sams 1 Search Results


93
Proteintech mat1a antibody
Expression levels of CBS, ALDH2, AHCY, <t>MAT1A</t> and MTHFR proteins in liver tissues of rats in each group. (A) Expression levels of MAT1A protein in liver tissues of rats in each group (n = 3); (B) Expression levels of AHCY protein in liver tissues of rats in each group (n = 3); (C) Expression levels of MYHFR protein in liver tissues of rats in each group (n = 3); (D) Expression levels of ALDH2 protein in liver tissues of rats in each group (n = 3); (E) Expression levels of CBS protein in liver tissues of rats in each group (n = 3). Note: Data are expressed as the mean ± SD. “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.
Mat1a Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sams+1/pmc12815877-65-42-44?v=Proteintech
Average 93 stars, based on 1 article reviews
mat1a antibody - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
OriGene mat1a 3 utr
Figure 1 miR-664, miR-485-3p, and miR-495 are induced in HCC and negatively regulate <t>MAT1A</t> expression in liver cancer cell lines. (A) Northern blot analysis showing expression of select miRNAs in HCC compared with adjacent nontumorous (NT) tissue. (B) Northern blot analysis confirming siRNA knockdown efficiency of miR-664, miR-485-3p, and miR-495 in HepG2 and Hep3B cells as compared with scramble siRNA (SC) control. (C and D) Northern (top) and Western (bottom) blot analyses showing the effect of siRNA knockdown of miR-664, miR-485-3p and miR-495, alone or in combination, on MAT1A expression in HepG2 (C) and Hep3B cells (D). Numbers below the blots represent densitometric values expressed as percentage of respective controls. Representative blots are shown for C and D from 3 experiments, *P < 0.01 vs. SC; †P < 0.05 vs. SC, and triple knockdown; ‡P < 0.001 vs. SC and single knockdown.
Mat1a 3 Utr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sams+1/10__1172_slash_jci63861-208-25-32?v=OriGene
Average 90 stars, based on 1 article reviews
mat1a 3 utr - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
OriGene mat1a plasmid
RNA sequencing (RNA-seq) profiling identifies significant transcriptional changes in drug treated bladder PDX tumors. ( A ) 351 and 402 genes were found significantly changed in BL0293 and BL0440 drug-relapsed tumors; ( B ) 20 up-regulated and ( D ) 17 down-regulated genes where shared by both drug-relapsed xenografts. ( C ) A heat map depicts variation of shared up- and down-regulated genes among BL0293 and BL0440 biological replicates. M1 and M2 denote biological replicates. ( E ) <t>methionine</t> <t>adenosyltransferase</t> <t>1a</t> ( <t>MAT1A</t> ) gene expression values in sensitive (PBS) and drug treated (Rx) tumors from RNA sequencing data, expressed in fold change (FC), for both BL0293 and BL0440.
Mat1a Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sams+1/pmc06829260-158-0-2?v=OriGene
Average 90 stars, based on 1 article reviews
mat1a plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

91
OriGene mata1
RNA sequencing (RNA-seq) profiling identifies significant transcriptional changes in drug treated bladder PDX tumors. ( A ) 351 and 402 genes were found significantly changed in BL0293 and BL0440 drug-relapsed tumors; ( B ) 20 up-regulated and ( D ) 17 down-regulated genes where shared by both drug-relapsed xenografts. ( C ) A heat map depicts variation of shared up- and down-regulated genes among BL0293 and BL0440 biological replicates. M1 and M2 denote biological replicates. ( E ) <t>methionine</t> <t>adenosyltransferase</t> <t>1a</t> ( <t>MAT1A</t> ) gene expression values in sensitive (PBS) and drug treated (Rx) tumors from RNA sequencing data, expressed in fold change (FC), for both BL0293 and BL0440.
Mata1, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sams+1/pm27981602-77-22-45?v=OriGene
Average 91 stars, based on 1 article reviews
mata1 - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

