Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot, Infection, Negative Control, Transfection, Luciferase, Construct, Activity Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Control, Stable Transfection, Plasmid Preparation, Inhibition, MTT Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Expressing

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot

Journal: The Journal of biological chemistry

Article Title: Atypical genotoxicity of carcinogenic nickel(II): Linkage to dNTP biosynthesis, DNA-incorporated rNMPs, and impaired repair of TOP1-DNA crosslinks.

doi: 10.1016/j.jbc.2023.105385

Figure Lengend Snippet: Figure 4. Loss of ribonucleotide reductase subunits in Ni(II)-treated cells. Whole-cell lysates were used for all Westerns. A, abundance of dNTP- producing proteins during cell cycle progression. H460 cells were arrested in the G1 phase by incubation with 0.5 μM PD-0332991 for 16 h and then collected for westerns at different times after release from the G1 block. B, distribution of H460 cells among different cell cycle phases following 6 h treatments with Ni(II). Data are means ± SD, n = 2. C, immunoblots of H460 cells treated with Ni(II) for 6 h or (D) 24 h. E, RRM1, RRM2 and c-MYC abundance in primary human cells treated with Ni(II) for 24 h. F, RRM1 levels in H460 and primary IMR90 cells after 72 h treatments with Ni(II). G, RRM1 abundance in G1 phase-arrested primary WI38 cells treated with Ni(II) for 24 h. Cells were incubated with 0.5 μM PD-0332991 for 24 h followed by the incubation with Ni(II) in the presence of the G1 phase blocker. H, mRNA levels measured by RT-qPCR in H460 cells treated with Ni(II) for 6 h. Means ± SD, n = 3. I, RRM1 and RRM2 depletion in H460 cells by 600 μM N(II) treatments for 6 h in the absence and presence of cycloheximide (100 μg/ml). A loss of a short-lived protein MCL1 serves as a biomarker of protein synthesis inhibition. J, immunoblots for RRM2B in Ni(II)-treated H460 and WI38 cells.

Article Snippet: Primary antibodies: p53 (Santa Cruz, sc-126), phospho-S15-p53 (Cell Signaling, 9284), acetyl-K382-p53 (Cell Signaling, 2525), phospho-T21-RPA32 (Abcam, ab109394), phospho-S4/8-RPA32 (Bethyl, A300-245A), RPA32 (Millipore, MABE285), phospho-S139-H2AX (Cell Signaling, 9718), phospho-S317-CHK1 (Cell Signaling, 2344), CHK1 (Cell Signaling, 2360), phospho-T68-CHK2 (Cell Signaling, 2344), CHK2 (Cell Signaling, 3440), phospho-S824-KAP1 (Bethyl, A300-767A), KAP1 (Bethyl, A300-274A), phospho-S1981ATM (Cell Signaling, 13050), ATM (Cell Signaling, 2873), phospho-T172-AMPK (Cell Signaling, 2531), phospho-S10histone H3 (Cell Signaling, 9701), cyclin A (Sigma, c4710), cyclin E (Santa Cruz, sc-247), c-MYC (Cell Signaling, 13987), TYMS (Cell Signaling, 9045), RRM1 #1 Ab (Cell Signaling, 3388 - antibody used in all main Figures), RRM1 #2 Ab (Cell Signaling, 8837 - antibody used in validation and confirmatory studies in Fig. S3), RRM2 #1 Ab (Cell Signaling, 65939 - antibody used in all main Figures), RRM2 #2 Ab (Abcam, ab172476 - antibody used in validation and confirmatory studies in Fig. S3), RRM2B (Invitrogen, 79938), RNaseH2A (ThermoFisher, PA5-78330), RNaseH2B (ThermoFisher, PA583560), RNaseH2C (ThermoFisher, PA5-100321), HIF1α (BD Biosciences, 610958), HIF2α (Cell Signaling, 7096), MCL1 (Cell Signaling, 5453), MDM2 (Cell Signaling, 86934), RAD51 (GeneTex, GTX100469), PCNA (Santa Cruz, sc-56), L7A (Cell J. Biol.

Techniques: Incubation, Blocking Assay, Western Blot, Quantitative RT-PCR, Biomarker Discovery, Inhibition

Journal: PloS one

Article Title: Conserved acidic amino acid residues in a second RNA recognition motif regulate assembly and function of TDP-43.

