ryanodine receptor Search Results


95
Developmental Studies Hybridoma Bank 34c mouse anti ryr antibody
34c Mouse Anti Ryr Antibody, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/34c mouse anti ryr antibody/product/Developmental Studies Hybridoma Bank
Average 95 stars, based on 1 article reviews
34c mouse anti ryr antibody - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

95
Alomone Labs alomone labs arr 002
Alomone Labs Arr 002, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alomone labs arr 002/product/Alomone Labs
Average 95 stars, based on 1 article reviews
alomone labs arr 002 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

93
Alomone Labs ryr1
Ryr1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ryr1/product/Alomone Labs
Average 93 stars, based on 1 article reviews
ryr1 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Proteintech 1 ap
1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 ap/product/Proteintech
Average 93 stars, based on 1 article reviews
1 ap - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

95
Proteintech anti ryanodine receptor 2
Anti Ryanodine Receptor 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ryanodine receptor 2/product/Proteintech
Average 95 stars, based on 1 article reviews
anti ryanodine receptor 2 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

94
Alomone Labs ryr3
Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.
Ryr3, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ryr3/product/Alomone Labs
Average 94 stars, based on 1 article reviews
ryr3 - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

93
Novus Biologicals anti ryr2 antibody
Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.
Anti Ryr2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ryr2 antibody/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
anti ryr2 antibody - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Novus Biologicals nbp2 80143r c3 33
Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.
Nbp2 80143r C3 33, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nbp2 80143r c3 33/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
nbp2 80143r c3 33 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Novus Biologicals ryanodine receptor 2
Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.
Ryanodine Receptor 2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ryanodine receptor 2/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
ryanodine receptor 2 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
OriGene human ryr2 sirnas
Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the <t>RYR2-duplicated</t> <t>(RYR2</t> Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.
Human Ryr2 Sirnas, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human ryr2 sirnas/product/OriGene
Average 90 stars, based on 1 article reviews
human ryr2 sirnas - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
OriGene anti ryr antibodies
Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the <t>RYR2-duplicated</t> <t>(RYR2</t> Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.
Anti Ryr Antibodies, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ryr antibodies/product/OriGene
Average 93 stars, based on 1 article reviews
anti ryr antibodies - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Alomone Labs bkα
Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the <t>RYR2-duplicated</t> <t>(RYR2</t> Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.
Bkα, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bkα/product/Alomone Labs
Average 90 stars, based on 1 article reviews
bkα - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.

Journal: Microcirculation (New York, N.Y. : 1994)

Article Title: Aging alters spontaneous and neurotransmitter-mediated Ca 2+ signaling in smooth muscle cells of mouse mesenteric arteries

doi: 10.1111/micc.12607

Figure Lengend Snippet: Transcript levels for ryanodine receptor isoforms in mesenteric artery smooth muscle cells from young and old mice. Data are from 22 with permission.

Article Snippet: Thus prepared, slides were incubated 60 min in primary antibody [Alamone Labs, 1:250] for RyR1 (Cat. #ARR-001), RyR2 (Cat. #ARR-002), or RyR3 (Cat. #ARR-003).

Techniques:

Representative immunofluorescence images depicting green fluorescence for RyR1 (top rows), RyR2 (center rows) and RyR3 (bottom rows) in 3 separate SMCs from MAs of (A) young and (B) old mice, (C) SMCs incubated with respective blocking peptides, and (D) SMC with primary omitted. ToPro nuclear stain (blue) is included in all images. Scale bars = 20 μm and apply to all panels.

Journal: Microcirculation (New York, N.Y. : 1994)

Article Title: Aging alters spontaneous and neurotransmitter-mediated Ca 2+ signaling in smooth muscle cells of mouse mesenteric arteries

doi: 10.1111/micc.12607

Figure Lengend Snippet: Representative immunofluorescence images depicting green fluorescence for RyR1 (top rows), RyR2 (center rows) and RyR3 (bottom rows) in 3 separate SMCs from MAs of (A) young and (B) old mice, (C) SMCs incubated with respective blocking peptides, and (D) SMC with primary omitted. ToPro nuclear stain (blue) is included in all images. Scale bars = 20 μm and apply to all panels.