92
Boster Bio slides
RNA sequencing (RNA-seq) profiling identifies significant transcriptional changes in drug treated bladder PDX tumors. ( A ) 351 and 402 genes were found significantly changed in BL0293 and BL0440 drug-relapsed tumors; ( B ) 20 up-regulated and ( D ) 17 down-regulated genes where shared by both drug-relapsed xenografts. ( C ) A heat map depicts variation of shared up- and down-regulated genes among BL0293 and BL0440 biological replicates. M1 and M2 denote biological replicates. ( E ) <t>methionine</t> <t>adenosyltransferase</t> <t>1a</t> ( <t>MAT1A</t> ) gene expression values in sensitive (PBS) and drug treated (Rx) tumors from RNA sequencing data, expressed in fold change (FC), for both BL0293 and BL0440.
Slides, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sams+1/pm39438468-54-7-20?v=Boster+Bio
Average 92 stars, based on 1 article reviews
slides - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

Image Search Results


Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFR proteins in liver tissues of rats in each group. (A) Expression levels of MAT1A protein in liver tissues of rats in each group (n = 3); (B) Expression levels of AHCY protein in liver tissues of rats in each group (n = 3); (C) Expression levels of MYHFR protein in liver tissues of rats in each group (n = 3); (D) Expression levels of ALDH2 protein in liver tissues of rats in each group (n = 3); (E) Expression levels of CBS protein in liver tissues of rats in each group (n = 3). Note: Data are expressed as the mean ± SD. “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFR proteins in liver tissues of rats in each group. (A) Expression levels of MAT1A protein in liver tissues of rats in each group (n = 3); (B) Expression levels of AHCY protein in liver tissues of rats in each group (n = 3); (C) Expression levels of MYHFR protein in liver tissues of rats in each group (n = 3); (D) Expression levels of ALDH2 protein in liver tissues of rats in each group (n = 3); (E) Expression levels of CBS protein in liver tissues of rats in each group (n = 3). Note: Data are expressed as the mean ± SD. “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques: Expressing

Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFRmRNA in liver tissues of rats in each group (A) Expression levels of ALDH2 mRNA in liver tissues of rats in each group (n = 3); (B) Expression levels of MTHFRmRNA in liver tissues of rats in each group (n = 3); (C) Expression levels of CBS mRNA in liver tissues of rats in each group (n = 3); (D) Expression levels of AHCY mRNA in liver tissues of rats in each group (n = 3); (E) Expression levels of MAT1A mRNA in liver tissues of rats in each group (n = 3). Note: “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFRmRNA in liver tissues of rats in each group (A) Expression levels of ALDH2 mRNA in liver tissues of rats in each group (n = 3); (B) Expression levels of MTHFRmRNA in liver tissues of rats in each group (n = 3); (C) Expression levels of CBS mRNA in liver tissues of rats in each group (n = 3); (D) Expression levels of AHCY mRNA in liver tissues of rats in each group (n = 3); (E) Expression levels of MAT1A mRNA in liver tissues of rats in each group (n = 3). Note: “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques: Expressing

The mechanism diagram of endogenous formaldehyde participating in one-carbon metabolism leading to homocysteine accumulation and causing NASH. Note: formaldehyde (Endogenous FA); Glutathione (GSH) Mitochondrial aldehyde dehydrogenase 2 (ALDH2); Formate; Tetrahydrofolate (THF); 5, 10-methylenetetrahydrofolate (5, 10-CH2-THF); Methylenetetrahydrofolate reductase (MTHFR); Homocysteine (HCY); S-adenosine homocysteine (SAH); Reactive oxygen species (ROS); Non-alcoholic steatohepatitis (NASH); Methionine Cystathionine -β -synthase (CBS); 5-methyltetrahydrofolate (5-CH3-THF); S-adenosylmethionine (SAM); Methionine adenosyltransferase 1A (MAT1A); S-adenosine homocysteine hydrolase (AHCY).

Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: The mechanism diagram of endogenous formaldehyde participating in one-carbon metabolism leading to homocysteine accumulation and causing NASH. Note: formaldehyde (Endogenous FA); Glutathione (GSH) Mitochondrial aldehyde dehydrogenase 2 (ALDH2); Formate; Tetrahydrofolate (THF); 5, 10-methylenetetrahydrofolate (5, 10-CH2-THF); Methylenetetrahydrofolate reductase (MTHFR); Homocysteine (HCY); S-adenosine homocysteine (SAH); Reactive oxygen species (ROS); Non-alcoholic steatohepatitis (NASH); Methionine Cystathionine -β -synthase (CBS); 5-methyltetrahydrofolate (5-CH3-THF); S-adenosylmethionine (SAM); Methionine adenosyltransferase 1A (MAT1A); S-adenosine homocysteine hydrolase (AHCY).