doi: 10.1371/journal.pone.0052776

Figure Lengend Snippet: Figure 1. Pivotal role of Glu246 and Asp247 in the conformation of the RRM2 domain of TDP-43. A. a, Scheme showing the alignment of RRM2 subdomains (residues 232–270 in human TDP-43) in multiple species. Glu246 (E246) and Asp247 (D247) are preserved across all species. b, Chemical properties of amino acid substitution mutants of E246 or D247. E246Q and D247N were used to create substitution mutants with minimal alteration of side chains. E246G and D247G were designed so that the effects of the side chains were eliminated, and the flexibility of the amide bonds was increased. B. Western blot analysis of recombinant RRM2 proteins of wild-type (WT), E246Q/D247N (QN), and E246G/D247G (GG), using an anti-TDP-43 rabbit polyclonal antibody that recognizes the RRM2 domain (Proteintech). The E246G/D247G mutant RRM2 showed marked oligomerization even when incubated at 4uC (vertical line). Note that considerable RRM2 dimers or oligomers were dissociated into monomers in the presence of DTT. Arrowhead and double arrowheads indicate RRM2 monomer and dimers, respectively. Asterisk possibly indicates heat-related high molecular complexes comprising RRM2 domain. C. Thioflavin T (ThT) fluorescence assay showing amyloid fibril formation of RRM2 with mutations in E246 and D247. Each value indicates averaged RFU of ThT with standard error of mean from triplicates. *p,0.01 vs. RRM2 WT at RT by one-way ANOVA with Newman-Keuls test. D. Superdex 75 size exclusion chromatography of recombinant RRM2 domain of WT (a), E246Q/D247N (QN, b), and E246G/D247G (GG, c). a, WT RRM2 alone was exclusively monomeric in its native condition (unfilled circle). Heat denaturation at 70uC for 10 min induced higher molecular assembly (filled circle). Arrowhead indicates the RRM2 oligomer. b, E246Q/D247N (QN) mutant RRM2 without stress was predominantly monomeric (unfilled circle). Heat denaturation markedly increased the ratio of oligomers to monomers (filled circle). c, E246G/D247G (GG) mutant existed as a mixture of monomer and oligomers at the baseline condition (unfilled circle). Higher molecular species were prominently

Article Snippet: To detect recombinant RRM2 proteins or full-length TDP-43 in cultured cells, rabbit polyclonal anti-TDP-43 antibody (ProteinTech Group Inc. Chicago, IL) was used (1:1000).

Techniques: Western Blot, Recombinant, Mutagenesis, Incubation, Fluorescence, Size-exclusion Chromatography

Journal: PloS one

Article Title: Conserved acidic amino acid residues in a second RNA recognition motif regulate assembly and function of TDP-43.

doi: 10.1371/journal.pone.0052776

Figure Lengend Snippet: Figure 2. D247 predominantly governs the conformation of RRM2. A. Coomassie staining of recombinant RRM2 protein with either single or double mutation(s) at E246 and D247 incubated for 24 hr at 4uC by denaturing SDS-PAGE. The effects of oligomerization were greater with the single mutant at D247 than at E246. Oligomerization is most prominent in the double E246G/D247G mutant. B. Size exclusion chromatography of RRM2 proteins of E246G and D247G incubated at 4uC (a) and 70uC for 10 min with 24 hr post incubation at 4uC. (b). The effect of oligomerization is more pronounced in the D247G mutant RRM2 than in the E246G in both the 4uC and 70uC conditions. Molecular size markers are as follows: bovine serum albumin (66 kDa), ovalbumin (43 kDa), superoxide dismutase 1 (32 kDa), myoglobin (17.6 kDa), and aprotinin (6.5 kDa). doi:10.1371/journal.pone.0052776.g002

Article Snippet: To detect recombinant RRM2 proteins or full-length TDP-43 in cultured cells, rabbit polyclonal anti-TDP-43 antibody (ProteinTech Group Inc. Chicago, IL) was used (1:1000).

Techniques: Staining, Recombinant, Mutagenesis, Incubation, SDS Page, Size-exclusion Chromatography

Journal: PloS one

Article Title: Conserved acidic amino acid residues in a second RNA recognition motif regulate assembly and function of TDP-43.