Article Snippet: Thus prepared, slides were incubated 60 min in primary antibody [Alamone Labs, 1:250] for RyR1 (Cat. #ARR-001), RyR2 (Cat. #ARR-002), or RyR3 (Cat. #ARR-003).

Techniques: Immunofluorescence, Fluorescence, Incubation, Blocking Assay, Staining

Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the RYR2-duplicated (RYR2 Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) ( A ) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaffected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. ( B ) A representative Sanger sequencing chromatogram from one of the RYR2-duplicated (RYR2 Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2 ’s 5′ UTR/promoter region, and exons 1–4 of RYR2 . ( C ) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Sequencing, Clone Assay, Derivative Assay, Mutagenesis

Shown is ( A ) real-time quantitative PCR (RT-qPCR) of RYR2 mRNA transcript normalized by cardiac troponin (cTnT) for 2 control donor heart tissue samples (control 1, a 42-year-old woman; and control 2, a 39-year-old man) and a heart tissue sample for a family member, a 12-year-old girl with sudden unexplained death in the young (SUDY) who was homozygous for the RYR2 duplication iPSC-CMs. Two independent RT-qPCR experiments with 6 technical replicates each ( N = 12) and ( B ) representative Western blots with RyR2 and cardiac α-actinin antibodies from the family member with SUDY and 2 unrelated control donor heart tissue samples (3 independent Western blots per sample). Shown are immunofluorescence (IF) images of a section of heart tissue collected from a relative with SUDY (pedigree 1, ) who died suddenly during exertion and a healthy 42-year-old female heart donor. ( C ) The individual IF images of RyR2 (red) and the cardiac marker cTnT (green) and the merged image along with DAPI staining for both the control and SUDY victim. ( D ) The individual IF images of the SR marker proteins calreticulin (green) and calsequestrin-2 (CASQ2, green) and the cardiac marker α-actinin (red) and the merged image along with DAPI staining for both the control and SUDY victim. Data are presented as mean ± SEM.

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown is ( A ) real-time quantitative PCR (RT-qPCR) of RYR2 mRNA transcript normalized by cardiac troponin (cTnT) for 2 control donor heart tissue samples (control 1, a 42-year-old woman; and control 2, a 39-year-old man) and a heart tissue sample for a family member, a 12-year-old girl with sudden unexplained death in the young (SUDY) who was homozygous for the RYR2 duplication iPSC-CMs. Two independent RT-qPCR experiments with 6 technical replicates each ( N = 12) and ( B ) representative Western blots with RyR2 and cardiac α-actinin antibodies from the family member with SUDY and 2 unrelated control donor heart tissue samples (3 independent Western blots per sample). Shown are immunofluorescence (IF) images of a section of heart tissue collected from a relative with SUDY (pedigree 1, ) who died suddenly during exertion and a healthy 42-year-old female heart donor. ( C ) The individual IF images of RyR2 (red) and the cardiac marker cTnT (green) and the merged image along with DAPI staining for both the control and SUDY victim. ( D ) The individual IF images of the SR marker proteins calreticulin (green) and calsequestrin-2 (CASQ2, green) and the cardiac marker α-actinin (red) and the merged image along with DAPI staining for both the control and SUDY victim. Data are presented as mean ± SEM.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Immunofluorescence, Marker, Staining

Shown are ( A ) screenshots of representative iPSC-CMs imaged and corresponding regions of interest used for calcium handling assessment and ( B ) representative raw tracings from unrelated WT (WT1) control iPSC-CMs and both patient human iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1). Also shown are summary data bar graphs of ( C ) Fluo-4–measured calcium transient amplitude, normalized by (F – F0)/F0, ( D ) calcium transient decay 50% (τ), and ( E ) calcium transient time-to-peak values for (WT1 and WT2) control iPSC-CMs and both patient iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1 and clone 2). Data are presented as mean ± standard deviation. n = 7 to 24 per group .