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques:

Figure 1 miR-664, miR-485-3p, and miR-495 are induced in HCC and negatively regulate MAT1A expression in liver cancer cell lines. (A) Northern blot analysis showing expression of select miRNAs in HCC compared with adjacent nontumorous (NT) tissue. (B) Northern blot analysis confirming siRNA knockdown efficiency of miR-664, miR-485-3p, and miR-495 in HepG2 and Hep3B cells as compared with scramble siRNA (SC) control. (C and D) Northern (top) and Western (bottom) blot analyses showing the effect of siRNA knockdown of miR-664, miR-485-3p and miR-495, alone or in combination, on MAT1A expression in HepG2 (C) and Hep3B cells (D). Numbers below the blots represent densitometric values expressed as percentage of respective controls. Representative blots are shown for C and D from 3 experiments, *P < 0.01 vs. SC; †P < 0.05 vs. SC, and triple knockdown; ‡P < 0.001 vs. SC and single knockdown.

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 1 miR-664, miR-485-3p, and miR-495 are induced in HCC and negatively regulate MAT1A expression in liver cancer cell lines. (A) Northern blot analysis showing expression of select miRNAs in HCC compared with adjacent nontumorous (NT) tissue. (B) Northern blot analysis confirming siRNA knockdown efficiency of miR-664, miR-485-3p, and miR-495 in HepG2 and Hep3B cells as compared with scramble siRNA (SC) control. (C and D) Northern (top) and Western (bottom) blot analyses showing the effect of siRNA knockdown of miR-664, miR-485-3p and miR-495, alone or in combination, on MAT1A expression in HepG2 (C) and Hep3B cells (D). Numbers below the blots represent densitometric values expressed as percentage of respective controls. Representative blots are shown for C and D from 3 experiments, *P < 0.01 vs. SC; †P < 0.05 vs. SC, and triple knockdown; ‡P < 0.001 vs. SC and single knockdown.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Expressing, Northern Blot, Knockdown, Control, Western Blot

Figure 2 MAT1A 3′ UTR-driven reporter activity and the effect of mutating miRNA bind- ing sites. (A) Diagram of MAT1A 3′ UTR fragment containing the putative bind- ing sites for miR-664, miR-485-3p, and miR-495. Mutations created for each miRNA site are denoted in bold ital- ics. Transient transfection assays were performed using a luciferase reporter system with WT and mutated MAT1A 3′ UTR constructs as described in Methods in (B) HepG2 and (C) Hep3B cells. *P < 0.05 vs. control; †P < 0.05 vs. MAT1A 3′ UTR; ‡P < 0.05 vs. triple miRNA siRNA knockdown. n = 3 experi- ments, done in triplicate.

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 2 MAT1A 3′ UTR-driven reporter activity and the effect of mutating miRNA bind- ing sites. (A) Diagram of MAT1A 3′ UTR fragment containing the putative bind- ing sites for miR-664, miR-485-3p, and miR-495. Mutations created for each miRNA site are denoted in bold ital- ics. Transient transfection assays were performed using a luciferase reporter system with WT and mutated MAT1A 3′ UTR constructs as described in Methods in (B) HepG2 and (C) Hep3B cells. *P < 0.05 vs. control; †P < 0.05 vs. MAT1A 3′ UTR; ‡P < 0.05 vs. triple miRNA siRNA knockdown. n = 3 experi- ments, done in triplicate.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Activity Assay, Transfection, Luciferase, Construct, Control, Knockdown