doi: 10.1371/journal.pone.0052776

Figure Lengend Snippet: Figure 3. Substitution mutants of full-length TDP-43 at E246 and D247 are readily misfolded. A. Confocal micrographs of HEK293A cells overexpressing EGFP-fused full-length TDP-43 (a, b, wild-type (WT), c, d, E246G, e, f, D247G, g, h, E246G/D247G). i, j, Percentages of transfected HEK293A cells harboring multiple puncta or inclusions (i, arrowheads) or displaying nucleus-excluded TDP-43 (unfilled arrowhead). (j). Scale bar indicates 30 mm. Data were expressed as the mean 6 SEM (N = 7–10). *p,0.05 vs. WT, #p,0.05 vs. E246G by one-way ANOVA with Newman-Keuls test. NS indicates not significant vs. WT. B. a, Western blotting showing the increased detergent-insolubility of TDP-43 with mutations at E246/D247, with defective nucleus localizing signal (mNLS), or devoid of RRM2 domain (DRRM2). Lysates from HEK293A cells transiently transfected with TDP-43- EGFP were separated into 1% TritonX100-soluble or -insoluble fractions. Top panel, anti-GFP; middle panel, anti-actin; bottom panel, anti-GAPDH. The GAPDH blot validates the successful separation between detergent-soluble and -insoluble components. b, Quantified insolubility of TDP-43-EGFP proteins with or without mutation at E246/D247 to glycine. Relative TDP-43-EGFP in the detergent-soluble or -insoluble fraction was obtained from the ratio of the GFP density to actin density from the densitometric value in each fraction (designated as insoluble TDP or soluble TDP, respectively). Insolubility index was obtained from the ratio of insoluble TDP to soluble TDP, and each value was standardized by the average ratio of WT. Data were expressed as the mean 6 SEM of four experiments.*p,0.05 vs. WT TDP-43-EGFP by one-way ANOVA with Newman-Keuls test. C. Size exclusion chromatography and Western blotting indicating the existence of oligomeric and monomeric states of full-length TDP-43 in cells. WT and E246G/ D247G (GG) TDP-43-FLAG genes were expressed in HEK293A cells. Cells were sonicated in PBS, and the supernatants were fractionated by a Superose 12 column (10/300) at a flow rate of 0.5 mL/min in PBS. Fractionated cell extracts were applied to Western blotting by anti-TDP-43 (Proteintech). Mutant TDP-43 (GG) proteins were collected in a larger fraction than 88–440 kDa. The molecular size markers thyroglobulin (669 kDa), ferritin (440 kDa), Mn-SOD (88 kDa), ovalbumin (43 kDa), and RNase (13.7 kDa) were eluted under the same conditions. Abs280 is presented to show the equal amount of proteins between WT and the GG mutant in each fraction. doi:10.1371/journal.pone.0052776.g003

Article Snippet: To detect recombinant RRM2 proteins or full-length TDP-43 in cultured cells, rabbit polyclonal anti-TDP-43 antibody (ProteinTech Group Inc. Chicago, IL) was used (1:1000).

Techniques: Transfection, Western Blot, Mutagenesis, Size-exclusion Chromatography, Sonication

Journal: PloS one

Article Title: Conserved acidic amino acid residues in a second RNA recognition motif regulate assembly and function of TDP-43.

doi: 10.1371/journal.pone.0052776

Figure Lengend Snippet: Figure 4. Oligomerization affects the nucleotide interaction and RNA splicing efficiency of TDP-43. A. Exon 9 skipping assay showing that mutations at E246 and D247 affect the RNA splicing activity of full-length TDP-43. a, Agarose gel electrophoresis of PCR products (top). Western blot analysis of the total cell lysates using anti-EGFP (middle) and -actin (bottom) antibodies was also shown. b, Quantification of spliced and unspliced fragments using densitometry. Each value is the ratio of spliced to unspliced PCR products. Data is mean 6 standard error of mean from triplicates. *p,0.01 vs. Wild-type (WT) TDP-43 by one-way ANOVA with Newman-Keuls test. B. Size exclusion chromatography for recombinant RRM2 proteins of WT (a), or mutants with E246Q/D247N (QN, b) or E246G/D247G (GG, c), and for (TG)12 oligonucleotides. Mixtures of RRM2 mutants and (TG)12 oligonucleotides were centrifuged at 15,0006g for 20 min and subjected to a Superdex75 (10/300) column at a flow rate of 0.5 mL/min in PBS. Only the RRM2 monomer showed a molecular shift with the (TG)12 oligonucleotides to a single peak, indicating their association (arrowheads). Molecular size markers are as follows: bovine serum albumin (66 kDa), ovalbumin (43 kDa), superoxide dismutase 1 (32 kDa), myoglobin (17.6 kDa), and aprotinin (6.5 kDa). *1 indicates free monomeric RRM2, *2 indicates oligomeric RRM2. Note that there is no peak for free (TG)12, indicating all the (TG)12 was bound to RRM2 monomers. doi:10.1371/journal.pone.0052776.g004

Article Snippet: To detect recombinant RRM2 proteins or full-length TDP-43 in cultured cells, rabbit polyclonal anti-TDP-43 antibody (ProteinTech Group Inc. Chicago, IL) was used (1:1000).

Techniques: Activity Assay, Agarose Gel Electrophoresis, Western Blot, Size-exclusion Chromatography, Recombinant

Journal: PloS one

Article Title: Conserved acidic amino acid residues in a second RNA recognition motif regulate assembly and function of TDP-43.

doi: 10.1371/journal.pone.0052776

Figure Lengend Snippet: Figure 5. 3B12A recognizes cytosol-redistributed TDP-43. A–D, SHSY-5Y cells were transiently transfected with TDP-43-EGFP of wild type (WT), mutants with defective NLS (mNLS), or deletion mutant of RRM2 deletion (DRRM2) (EGFP shown as green). At 48 h after transfection, cells were fixed and stained with 3B12A (red). DAPI was used for counterstaining (blue). A. a–f, Transfected or endogenous WT TDP-43 was rarely stained by 3B12A (unfilled arrowheads). Occasionally, cells with very high fluorescence were labeled (arrowhead). B. Cytosolic redistributed TDP-43 (mNLS) was preferentially stained by 3B12A (arrowheads). 3B12A recognized the mNLS mutant of TDP-43-EGFP even at moderate expression levels, regardless of aggregate formation. c–e are high power fields of a–b. C. Nuclear-excluded WT TDP-43 is recognized by 3B12A. WT TDP-43-EGFP expressing SHSY-5Y cells exposed to 5 mM lactacystin were fixed and stained with 3B12A (arrowheads). D. No reactivity of 3B12A to TDP-43-EGFP devoid of RRM2 (DRRM2) (unfilled arrowheads). E. Immunoprecipitation experiment showing that 3B12A preferentially recognized NLS-defective TDP-43 in cell lysates. HEK293A cells were transiently transfected with WT, mNLS, or FALS mutant (A315T and Q331K) forms of TDP-43-FLAG. Total lysates were immunoprecipitated with the 3B12A. Western blot analysis using a rabbit polyclonal anti-FLAG antibody showed that 3B12A predominantly recognized the defective NLS, but more weakly recognized the WT and FALS-linked mutant forms of TDP-43. doi:10.1371/journal.pone.0052776.g005

Article Snippet: To detect recombinant RRM2 proteins or full-length TDP-43 in cultured cells, rabbit polyclonal anti-TDP-43 antibody (ProteinTech Group Inc. Chicago, IL) was used (1:1000).

Techniques: Transfection, Mutagenesis, Staining, Fluorescence, Labeling, Expressing, Immunoprecipitation, Western Blot

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 1 RRM2 is involved in HBV-related HCC. Boxplot (A) and Pairwise boxplot (B) of RRM2 expression between HCC tumor tissues (T) and pericarcinoma tous tissues (P) using heatmaps from TCGA datasets. (C) The expression of RRM2 in HCC tumor tissues was compared with that in the pericarcinomatous tissues in the GSE25097 dataset. (D) RRM2 methylation between HCC tumor tissues and normal tissues in UALCAN dataset. (E) Association between RRM2 mRNA expression and specific cancer stages in HCC patients of UALCAN dataset. (F) Association between RRM2 mRNA expression and tumor grade in HCC patients of UALCAN dataset. (G) Positive area of RRM2 staining in HBV (-) or HBV (+) HCC tumor tissues and pericarcinomatous tissues, respectively and the overally. (H) Representative images of H&E staining, as well as HBx and RRM2 IHC staining in HBV-related liver cirrhosis tissues (n = 10), HBV-related HCC tissues and its corresponding pericarcinomatous tissues (n = 85). Scale bar: 100 μm. (I) Positive areas of RRM2 staining in specified tissues. (J) Relative RRM2 mRNA levels in human normal liver tissues (N), HBV-related HCC tissues (T) and its corresponding pericarcinomatous tissues (P) by qRT-PCR. n = 8 in each group. (K, L) RRM2 protein levels in indicated human liver tissues were determined by WB. ACTB was used as the loading control. n = 8 in each group. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Expressing, Methylation, Staining, Immunohistochemistry, Quantitative RT-PCR, Control

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 2 Increased RRM2 expression was related with a bad outcome in HCC patients. (A, B) Patients with high-expression levels of RRM2 had shorter OS and DFS times than low RRM2 expression patients in 148 samples. (C) Based on the TCGA dataset, the Kaplan-Meier survival curves depict the OS curves for HCC patients with high and low levels of RRM2 protein expression. (D) Time-dependent ROC curve analysis to assess the predictive efficacy of the prognostic signature. Patients with HCC from TCGA dataset were evaluated using univariate (E) and multivariate (F) Cox proportional hazards analysis to figure out the Hazard ratio (HR) of RRM2 for OS. (G) Nomogram for predicting the probability of 1-, 3-, and 5-year OS, DSS and PFI for HCC patients. (H) Calibration curve for predicting the probability of 1-, 3-, and 5-year OS for HCC patients. (I) DCA plots of the nomogram for predicting the probability of 1-, 3-, and 5-year OS for HCC patients by calculating the C-index

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Expressing

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 3 Analysis of RRM2 biological significance and potential molecular mechanism in HCC. (A) Heat map of top 10 DEGs in RRM2-high expression sam ples and low samples groups. (B) Expression correlation between RRM2 and representative genes (CCNB1, CDCA5, CCNB2, KIF4A, KIFC1, NCAPG, SPC25, TOP2A, TPX2, ZWINT) of the top RRM2 positive correlated genes in TCGA projects as determined. (C) GSEA of RRM2 in HCC. The 8 significant pathways of RRM2 GSEA results in HCC