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Shown are ( A ) screenshots of representative iPSC-CMs imaged and corresponding regions of interest used for calcium handling assessment and ( B ) representative raw tracings from unrelated WT (WT1) control iPSC-CMs and both patient human iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1). Also shown are summary data bar graphs of ( C ) Fluo-4–measured calcium transient amplitude, normalized by (F – F0)/F0, ( D ) calcium transient decay 50% (τ), and ( E ) calcium transient time-to-peak values for (WT1 and WT2) control iPSC-CMs and both patient iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1 and clone 2). Data are presented as mean ± standard deviation. n = 7 to 24 per group .

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Standard Deviation

Representative Fluo-4–measured calcium transient before (blue trace) and after 100 nM ISO (red trace) are shown for ( A ) WT (WT1) control iPSC-CMs and ( B ) the homozygous RYR2 duplication iPSC-CMs for patient 1. ( C ) The average calcium transient amplitude summary data at baseline and after 100 nM ISO treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Representative Fluo-4–measured calcium transients before and after 10 mM caffeine are shown for ( D ) WT1 control iPSC-CMs (blue trace) and the homozygous RYR2 duplication iPSC-CMs for patient 1 (red trace). ( E ) The average calcium transient amplitude summary data at baseline (BL) and after 10 mM caffeine (Caff) treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Data are presented as mean ± SEM . A 2-tailed Student’s t test was performed to determine statistical significance between 2 groups. P < 0.05 was considered to be significant.

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Representative Fluo-4–measured calcium transient before (blue trace) and after 100 nM ISO (red trace) are shown for ( A ) WT (WT1) control iPSC-CMs and ( B ) the homozygous RYR2 duplication iPSC-CMs for patient 1. ( C ) The average calcium transient amplitude summary data at baseline and after 100 nM ISO treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Representative Fluo-4–measured calcium transients before and after 10 mM caffeine are shown for ( D ) WT1 control iPSC-CMs (blue trace) and the homozygous RYR2 duplication iPSC-CMs for patient 1 (red trace). ( E ) The average calcium transient amplitude summary data at baseline (BL) and after 10 mM caffeine (Caff) treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Data are presented as mean ± SEM . A 2-tailed Student’s t test was performed to determine statistical significance between 2 groups. P < 0.05 was considered to be significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Clone Assay

Representative action potential traces from ( A ) WT (WT1) control iPSC-CMs ( n = 10) and ( B ) RYR2 Dup 1-c2 mutant iPSC-CMs under baseline conditions ( n = 10) and ( C ) RYR2 Dup 1-c2 mutant ( n = 8) and ( D ) RYR2 Dup 2-c2 mutant ( n = 5) iPSC-CMs following ISO (100 nM) treatment. DAD events are indicated by the arrow.

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Representative action potential traces from ( A ) WT (WT1) control iPSC-CMs ( n = 10) and ( B ) RYR2 Dup 1-c2 mutant iPSC-CMs under baseline conditions ( n = 10) and ( C ) RYR2 Dup 1-c2 mutant ( n = 8) and ( D ) RYR2 Dup 2-c2 mutant ( n = 5) iPSC-CMs following ISO (100 nM) treatment. DAD events are indicated by the arrow.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Mutagenesis

