|
Proteintech
dhrs9 Dhrs9, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dhrs9/product/Proteintech Average 94 stars, based on 1 article reviews
dhrs9 - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Addgene inc
pcms egfp rtp801 ![]() Pcms Egfp Rtp801, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcms egfp rtp801/product/Addgene inc Average 88 stars, based on 1 article reviews
pcms egfp rtp801 - by Bioz Stars,
2026-05
88/100 stars
|
Buy from Supplier |
|
Proteintech
anti redd1 ![]() Anti Redd1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti redd1/product/Proteintech Average 94 stars, based on 1 article reviews
anti redd1 - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Proteintech
p re ss article ![]() P Re Ss Article, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p re ss article/product/Proteintech Average 93 stars, based on 1 article reviews
p re ss article - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Boster Bio
anti ddit4 ![]() Anti Ddit4, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti ddit4/product/Boster Bio Average 94 stars, based on 1 article reviews
anti ddit4 - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Merck KGaA
polyclonal antibodies against full length rtp801 ![]() Polyclonal Antibodies Against Full Length Rtp801, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal antibodies against full length rtp801/product/Merck KGaA Average 90 stars, based on 1 article reviews
polyclonal antibodies against full length rtp801 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Proteostasis Therapeutics
rtp801 proteostasis ![]() Rtp801 Proteostasis, supplied by Proteostasis Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rtp801 proteostasis/product/Proteostasis Therapeutics Average 90 stars, based on 1 article reviews
rtp801 proteostasis - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
OPKO Health
pf-4523655 (rtp801 n i-14) ![]() Pf 4523655 (Rtp801 N I 14), supplied by OPKO Health, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pf-4523655 (rtp801 n i-14)/product/OPKO Health Average 90 stars, based on 1 article reviews
pf-4523655 (rtp801 n i-14) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Bio Basic Canada
primers for aβ-responsive genes and cloning of rtp801 and stc2 ![]() Primers For Aβ Responsive Genes And Cloning Of Rtp801 And Stc2, supplied by Bio Basic Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for aβ-responsive genes and cloning of rtp801 and stc2/product/Bio Basic Canada Average 90 stars, based on 1 article reviews
primers for aβ-responsive genes and cloning of rtp801 and stc2 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Databank Inc
human rtp801 ![]() Human Rtp801, supplied by Databank Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human rtp801/product/Databank Inc Average 90 stars, based on 1 article reviews
human rtp801 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Shigemi Inc
autophagy in lymphocytes (dig2/rtp801/redd1) protein mediates dexamethasone-induced gene 2 glucocorticoid elevation ![]() Autophagy In Lymphocytes (Dig2/Rtp801/Redd1) Protein Mediates Dexamethasone Induced Gene 2 Glucocorticoid Elevation, supplied by Shigemi Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/autophagy in lymphocytes (dig2/rtp801/redd1) protein mediates dexamethasone-induced gene 2 glucocorticoid elevation/product/Shigemi Inc Average 90 stars, based on 1 article reviews
autophagy in lymphocytes (dig2/rtp801/redd1) protein mediates dexamethasone-induced gene 2 glucocorticoid elevation - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
the specific short hairpin rna against rtp801 (rtp801-shrna) ![]() The Specific Short Hairpin Rna Against Rtp801 (Rtp801 Shrna), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the specific short hairpin rna against rtp801 (rtp801-shrna)/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
the specific short hairpin rna against rtp801 (rtp801-shrna) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: In vivo down‐regulation of RTP801 alleviates the pathological changes in A53T mice with CRS treatment. (A) Scheme of the in vivo experimental procedure. Lentivirus‐mediated RTP801 shRNA or scramble shRNA was stereotaxically injected into SNpc. CRS treatment was performed 7 days after the injection (n = 8). (B) Latency to fall off the rotarod were recorded 2 days after CRS treatment to evaluate motor coordination and balance of the experimental animals (mean ± SEM, n = 8). (C) Dopamine levels in the striatum were evaluated (mean ± SEM, n = 5). (D) The content of RTP801 and the accumulation of αSyn in mesencephalon were examined using Western blots. Data shown are means ± SEM, n = 5. *P<0.05, significantly different from scramble shRNA, # P<0.05, significantly different from scramble shRNA without CRS. (E) Immunofluorescence staining of TH (red) and RTP801 (green) in SNpc. Scale bar = 20 μm (mean ± SEM. n = 3).