Figure 3 Increased cellular apoptosis and decreased cell growth in Hep3B cells by miRNA knockdown requires MAT1A induction. (A) Apoptosis rates were determined by Hoechst staining at 24, 48, and 72 hours after tran- sient miRNA knockdown in Hep3B cells. *P < 0.01, **P < 0.05 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 12 determi- nations. (B) BrdU incorporation assay was measured at 24 hours after transient miRNA knockdown in Hep3B cells. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 8 determinations. (C) To determine the role of MAT1A induction on growth, Hep3B cells stably trans- fected with miR-664, miR-485-3p, and miR-495 siRNA or scramble siRNA (stable SC) were transiently trans- fected with MAT1A siRNA or SC, and BrdU incorpo- ration and MAT1A protein levels were measured 24 hours later. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. SC+MAT1Asi and each respective miRNA siRNA+SC. n = 3 experiments, each with 8 determinations for BrdU. Numbers below the Western blot represent mean den- sitometric values expressed as percentage of control.

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 3 Increased cellular apoptosis and decreased cell growth in Hep3B cells by miRNA knockdown requires MAT1A induction. (A) Apoptosis rates were determined by Hoechst staining at 24, 48, and 72 hours after tran- sient miRNA knockdown in Hep3B cells. *P < 0.01, **P < 0.05 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 12 determi- nations. (B) BrdU incorporation assay was measured at 24 hours after transient miRNA knockdown in Hep3B cells. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 8 determinations. (C) To determine the role of MAT1A induction on growth, Hep3B cells stably trans- fected with miR-664, miR-485-3p, and miR-495 siRNA or scramble siRNA (stable SC) were transiently trans- fected with MAT1A siRNA or SC, and BrdU incorpo- ration and MAT1A protein levels were measured 24 hours later. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. SC+MAT1Asi and each respective miRNA siRNA+SC. n = 3 experiments, each with 8 determinations for BrdU. Numbers below the Western blot represent mean den- sitometric values expressed as percentage of control.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Knockdown, Staining, BrdU Incorporation Assay, Stable Transfection, Western Blot, Control

Figure 4 Effect of stably transfected miR-664, miR-485, and miR-495 and their siRNAs on tumor growth in a xenograft mouse model. Nude mice were injected with Hep3B cells subcutaneously containing either (A) stably transfected miR-664, miR-485, and miR-495 (*P < 0.05, **P < 0.01 vs. EV; †P < 0.05 vs. miR-664 or miR-485; n = 8) or (B) stably transfected siRNAs against miR-664, miR-485-3p, and miR-495 (*P < 0.05, **P < 0.0001 vs. SC; †P < 0.05 vs. miR-664-si or miR-485-3psi; n = 8), and tumor volumes were measured over time. (C) Representative pictures of subcutane- ous tumors at 8 weeks following injection of cells containing stably transfected miRNAs (left) and siRNAs (right) (top row), immunohistochemistry stained for PCNA (middle row) and MAT1A protein expression (bottom row) Original magnification, ×200. Numbers below PCNA staining repre- sent percentage of positively stained cells. *P < 0.01 vs. miR-485, miR-664 and EV; †P < 0.05 vs. EV; ‡P < 0.05 vs. miR-485-3psi, miR-664si and SC; §P < 0.05 vs. SC.

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 4 Effect of stably transfected miR-664, miR-485, and miR-495 and their siRNAs on tumor growth in a xenograft mouse model. Nude mice were injected with Hep3B cells subcutaneously containing either (A) stably transfected miR-664, miR-485, and miR-495 (*P < 0.05, **P < 0.01 vs. EV; †P < 0.05 vs. miR-664 or miR-485; n = 8) or (B) stably transfected siRNAs against miR-664, miR-485-3p, and miR-495 (*P < 0.05, **P < 0.0001 vs. SC; †P < 0.05 vs. miR-664-si or miR-485-3psi; n = 8), and tumor volumes were measured over time. (C) Representative pictures of subcutane- ous tumors at 8 weeks following injection of cells containing stably transfected miRNAs (left) and siRNAs (right) (top row), immunohistochemistry stained for PCNA (middle row) and MAT1A protein expression (bottom row) Original magnification, ×200. Numbers below PCNA staining repre- sent percentage of positively stained cells. *P < 0.01 vs. miR-485, miR-664 and EV; †P < 0.05 vs. EV; ‡P < 0.05 vs. miR-485-3psi, miR-664si and SC; §P < 0.05 vs. SC.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Stable Transfection, Transfection, Injection, Immunohistochemistry, Staining, Expressing

Figure 6 Role of MAT1A in tumorigenesis and therapeutic effect of miR-495 siRNA. HepG2 cells were injected into the left hepatic lobe of male BALB/c nude mice and lentiviral vectors containing MAT1A siRNA (MAT1Asi), miR-495 siRNA (miR-495si), and scramble siRNA (SC), alone or together, were injected into the spleen at the time of HepG2 cell injection (n = 8 per group). Control group received only HepG2 cell injection. Two weeks later, lentiviral siRNAs were injected into the tail vein, and this was repeated every 2 weeks until sacrifice at 8 weeks. First row: arrows point to tumors at the site of injection, and tumor volumes are shown below. *P < 0.005 vs. SC+SC; †P < 0.005 vs. MAT1Asi+SC; ‡P < 0.05 vs. miR- 495si+MAT1Asi. Second and third rows show metastasis to lung and pancreas (indicated by arrows) in the various treatment groups, with the incidence shown below. Original magnification, ×200.

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 6 Role of MAT1A in tumorigenesis and therapeutic effect of miR-495 siRNA. HepG2 cells were injected into the left hepatic lobe of male BALB/c nude mice and lentiviral vectors containing MAT1A siRNA (MAT1Asi), miR-495 siRNA (miR-495si), and scramble siRNA (SC), alone or together, were injected into the spleen at the time of HepG2 cell injection (n = 8 per group). Control group received only HepG2 cell injection. Two weeks later, lentiviral siRNAs were injected into the tail vein, and this was repeated every 2 weeks until sacrifice at 8 weeks. First row: arrows point to tumors at the site of injection, and tumor volumes are shown below. *P < 0.005 vs. SC+SC; †P < 0.005 vs. MAT1Asi+SC; ‡P < 0.05 vs. miR- 495si+MAT1Asi. Second and third rows show metastasis to lung and pancreas (indicated by arrows) in the various treatment groups, with the incidence shown below. Original magnification, ×200.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Injection, Control

RNA sequencing (RNA-seq) profiling identifies significant transcriptional changes in drug treated bladder PDX tumors. ( A ) 351 and 402 genes were found significantly changed in BL0293 and BL0440 drug-relapsed tumors; ( B ) 20 up-regulated and ( D ) 17 down-regulated genes where shared by both drug-relapsed xenografts. ( C ) A heat map depicts variation of shared up- and down-regulated genes among BL0293 and BL0440 biological replicates. M1 and M2 denote biological replicates. ( E ) methionine adenosyltransferase 1a ( MAT1A ) gene expression values in sensitive (PBS) and drug treated (Rx) tumors from RNA sequencing data, expressed in fold change (FC), for both BL0293 and BL0440.

Journal: International Journal of Molecular Sciences

Article Title: Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice

doi: 10.3390/ijms20204983

Figure Lengend Snippet: RNA sequencing (RNA-seq) profiling identifies significant transcriptional changes in drug treated bladder PDX tumors. ( A ) 351 and 402 genes were found significantly changed in BL0293 and BL0440 drug-relapsed tumors; ( B ) 20 up-regulated and ( D ) 17 down-regulated genes where shared by both drug-relapsed xenografts. ( C ) A heat map depicts variation of shared up- and down-regulated genes among BL0293 and BL0440 biological replicates. M1 and M2 denote biological replicates. ( E ) methionine adenosyltransferase 1a ( MAT1A ) gene expression values in sensitive (PBS) and drug treated (Rx) tumors from RNA sequencing data, expressed in fold change (FC), for both BL0293 and BL0440.

Article Snippet: MAT1A plasmid (Origene; NM_000429 Human Untagged Clone, Product #SC119881) was isolated and purified using MidiPrepTM kit (Qiagen Inc., Hilden, Germany).

Techniques: RNA Sequencing, Gene Expression

Top 20 upregulated genes in drug relapsed PDX tumors.

Journal: International Journal of Molecular Sciences

Article Title: Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice

doi: 10.3390/ijms20204983

Figure Lengend Snippet: Top 20 upregulated genes in drug relapsed PDX tumors.

Article Snippet: MAT1A plasmid (Origene; NM_000429 Human Untagged Clone, Product #SC119881) was isolated and purified using MidiPrepTM kit (Qiagen Inc., Hilden, Germany).

Techniques: Sequencing, Binding Assay

MAT1A protein levels increase in drug relapsed PDX and clinical patient tumors. MAT1A protein expression was examined by immunohistochemical (IHC) analysis in ( A ) non-drug relapsed and ( B ) drug relapsed BL0440 tumors. Images taken at 40× magnification, insets are enlargements of image shown, white arrows highlighting regions of enhanced MAT1A abundance in chemotherapy treated tumors. ( C ) MAT1A expression quantification across patient tissue microarrays (TMAs) (n, nuclear; c, cytoplasmic). ( D , E ) Evaluation of TMA of bladder cancer samples obtained during cystectomy. IHC analysis includes MAT1A protein stained with labeled streptavidin biotin (LSAB) and counterstained with hematoxylin. ( D ) Sample showing nuclear and cytoplasmic localization of MAT1A from male patient receiving six cycles of chemotherapy which included gemcitabine; ( E ) sample showing only cytoplasmic MAT1A localization from male patient receiving Bacillus Calmette-Guerin (BCG).

Journal: International Journal of Molecular Sciences

Article Title: Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice

doi: 10.3390/ijms20204983

Figure Lengend Snippet: MAT1A protein levels increase in drug relapsed PDX and clinical patient tumors. MAT1A protein expression was examined by immunohistochemical (IHC) analysis in ( A ) non-drug relapsed and ( B ) drug relapsed BL0440 tumors. Images taken at 40× magnification, insets are enlargements of image shown, white arrows highlighting regions of enhanced MAT1A abundance in chemotherapy treated tumors. ( C ) MAT1A expression quantification across patient tissue microarrays (TMAs) (n, nuclear; c, cytoplasmic). ( D , E ) Evaluation of TMA of bladder cancer samples obtained during cystectomy. IHC analysis includes MAT1A protein stained with labeled streptavidin biotin (LSAB) and counterstained with hematoxylin. ( D ) Sample showing nuclear and cytoplasmic localization of MAT1A from male patient receiving six cycles of chemotherapy which included gemcitabine; ( E ) sample showing only cytoplasmic MAT1A localization from male patient receiving Bacillus Calmette-Guerin (BCG).

Article Snippet: MAT1A plasmid (Origene; NM_000429 Human Untagged Clone, Product #SC119881) was isolated and purified using MidiPrepTM kit (Qiagen Inc., Hilden, Germany).

Techniques: Expressing, Immunohistochemical staining, Staining, Labeling

MAT1A is upregulated in cells that survive 48 h drug treatment and overexpression alters cell response to gemcitabine. ( A ) 5637 cells were dosed at ~80% IC50 gemcitabine concentration (0.3 µM) for 48 h in vitro. RNA was collected from remaining gemcitabine treated (5637 Rx , n = 3) and untreated cells (5637, n = 3) before (day zero), during (day one, two) and after (day three, four, six, nine, and 12) drug treatment. ( B ) MAT1A expression was quantified via qPCR at each timepoint and expressed in FC. Statistical analysis was conducted using Student’s t-test, p < 0.0005 (#). ( C ) Quantitative PCR showing relative MAT1A gene expression in MAT1A plasmid transfected 5637 bladder cancer cells (5637 MAT1A + ) expressed as FC, ( n = 3 biological replicates), p < 0.0005 (#) compared to expression at day four in post drug treated 5637 cells (5637 Rx ) (NS, non-significant). ( D ) Representative gel of MAT1A protein expression relative to control b-tubulin analyzed via Western blotting using the Jess system (ProteinSimple). ( E ) Normalized MAT1A /b-tubulin protein expression calculated using Jess system densitometry expressed as percent of wildtype MAT1A expression in 5637 control cells ( n = 6 biological replicates), p < 0.005 (**). ( F ) IC50 gemcitabine drug toxicity curve between empty vector transfected and MAT1A transfected cells ( n = 5 biological replicates per condition per dose).