( A ) Representative field potential (FP) recordings from WT (WT1) and the homozygous RYR2 duplication iPSC-CMs for both patients (RYR2 Dup 1 and RYR2 Dup 2) at baseline (top) and following ISO (100 nM) treatment (bottom). ( B ) A bar graph summary showing the erratic beating frequency (i.e., arrhythmic events) present at baseline and following ISO treatment in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs for both patients. WT1-iPSC-CM baseline ( n = 158, SEM = 1.25), WT-iPSC-CM ISO ( n = 160, SEM = 1.5), RYR2 Dup 1-c1-iPSC-CM baseline ( n = 165, SEM = 1.9), RYR2 Dup 1-c1-iPSC-CM ISO ( n = 419, SEM = 1.7), RYR2 Dup 2-c1-iPSC-CM baseline ( n = 129, SEM = 2.9), RYR2 Dup 2-c1-iPSC-CM ISO ( n = 100, SEM = 3.8). ( C ) Representative FP recordings from WT1 control and RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) treatment alone, and following ISO with nadolol (10 μM). ( D ) A bar graph summary of the erratic beating frequency (i.e., arrhythmic events) present in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) and in response to pharmacotherapies (nadolol at 10 μM, propranolol at 1 μM, and flecainide at 6 μM). Data are shown as number of experiments, where each experiment includes data acquired from 250–500 electrode recordings each. WT1-iPSC-CM baseline ( n = 4, SEM = 1.5), ISO ( n = 12, SEM = 0.4), ISO + nadolol ( n = 12, SEM = 0.20), ISO + propranolol ( n = 12, SEM = 0.20), and ISO + flecainide ( n = 12, SEM = 1.7). RYR2 Dup 2-c1-iPSC-CM baseline ( n = 4, SEM = 3.9), ISO ( n = 12, SEM = 1.5), ISO + nadolol ( n = 12, SEM = 1.1), ISO + propranolol ( n = 12, SEM = 0.72), and ISO + flecainide ( n = 12, SEM = 1.2). Data are presented as mean ± SEM. The symbol *** represents P < 0.0001. A 1-way ANOVA with Tukey’s test was performed to determine statistical significance between multiple groups. P < 0.05 was considered significant.

Journal: JCI Insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: ( A ) Representative field potential (FP) recordings from WT (WT1) and the homozygous RYR2 duplication iPSC-CMs for both patients (RYR2 Dup 1 and RYR2 Dup 2) at baseline (top) and following ISO (100 nM) treatment (bottom). ( B ) A bar graph summary showing the erratic beating frequency (i.e., arrhythmic events) present at baseline and following ISO treatment in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs for both patients. WT1-iPSC-CM baseline ( n = 158, SEM = 1.25), WT-iPSC-CM ISO ( n = 160, SEM = 1.5), RYR2 Dup 1-c1-iPSC-CM baseline ( n = 165, SEM = 1.9), RYR2 Dup 1-c1-iPSC-CM ISO ( n = 419, SEM = 1.7), RYR2 Dup 2-c1-iPSC-CM baseline ( n = 129, SEM = 2.9), RYR2 Dup 2-c1-iPSC-CM ISO ( n = 100, SEM = 3.8). ( C ) Representative FP recordings from WT1 control and RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) treatment alone, and following ISO with nadolol (10 μM). ( D ) A bar graph summary of the erratic beating frequency (i.e., arrhythmic events) present in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) and in response to pharmacotherapies (nadolol at 10 μM, propranolol at 1 μM, and flecainide at 6 μM). Data are shown as number of experiments, where each experiment includes data acquired from 250–500 electrode recordings each. WT1-iPSC-CM baseline ( n = 4, SEM = 1.5), ISO ( n = 12, SEM = 0.4), ISO + nadolol ( n = 12, SEM = 0.20), ISO + propranolol ( n = 12, SEM = 0.20), and ISO + flecainide ( n = 12, SEM = 1.7). RYR2 Dup 2-c1-iPSC-CM baseline ( n = 4, SEM = 3.9), ISO ( n = 12, SEM = 1.5), ISO + nadolol ( n = 12, SEM = 1.1), ISO + propranolol ( n = 12, SEM = 0.72), and ISO + flecainide ( n = 12, SEM = 1.2). Data are presented as mean ± SEM. The symbol *** represents P < 0.0001. A 1-way ANOVA with Tukey’s test was performed to determine statistical significance between multiple groups. P < 0.05 was considered significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: