7 cells treated with different concentrations of TGF-β1 were determined by using western blotting. k Western blotting indicated that TGF-β1-induced Sema3C expression and AP1 signal activation could be inhibited by galunisertib (TGF-β1 receptor type I Inhibitor). l , m Western blotting confirmed that galunisertib and the TGF-β1 neutralizing antibody (anti-TGF-β1) inhibited the Sema3C upregulation stimulated by treatment with CAFs-CM. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Expressing, Derivative Assay, Staining, Western Blot, Control, Binding Assay, Transfection, ChIP-qPCR, Activation Assay

Journal: Signal Transduction and Targeted Therapy

Article Title: Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression

doi: 10.1038/s41392-024-01887-0

Figure Lengend Snippet: Sema3C inhibition enhances sorafenib efficacy in HCC mouse model. a Diagram demonstrated the time point of DEN+CCl 4 -induced mouse HCC model and treatment mode. b The mouse livers from the indicated groups were removed after 26 weeks, and the protein expression of Sema3C was detected by western blotting. c Representative images of mouse liver tissue from the indicated groups at 26 weeks (n = 5 per group), scale bar, 1 cm. Liver/body weight ( d ), tumor number ( e ), and maximal size of tumor of the indicated groups ( f ). g Kaplan–Meier survival curve showing percentage of overall survival of each annotated group (n = 8). h H&E, IHC staining and statistical analysis for Ki67, Collagen I, and EpCAM in HCC tumors harvested from the 4 treatment groups (n = 5 per group). Scale bar, 100 μm. i Schematic diagram showing that Sema3C mediates the interaction between CSCs and stroma in HCC. H&E hematoxylin-eosin, IHC immunohistochemistry; Data are presented as means ± SD. ns, not significantly; *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: To verify the effect of TGF-β1 on Sema3C expression in HCC, 1 μg/mL anti-TGF-β1 antibody or an IgG control (Proteintech, China) was added to the CM of CAFs and incubated at room temperature for 1 h. The treated CM was then used to co-culture with the corresponding HCC cells.

Techniques: Inhibition, Expressing, Western Blot, Immunohistochemistry

Journal: Frontiers in Immunology

Article Title: The involvement of the primo vascular system in local enteritis and its modification by electroacupuncture

doi: 10.3389/fimmu.2022.1072996

Figure Lengend Snippet: Validating the reliability of the sequencing data (n = 3 per group). Representative protein levels of TAP binding protein (TAPBP), toll-like receptor 2 (TLR2), semaphorin 4D (SEMA4D), jagunal homolog 1 (JAGN1), tumor necrosis factor receptor superfamily member 5 (CD40), anti- receptor-type tyrosine-protein phosphatase C (CD45), anti- lysosomal associated membrane protein 1 (LAMP1), HLA (RLA) class II histocompatibility antigen DR alpha chain (HLA-DRA1), and fibrinogen like 1 (FGL1) were detected in the PVS tissues by western blotting. Data were expressed as mean ± SD. Statistical analysis was performed using an unpaired Student’s t-test. * P < 0.05, ** P < 0.01, vs. control group.

Article Snippet: After being incubated in Tris-buffered saline containing 0.1% Tween-20 (TBST) with 5% nonfat milk for 1 h, the membranes were infiltrated with anti-tubulin-α antibody (Proteintech 66031-1-Ig, diluted 1:3000), anti-tumor necrosis factor receptor superfamily member 5 (CD40) antibody (Abclonal A0218, diluted 1:1000), anti-receptor-type tyrosine-protein phosphatase C (CD45) (Huabio ER1901-29, diluted 1:1000), anti-HLA (RLA) class II histocompatibility antigen DR alpha chain (HLA-DRA1) antibody (Abclonal A10863, diluted 1:1000), anti-TAP binding protein (TAPBP) antibody (Abclonal 13357, diluted 1:1000) anti-toll-like receptor 2 (TLR2) antibody (Abclonal A2545, diluted 1:1000), anti-semaphorin 4D (SEMA4D) antibody (Abclonal A10136, diluted 1:1000), anti-fibrinogen like 1 (FGL1) antibody (Abclonal A20335, diluted 1:1000), anti-jagunal homolog 1 (JAGN1) antibody (Santa Cruz sc-515306, diluted 1:1000), and anti-lysosomal associated membrane protein 1 (LAMP1) antibody (CST 9091, diluted 1:1000), respectively, overnight at 4°C.