Journal: International Journal of Molecular Sciences

Article Title: Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice

doi: 10.3390/ijms20204983

Figure Lengend Snippet: MAT1A is upregulated in cells that survive 48 h drug treatment and overexpression alters cell response to gemcitabine. ( A ) 5637 cells were dosed at ~80% IC50 gemcitabine concentration (0.3 µM) for 48 h in vitro. RNA was collected from remaining gemcitabine treated (5637 Rx , n = 3) and untreated cells (5637, n = 3) before (day zero), during (day one, two) and after (day three, four, six, nine, and 12) drug treatment. ( B ) MAT1A expression was quantified via qPCR at each timepoint and expressed in FC. Statistical analysis was conducted using Student’s t-test, p < 0.0005 (#). ( C ) Quantitative PCR showing relative MAT1A gene expression in MAT1A plasmid transfected 5637 bladder cancer cells (5637 MAT1A + ) expressed as FC, ( n = 3 biological replicates), p < 0.0005 (#) compared to expression at day four in post drug treated 5637 cells (5637 Rx ) (NS, non-significant). ( D ) Representative gel of MAT1A protein expression relative to control b-tubulin analyzed via Western blotting using the Jess system (ProteinSimple). ( E ) Normalized MAT1A /b-tubulin protein expression calculated using Jess system densitometry expressed as percent of wildtype MAT1A expression in 5637 control cells ( n = 6 biological replicates), p < 0.005 (**). ( F ) IC50 gemcitabine drug toxicity curve between empty vector transfected and MAT1A transfected cells ( n = 5 biological replicates per condition per dose).

Article Snippet: MAT1A plasmid (Origene; NM_000429 Human Untagged Clone, Product #SC119881) was isolated and purified using MidiPrepTM kit (Qiagen Inc., Hilden, Germany).

Techniques: Over Expression, Concentration Assay, In Vitro, Expressing, Real-time Polymerase Chain Reaction, Gene Expression, Plasmid Preparation, Transfection, Control, Western Blot

MAT1A overexpression decreases cell proliferation and transcriptional activity. ( A ) Proliferation indices over 72 h (* p < 0.05) in 5637 and 5637 MAT1A + cells and ( B ) percentage of 5637 versus 5637 MAT1A + cells in various generations following initial cell seeding at generation zero (* p < 0.05). Cells were stained with carboxyfluorescein diacetate succinimidyl ester (CFSE) and analyzed using flow cytometry to evaluate changes in proliferation. Data was analyzed and proliferation was modeled in FlowJo ® . RNA-seq analysis identified whole genome transcriptomic alterations in 5637 MAT1A + and 5637 cells. Heat maps representing differentially expressed genes ( n = 3 biological replicates) reveal downregulation in three gene groups: ( C ) zinc finger, ( D ) histone, and ( E ) transcription factors.

Journal: International Journal of Molecular Sciences

Article Title: Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice

doi: 10.3390/ijms20204983

Figure Lengend Snippet: MAT1A overexpression decreases cell proliferation and transcriptional activity. ( A ) Proliferation indices over 72 h (* p < 0.05) in 5637 and 5637 MAT1A + cells and ( B ) percentage of 5637 versus 5637 MAT1A + cells in various generations following initial cell seeding at generation zero (* p < 0.05). Cells were stained with carboxyfluorescein diacetate succinimidyl ester (CFSE) and analyzed using flow cytometry to evaluate changes in proliferation. Data was analyzed and proliferation was modeled in FlowJo ® . RNA-seq analysis identified whole genome transcriptomic alterations in 5637 MAT1A + and 5637 cells. Heat maps representing differentially expressed genes ( n = 3 biological replicates) reveal downregulation in three gene groups: ( C ) zinc finger, ( D ) histone, and ( E ) transcription factors.

Article Snippet: MAT1A plasmid (Origene; NM_000429 Human Untagged Clone, Product #SC119881) was isolated and purified using MidiPrepTM kit (Qiagen Inc., Hilden, Germany).

Techniques: Over Expression, Activity Assay, Staining, Flow Cytometry, RNA Sequencing