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: In Vivo, shRNA, Injection, Western Blot, Immunofluorescence, Staining
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: Up‐regulated RTP801 with stress treatment reduces cell viability. (A) Immunofluorescence staining of TH (red) and RTP801 (green) in SNpc. Bar = 20 μm. RTP801+ cell in SNpc was calculated (mean ± SEM, n = 5). (B) The expression of RTP801 in mesencephalon (mean ± SEM, n = 5). (C) Cells were treated with or without corticosterone (CORT; 10 μM) for 48 h, and RTP801 was measured. Cell viability was evaluated using MTT in 96‐well plates (mean ± SEM, n = 5). (D) Different amounts of pcDNA‐RTP801 were transfected into cells in 6‐well plates. RTP801 expression and cell viability were evaluated 48 h after transfection. Data shown are means ± SEM, n = 5. *P<0.05, significantly different as indicated.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Immunofluorescence, Staining, Expressing, Transfection
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: CRS up‐regulates RTP801 via miR‐7 suppression. (A) Prediction of miR‐7 binding site in DDIT4 3′‐UTR by TargetScan. The consensus seed sequence in species is emphasized by the red box. (B) Expression of miR‐7 in mesencephalon was assessed using Q‐PCR. (C) MiR‐7 or scramble control transfected cells were lysed to examine the expression of RTP801. (D) The schematic diagram of DDIT4 3′‐UTR and DDIT4‐3′‐UTR‐MUT, which were constructed into a pmirGLO vector. (E) Cells transfected with DDIT4 3′‐UTR were treated with scramble control or miR‐7 and lysed for dual‐luciferase activity test. (F) DDIT4 3′‐UTR or DDIT4‐3′‐UTR‐MUT transfected cells were treated with or without miR‐7 and corticosterone (CORT) to examine dual‐luciferase activity. (G) Cells were treated with an anti‐miR‐7 and corticosterone to examine the effect on DDIT4 3′‐UTR. Data shown are means ± SEM, n = 5. *P<0.05, significantly different as indicated.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Binding Assay, Sequencing, Expressing, Transfection, Construct, Plasmid Preparation, Luciferase, Activity Assay
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: Inhibition of proteasomal degradation by αSyn A53T prolongs the biological half‐life of RTP801. (A) Cells transfected with pcDNA‐RTP801 were treated with CHX (10 μg·mL−1) for the indicated periods and lysed to examine the content of RTP801. (B) Cells transfected with pcDNA‐RTP801 were treated with or without MG‐132 (10 mM) for 24 h and subjected to Western blotting for RTP801. Data shown are means ± SEM, n = 5. *P<0.05, significantly different as indicated.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Inhibition, Transfection, Western Blot
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: RTP801‐triggered block of autophagy causes aggregation of αSyn. (A) Mesencephalic LC3‐II and p62 were examined. (B) Cells transfected with or without RTP801 siRNA were lysed to examine RTP801, LC3‐II, p62 and αSyn after corticosterone (CORT) treatment. Data shown are means ± SEM, n = 5. *P<0.05, significant effect of corticosterone, # P<0.05, significant effect of RTP801 siRNA. (C) Cells transfected with or without pcDNA‐RTP801 were subjected to p62 and αSyn testing after 24 h of 3‐MA (10 mM) treatment. Data shown are means ± SEM, n = 5. *P<0.05, significant effect of pcDNA‐RTP801, # P<0.05, significant effect of 3‐MA.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Blocking Assay, Transfection
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: ER stress and up‐regulated RTP801 reinforce each other in CRS‐treated A53T mice. (A) Mesencephalic Grp78, ATF4 and CHOP were tested. Data shown are means ± SEM, n = 5. *P<0.05, significant effect of CRS, #*P<0.05, significantly different from WT . (B) Cells were treated with or without corticosterone (CORT) and lysed to examine Grp78, ATF4 and CHOP. *P<0.05, significant effect of corticosterone; # P<0.05, significantly different from PC12. (C) RTP801 was investigated after corticosterone (CORT; 10 μM) or corticosterone plus salubrinal (5 μM) treated PC12‐A53T. (D) PC12‐A53T cells transfected with or without RTP801 siRNA were lysed to examine RTP801, Grp78, ATF4 and CHOP after corticosterone treatment. Data shown are means ± SEM, n = 5. *P<0.05, significantly different from control siRNA.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Transfection
Journal: British Journal of Pharmacology
Article Title: RTP801 is a critical factor in the neurodegeneration process of A53T α‐synuclein in a mouse model of Parkinson's disease under chronic restraint stress
doi: 10.1111/bph.14091
Figure Lengend Snippet: Schematic summary of the results. CRS treatment induced RTP801 up‐regulation and caused neurodegeneration, or even death, of TH+ cells in A53T mice. PD‐like pathogenesis was mediated by the robust enhancement of RTP801. Increased content of RTP801 occurred via inhibition of miR‐7, which post‐transcriptionally inhibited RTP801 expression and retarded proteasomal degradation. Up‐regulation of RTP801 intensified the toxicity of αSyn A53T for dopaminergic neurons. The crosstalk between ER stress and up‐regulated RTP801 reinforced the extra stress exposure. The block of autophagy that increased accumulation of oligomeric forms of αSyn aggravated the pathogenesis.
Article Snippet: RTP801 constructs were generated by PCR cloning (RTP801 forward, 5′‐GAATTCGAACCATGCCTAGCCTTTGGGATCG‐3′; RTP801 reverse, 5′‐CTCGAGTCAACACTCTTCAATGAGCA‐3′) from
Techniques: Inhibition, Expressing, Blocking Assay
Journal: Frontiers in Cellular Neuroscience
Article Title: RTP801/REDD1: a stress coping regulator that turns into a troublemaker in neurodegenerative disorders
doi: 10.3389/fncel.2014.00313
Figure Lengend Snippet: Schematic representation of the hypothesized regulation of mTOR/Akt by RTP801 in neurons . In physiological conditions the gene and the protein levels of RTP801 are low; mTOR is active and promotes protein translation (mTORC1) and Akt phosphorylation at Ser473 residue (mTORC2). These signals mediate neuronal survival (left panel). However, when neurons are under stress, RTP801 is induced at gene and protein levels, and promotes mTORC1 and mTORC2 inhibition through TSC1-TSC2 complex and Rheb protein. These events result in protein translation inhibition and prevent Akt phosphorylation at residues Ser473 and, consequently, at Thr308. If this mTOR/Akt repression is sustained over time neuron function is impaired and leads to neuron death (right panel). Illustration by Olivares-Boldú L .
Article Snippet: Apart from its rapid gene induction under stress,
Techniques: Phospho-proteomics, Residue, Inhibition
Journal:
Article Title: RNAi and small interfering RNAs in human disease therapeutic applications
doi: 10.1016/j.tibtech.2010.07.009
Figure Lengend Snippet: Small RNA-based therapeutics in clinical trials
Article Snippet: Macular edema , Ophthamology , Bevasinarib,
Techniques: shRNA, Expressing, Infection