Techniques: Sequencing, Binding Assay, Membrane, Western Blot, Control

Journal: Biomolecules

Article Title: Semaphorin 4A Maintains Trophoblastic Function via Activating the STAT3 Pathway.

doi: 10.3390/biom14070826

Figure Lengend Snippet: Figure 1. Expression and mechanism of SEMA4A in villus tissue of missed abortion. (A) The content of SEMA4A in missed abortion villi was less than that in normal pregnancy villi. (B) Molecular mechanism of SEMA4A in missed abortion trophoblastic cells: SEMA4A inhibits bcl-2, MMP9 and promotes BAX by inhibiting p-STAT3 pathway. (C) Effect of SEMA4A on trophoblast function in missed abortion: SEMA4A promotes apoptosis and inhibits proliferation and migration of missed abortion trophoblast cells.

Article Snippet: Subsequently, the samples were subjected to incubation with a primary rabbit anti-human SEMA4A antibody (1:50, Proteintech, Wuhan Proteintech Biotechnology Co., Ltd. of Wuhan, China) for an overnight period at a temperature of 4 ◦C.

Techniques: Expressing, Migration

Journal: Biomolecules

Article Title: Semaphorin 4A Maintains Trophoblastic Function via Activating the STAT3 Pathway.

doi: 10.3390/biom14070826

Figure Lengend Snippet: Figure 2. The expression of SEMA4A in human villous tissues from the MA and the control groups. (A,B) Relative expression levels of SEMA4A protein normalized to β-Actin in the MA (n = 18) and control groups (n = 18) by Western blotting. (C,D) Immunohistochemical staining of SEMA4A in villous tissues from the MA (n = 5) and control (n = 5) groups. Black arrow: SEMA4A distribution region. The negative control was the control group. Data represent mean ± SD. Scale bars: 100 µm. ** p < 0.01. Original Western blot images are available in Supplementary Materials.

Article Snippet: Subsequently, the samples were subjected to incubation with a primary rabbit anti-human SEMA4A antibody (1:50, Proteintech, Wuhan Proteintech Biotechnology Co., Ltd. of Wuhan, China) for an overnight period at a temperature of 4 ◦C.

Techniques: Expressing, Control, Western Blot, Immunohistochemical staining, Staining, Negative Control

Journal: Biomolecules

Article Title: Semaphorin 4A Maintains Trophoblastic Function via Activating the STAT3 Pathway.

doi: 10.3390/biom14070826

Figure Lengend Snippet: Figure 4. SEMA4A decreased HTR-8/SVneo cell apoptosis. (A–C) SEMA4A overexpression and knockdown were confirmed by qRT-PCR (n = 3) and Western blot (n = 3) analysis. (D–I) Repre- sentative expression of qRT-PCR (n = 3) and Western blot (n = 3) analysis for bcl-2 and BAX in HTR-8/SVneo cells. (J,K) The ratio of apoptotic cells (n = 3). (A,D,G) Different groups of HTR- 8/SVneo are presented on the y-axis for the qRT-PCR; the mean ± SD of 2−∆∆Ct for each group is presented on the x-axis for the qRT-PCR. Data represent mean ± SD. * p < 0.05; ** p < 0.01; *** p < 0.001. The experiment was repeated three times. Original Western blot images are available in Supplementary Materials.

Article Snippet: Subsequently, the samples were subjected to incubation with a primary rabbit anti-human SEMA4A antibody (1:50, Proteintech, Wuhan Proteintech Biotechnology Co., Ltd. of Wuhan, China) for an overnight period at a temperature of 4 ◦C.

Techniques: Over Expression, Knockdown, Quantitative RT-PCR, Western Blot, Expressing

Journal: Biomolecules

Article Title: Semaphorin 4A Maintains Trophoblastic Function via Activating the STAT3 Pathway.

doi: 10.3390/biom14070826

Figure Lengend Snippet: Figure 5. SEMA4A increased HTR-8/SVneo cell proliferation and migration. (A,B) CCK-8 assay (n = 3) was conducted to analyze the proliferation of SEMA4A-overexpressed/silenced HTR-8/SVneo cells. (C,D) Wound healing scratches (n = 3) were imaged immediately and 24 h after initial scratch time to quantify relative migration. (E,F) The Transwell migration (n = 3) assay was used to test the ability of cells to migrate. Scale bar = 200 µm. Data represent mean ± SD. * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: Subsequently, the samples were subjected to incubation with a primary rabbit anti-human SEMA4A antibody (1:50, Proteintech, Wuhan Proteintech Biotechnology Co., Ltd. of Wuhan, China) for an overnight period at a temperature of 4 ◦C.

Techniques: Migration, CCK-8 Assay

Journal: Biomolecules

Article Title: Semaphorin 4A Maintains Trophoblastic Function via Activating the STAT3 Pathway.

doi: 10.3390/biom14070826

Figure Lengend Snippet: Figure 6. Effect of SEMA4A on p-STAT3/STAT3 and MMP9 in trophoblast. (A,B) Representative images and bar graph of Western blot (n = 3) analysis for p-STAT3/STAT3 in HTR-8/SVneo cells. (A,C,D) MMP-9 mRNA and protein expression in HTR-8/SVneo cells transfected with SEMA4A siRNAs or SEMA4A overexpression vectors by qRT-PCR (n = 3) and Western blot (n = 3) analysis. (C) Different groups of HTR-8/SVneo are presented on the y-axis for the qRT-PCR; the mean ± SD of 2−∆∆Ct for each group is presented on the x-axis for the qRT-PCR. * p < 0.05; ** p < 0.01. Original Western blot images are available in Supplementary Materials.

Article Snippet: Subsequently, the samples were subjected to incubation with a primary rabbit anti-human SEMA4A antibody (1:50, Proteintech, Wuhan Proteintech Biotechnology Co., Ltd. of Wuhan, China) for an overnight period at a temperature of 4 ◦C.

Techniques: Western Blot, Expressing, Transfection, Over Expression, Quantitative RT-PCR

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Mass Spectrometry, Control, Flow Cytometry, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Transfection, Control, Plasmid Preparation, Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: RNA Sequencing, Biomarker Discovery, Over Expression

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Over Expression, Control, Protein-Protein interactions, Immunoprecipitation, Western Blot, Functional Assay, Biomarker Discovery, Transfection, Plasmid Preparation, Migration, shRNA, Luciferase

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: In Vitro, Biomarker Discovery, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Inhibition, Over Expression, Expressing, Western Blot

Journal: Frontiers in Immunology

Article Title: Integrative analysis of semaphorins family genes in colorectal cancer: implications for prognosis and immunotherapy

doi: 10.3389/fimmu.2025.1536545

Figure Lengend Snippet: Potential agents for patients with high SRS. (A) Identification of significantly activated pathways in the SRS-high group using the GSEA algorithm. (B) Predicting oxaliplatin sensitivity to assess the computational algorithm’s feasibility. (C, D) Analyzing correlation and differences in drug sensitivity for potential candidates from the CTRP and PRISM datasets. (E–H) Conducting molecular docking studies between SEMA4C and the compounds tanespimycin, clofarabine, nutlin-3, and LGX818.

Article Snippet: Membranes were blocked using 5% skim milk in TBST and incubated with primary antibodies against SEMA4C (1:3000, Cat. no: 28402-1-AP; Proteintech) and β-actin (1:1000, Cat. no: TA09; OriGene Technologies, Inc.).

Techniques:

Journal: Frontiers in Immunology

Article Title: Integrative analysis of semaphorins family genes in colorectal cancer: implications for prognosis and immunotherapy

doi: 10.3389/fimmu.2025.1536545

Figure Lengend Snippet: Verification of the tumor-promoting effect of SEMA4C in CRC. (A) Western blot analysis of SEMA4C expression in HT29 and SW480 cell lines. (B, C) CCK-8 and colony formation assays were conducted to evaluate the impact of SEMA4C downregulation on the proliferation and viability of HT29 and SW480 cell lines. (D–F) Transwell assays were performed to evaluate the influence of SEMA4C downregulation on the cell migration and invasion. (G) Impact of SEMA4C downregulation on the cell apoptosis was analyzed by flow cytometry assay. (*: P < 0.05; **: P < 0.01; ***: P < 0.001).

Article Snippet: Membranes were blocked using 5% skim milk in TBST and incubated with primary antibodies against SEMA4C (1:3000, Cat. no: 28402-1-AP; Proteintech) and β-actin (1:1000, Cat. no: TA09; OriGene Technologies, Inc.).

Techniques: Western Blot, Expressing, CCK-8 Assay, Migration, Flow Cytometry