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Expressing

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 6 HBx stimulated RRM2 expression in HCC. (A) RRM2 mRNA expression levels in LO2, HepG2, and HepG2.2.15 cells (n = 3). (B) Analysis of RRM2 protein levels in the indicated cells using WB analysis (n = 3). (C) HCC tumor tissues underwent double immunofluorescence staining for HBx and RRM2. The nuclei were dyed blue with DAPI. Scale bar: 200 μm. (n = 6). (D) The protein expression levels of RRM2 in LO2 and Huh-7 cells transfected with either LV-HBx or LV-NC plasmids were detected using the corresponding antibodies with ACTB as the control by WB. (E) Quantification of the relative RRM2 protein expression in cells (n = 3). (F, G) HBx and RRM2 protein expression in liver tissues of nude mice from the NC and HBx groups were determined by WB (n = 6). (H) Anti-HBx antibody was used to perform immunoprecipitation on the cell lysates. Anti-RRM2 antibody was used to identify endogenous RRM2 that was co-immunoprecipitated. (I) Representative images of RRM2 staining in liver tissues from the NC and HBx groups (n = 6). *P < 0.05, **P < 0.01

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Expressing, Double Immunofluorescence Staining, Transfection, Control, Immunoprecipitation, Staining

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 7 HBx-induced autophagosome production was inhibited by RRM2 blockade. LO2 or Huh-7 cells transfected with either LV-HBx or LV-NC plasmids were treated with/without siRRM2 for 48 h. (A) After treatment, RNA samples were then collected and relative gene expression ratios of RRM2 in cells were determined using RT-PCR analysis (n = 3). (B) Cell lysates were collected and analyzed by immunoblotting using anti-LC3B antibody. Quantification of the relative LC3B protein expression in cells (n = 3). (C) Huh-7 cells that had been genetically modified to express HBx were exposed to stubRFP-sensGFP-LC3 lentivirus, and then treated with si-RRM2 or si-NC for a period of 48 h. The nuclei are labeled with DAPI staining. Scale bar: 20 μm. (D) Measurement of the number of LC3 puncta in each field. (E) LC3 immunofluorescent staining in cells. Scale bar: 200 μm. (F) The mean number of LC3 puncta per cell was computed (n = 50 cells). (G, H) With transmission electron microscopy, double membrane autophagosome structures were identified in cells, as indicated by the arrows. Scale bar: 200 nm. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Transfection, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Genetically Modified, Labeling, Staining, Transmission Assay, Electron Microscopy, Membrane

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 8 HBx promoted HCC cell proliferation via RRM2. LO2 or Huh-7 cells transfected with either LV-HBx or LV-NC plasmids were treated with/without siRRM2 for 48 h. (A-C) Analysis of cell cycle distribution among different groups by flow cytometry. (D) EdU incorporation assay was used to assess cel lular proliferation following treatment. Scale bar: 200 μm. (E, F) Quantitative analysis of EdU-positive cells. (G) WB analysis of PCNA protein expression in LO2 or Huh-7 cells with the above treatments. (H) Quantitative of the relative PCNA protein expression in cells (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Transfection, Flow Cytometry, Expressing

Journal: Cell & bioscience

Article Title: HBx promotes tumorigenicity through RRM2-mediated autophagy in hepatocellular carcinoma.

doi: 10.1186/s13578-024-01298-2

Figure Lengend Snippet: Fig. 9 HBx promoted HCC cell apoptosis via RRM2. LO2 or Huh-7 cells transfected with the HA-HBx construct or empty NC were treated with/without siRRM2 for 48 h. (A) Analysis of apoptotic cells by flow cytometry. Representative Annexin V-FITC/PI-stained flow cytometry plots for apoptosis. (B, C) The proportion of apoptotic cells was displayed on the right panel. (D) WB analysis of BCL2 and Bax protein expression in LO2 or Huh-7 cells with the above treatments. (E) Quantitative of the relative BCL2 and Bax protein expression in cells (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Article Snippet: For tissue staining, slides were treated with primary antibody against HBx (Genetex, 22741), RRM2 (ABclonal, A3424), or SQSTM1/p62 (Proteintech, 18420).

Techniques: Transfection, Construct, Flow Cytometry, Staining, Expressing

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 is highly expressed in liver cancer. a The 180 ferroptosis-related factors that were downregulated were identified by TMT, RNA-seq and DNase-seq. b RRM2 was identified as the most significantly upregulated secretory or membrane-bound protein in liver cancer via data mining using the TCGA database. c Scatter plot for serum RRM2 in healthy individuals and patients with hepatitis A, hepatitis B, hepatitis C, lung cancer, gastric cancer, breast cancer, colorectal cancer or liver cancer. d RRM2 expression in the sera from healthy individuals and liver cancer patients, as was evaluated by immunoblotting. e TMA of RRM2 in liver cancer and normal liver tissues. Representative IHC images of TMA stained with anti-RRM2 antibodies are shown. Data were analyzed using a chi-square test. f The UALCAN database was used to analyze alterations in RRM2 expression between liver cancer (n = 371) and normal liver (n = 50) tissues. g Kaplan–Meier survival plots of RRM2 were obtained from the KM plotter database. h RRM2 was highly expressed in SMMC-7721 and HepG2 cell. RRM2 expression was measured by immunoblotting with anti-RRM2 antibodies in established hepatocyte (HL-7702) and liver cancer cell lines, as indicated. The IB data are representative images from three biological replicates. **P < 0.01 indicates statistical significance. Data in c were analyzed using a one-way ANOVA test. Data in e were analyzed using a chi-square test. Data in f were analyzed using Student’s t test. Data in g were analyzed using log rank analysis

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: RNA Sequencing, Membrane, Expressing, Western Blot, Staining

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 suppresses ferroptosis in liver cancer cells. a , b RRM2 protein ( a ) and mRNA levels ( b ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as analyzed by immunoblotting and qPCR, respectively. c – e Cell viability ( c ), cell death ( d ) and 4-HNE levels ( e ) were measured in HepG2 and SMMC-7721 cells with ectopically expressed or knocked down RRM2 before further treatment with Fer-1, ZVAD-FMK, Nec-1 or ectopically expressed RRM2. Cell viability was measured using a CellTiter-Glo luminescent cell viability assay, cell death was measured by staining with SYTOX Green followed by flow cytometry, and 4-HNE was measured by a kit from Abcam. f , g Cell death ( f ) and 4-HNE levels ( g ) were measured in HepG2 and SMMC-7721 cells treated with erastin (10 μM, 24 h) in the presence or absence of Fer-1 (1 μM, 24 h). The cells were also cultured with or without RRM2 T33E transfection, as indicated. h – j The levels of GSH ( h ), labile iron ( i ) and membrane-anchored phospholipids ( j ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown were analyzed. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from b − j were analyzed using a one-way ANOVA test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Over Expression, Knockdown, Western Blot, Cell Viability Assay, Staining, Flow Cytometry, Cell Culture, Transfection, Membrane

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 upregulates GSH by sustaining GSS. a The ferroptosis-related metabolic axis from glucose to GSH. b – g The levels of glycine ( b ), glutamate ( c ), cysteine ( d ), cystathionine ( e ), serine ( f ) and glucose ( g ) were measured in HepG2 and SMMC-7721 cells with or without ectopically expression or knocked down of RRM2. h , i mRNA levels of CBS , CTH , SHMT2 , GSS and GPX4 were analyzed by qPCR in HepG2 ( h ) and SMMC-7721 cells ( i ) administered the indicated treatment. j , k Protein levels of CBS, CTH, SHMT2, GSS and GPX4 were analyzed by immunoblotting in HepG2 and SMMC-7721 cells ( j ). The level of RRM2 was normalized to that of GAPDH, and the normalized level of RRM2 in the untreated group was arbitrarily set to 100% ( k ). ( l ) GSH levels were measured in WT and GSS −/− HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as indicated. The data are shown as the mean ± SD from three biological replicates. **P < 0.01 indicates statistical significance. Data from b − i and k − l were analyzed using one-way ANOVA

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Expressing, Western Blot, Over Expression, Knockdown

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Phosphorylation of RRM2 at T33 protects GSS from proteasome degradation. a pRRM2 and RRM2 were measured by immunoblotting using anti-RRM2 antibodies following electrophoresis in gels containing Phos-tag™, while GSS was measured by immunoblotting using anti-GSS antibodies following electrophoresis in conventional gels. HepG2 and SMMC-7721 cells were cultured in the presence or absence of erastin (10 μM) for 24 h. Relative pRRM2/RRM2 ratios between groups were also calculated and graphed. b RRM2 was phosphorylated at T33. pRRM2 and RRM2 levels were measured by immunoblotting with anti-Myc antibodies following electrophoresis in Phos-tag™-containing gels of HepG2 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. c RRM2 and GSS were measured by immunoblotting in RRM2 −/− HepG2 and SMMC-7721 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. d RRM2 and GSS were degraded by proteasomes. RRM2 and GSS were measured by immunoblotting in HepG2 cells with the indicated treatments. Erastin and MG132 were treated at concentrations of 10 μM and 8 μM, respectively, for 24 h. e Colocalization of GSS (upper) or RRM2 (lower) with PSMB5 in HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h). Scale bar, 20 μm. f Association of RRM2, GSS and PSMB5 in proteasomes isolated from HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h) in the presence of MG132 (8 μM, 24 h). Samples from affinity or control beads were analyzed in parallel. g Erastin (10 μM, 24 h) chase of GSS and RRM2 in RRM2 −/− HepG2 and SMMC-7721 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The levels of GSS were also normalized to those of GAPDH, and the normalized level of GSS in the 0 h group was arbitrarily set to 100%. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from a were analyzed using a one-way ANOVA test. Data from e were analyzed using Student’s t test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Phospho-proteomics, Western Blot, Electrophoresis, Cell Culture, Expressing, Isolation, Control

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Dephosphorylation of RRM2 stimulates RRM2 binding with GSS to promote their corecruitment to the proteasome and subsequent activation of ferroptosis. a , b Reciprocal IP experiments of RRM2 and GSS in RRM2 −/− HepG2 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The amount of proteins in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. c , d Reciprocal IP experiments for RRM2 and GSS in HepG2 cells with or without NU6102 (20 μM, 24 h) and SB203580 (10 μM, 24 h) treatment. The amount of protein in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. e Proximal protein ligation between endogenous GSS and the indicated exogenous RRM2-Myc, as measured by PLA in HepG2 cells expressing RRM2 WT , RRM2 T33A or RRM2 T33E . Scale bar, 20 μm. The PLA signals were also calculated and graphed, and the data from the “Empty” group were arbitrarily set to 1. f RRM2 WT , RRM2 T33A or RRM2 T33E was expressed in reconstituted RRM2 −/− HepG2 cells. Immunoprecipitations were acquired with anti-PSMB5 antibodies and further analyzed by immunoblotting using anti-RRM2 and anti-GSS antibodies. GSS and RRM2 enrichment in the immunoprecipitates was calculated as the normalization to the levels in whole-cell lysates (input). g – i GSH ( g ), cell death ( h ) and 4-HNE ( i ) were measured in HepG2 and SMMC-7721 cells with or without RRM2 knockdown before they were further treated with Fer-1 (1 μM, 24 h), ZVAD-FMK (20 μM, 24 h), Nec-1 (20 μM, 24 h), or ectopically expressed GSS, RRM2 T33A or RRM2 WT in the presence or absence of NU6102 (20 μM, 24 h). The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. The data from a – d and f – i were analyzed using one-way ANOVA

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: De-Phosphorylation Assay, Binding Assay, Activation Assay, Ligation, Expressing, Western Blot, Knockdown

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Relationship among serum RRM2, serum AFP and the parameters of liver function in liver cancer patients. The relationships between serum RRM2 levels and serum AFP ( a ), CEA ( b ), ALT( c ), AST ( d ), ALP ( e ), γ-GT ( f ), ALB ( g ), and total bilirubin ( h ) in liver cancer patients are shown. Data from 185 liver cancer patients (from three biological replicates) were used to analyze the relationship using Spearman's rank correlation coefficient

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques:

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Diagnostic value of serum RRM2 in predicting liver cancer. a ROC curves for serum RRM2, AFP, and the combination of serum RRM2 and AFP for the discriminating patients with liver cancer from healthy individuals. The AUC value represents the combined effects of the sensitivity and specificity of single or combined biomarkers in the diagnosis of patients with liver cancer. All the data were obtained from three biological replicates. b Serum RRM2 is positively associated with tumor stage in liver cancer patients. The first quartile of serum RRM2 levels in liver cancer patients was no more than 300 pg/ml, the second quartile was from 300 to 1200 pg/ml, and the bottom quartile was more than 1200 pg/ml. Liver cancer patients were divided into three groups according to these quartiles. All the data were from three biological replicates. The associations between tumor stage and serum RRM2 in liver cancer patients were analyzed using the χ 2 test. c Correlation between intracellular RRM2 and RRM2 in culture medium from liver cancer cell lines as analyzed by Spearman rank-correlation analysis. d RRM2 expression across multiple cancer types from the UALCAN database. TPM, transcriptions per million. e The model of the study. Under homeostasis, RRM2 is phosphorylated at the T33 site (can be dephosphorylated by NU6102) to sustain GSS and GSH levels and suppress potential ferroptosis. In the ferroptotic state, RRM2 is dephosphorylated and has increased affinity GSS, leading to the subsequent proteasomal degradation of both proteins. With such an effect, GSH eventually declines to facilitate ferroptosis. The data from a-c are shown from three biological replicates. Analysis of the receiver operator characteristics (ROC) and calculation of the area under the curve (AUC) was performed to find the diagnostic values of RRM2, AFP and the combination of RRM2 and AFP for the prediction of liver cancer. **P < 0.01 indicates statistical significance. Data from b were analyzed using the χ 2 test. Data from c were analyzed by Spearman rank-correlation analysis. Data in d were analyzed using Student’s t test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Diagnostic Assay, Biomarker Discovery, Expressing

Journal: Diagnostic Pathology

Article Title: RRM2 expression in different molecular subtypes of breast cancer and its prognostic significance

doi: 10.1186/s13000-021-01174-4

Figure Lengend Snippet: Clinical and pathological characteristics of patient cohort

Article Snippet: Rabbit polyclonal primary antibody against RRM2 (NBP1–31661), obtained from NOVUS Biological, Centennial, Co 80,112 USA was used at a dilution rate of 1:50. (DAB) was used as a chromogen, after that, hematoxylin was applied for counterstaining.

Techniques:

Journal: Diagnostic Pathology

Article Title: RRM2 expression in different molecular subtypes of breast cancer and its prognostic significance

doi: 10.1186/s13000-021-01174-4

Figure Lengend Snippet: Intense RRM2 expression in cancer breast ×200

Article Snippet: Rabbit polyclonal primary antibody against RRM2 (NBP1–31661), obtained from NOVUS Biological, Centennial, Co 80,112 USA was used at a dilution rate of 1:50. (DAB) was used as a chromogen, after that, hematoxylin was applied for counterstaining.

Techniques: Expressing

Journal: Diagnostic Pathology

Article Title: RRM2 expression in different molecular subtypes of breast cancer and its prognostic significance

doi: 10.1186/s13000-021-01174-4

Figure Lengend Snippet: Correlation between RRM2 protein expression and other clinicopathological variables

Article Snippet: Rabbit polyclonal primary antibody against RRM2 (NBP1–31661), obtained from NOVUS Biological, Centennial, Co 80,112 USA was used at a dilution rate of 1:50. (DAB) was used as a chromogen, after that, hematoxylin was applied for counterstaining.

Techniques: Expressing

Journal: Diagnostic Pathology

Article Title: RRM2 expression in different molecular subtypes of breast cancer and its prognostic significance

doi: 10.1186/s13000-021-01174-4

Figure Lengend Snippet: Kaplan-Meier disease free survival for RRM2 score in whole series

Article Snippet: Rabbit polyclonal primary antibody against RRM2 (NBP1–31661), obtained from NOVUS Biological, Centennial, Co 80,112 USA was used at a dilution rate of 1:50. (DAB) was used as a chromogen, after that, hematoxylin was applied for counterstaining.

Techniques:

Journal: Diagnostic Pathology

Article Title: RRM2 expression in different molecular subtypes of breast cancer and its prognostic significance

doi: 10.1186/s13000-021-01174-4

Figure Lengend Snippet: Kaplan-Meier DFS for RRM2 score in ER positive group

Article Snippet: Rabbit polyclonal primary antibody against RRM2 (NBP1–31661), obtained from NOVUS Biological, Centennial, Co 80,112 USA was used at a dilution rate of 1:50. (DAB) was used as a chromogen, after that, hematoxylin was applied for counterstaining.

Techniques:

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Gene Expression, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot

Journal: Cell Death Discovery

Article Title: Repositioning of a cyclin-dependent kinase inhibitor GW8510 as a ribonucleotide reductase M2 inhibitor to treat human colorectal cancer

doi: 10.1038/cddiscovery.2016.27

Figure Lengend Snippet: Role of RRM2 in CRC. ( a ) Summary view of RRM1, RRM2, and RRM2B expression profiles in human tumors using published human oncology microarray data (Oncomine). The number in each cell under ‘Cancer versus Normal’ corresponds to the amount of cancer types that contains a significantly different level of RRM1, RRM2, or RRM2B compared with normal corresponding tissue. Thresholds for significance are: fold expression>2; P -value<0.05 and ranking of gene in the analyses>top 10%. Red signifies the gene overexpression in the analyses; blue represents the gene underexpression. Intensity of color signifies the best rank of gene in those analyses. ( b ) A microarray dataset (GSE8671) of colorectal adenomas and adjacent normal mucosa was obtained from NCBI GEO database. Probe IDs of RRM2: 209773_s_at. ( c ) A microarray dataset (GSE1710) of patients with Crohn’s disease and ulcerative colitis was obtained from NCBI GEO database. RRM2 expression in these datasets was shown.

Article Snippet: Horseradish peroxidase-labeled goat anti-rabbit and anti-mouse secondary antibodies were purchased from Jackson ImmunoResearch (West Grove, PA, USA). pcDNA3-RRM2 plasmid was purchased from Addgene (Cambridge, MA, USA).

Techniques: Expressing, Microarray, Over Expression

Journal: Cell Death Discovery

Article Title: Repositioning of a cyclin-dependent kinase inhibitor GW8510 as a ribonucleotide reductase M2 inhibitor to treat human colorectal cancer

doi: 10.1038/cddiscovery.2016.27

Figure Lengend Snippet: Identification of GW8510 as a potential RRM2 inhibitor. ( a ) The chemical structures of GW8510. ( b ) HCT116 cells were treated with various doses of GW8510 for 72 h. The cell viability was analyzed by an MTT assay. ( c ) HCT116 cells were treated with various doses of GW8510 for 24 h. The protein expressions were analyzed by western blots. ( d ) HCT116 cells were treated with various doses of GW8510 for 24 h in the absence or presence of 5 μ M MG132. The protein expressions were analyzed by western blots. ( e ) HCT116 cells were transiently transfected with a RRM2-overexpressing (pcDNA3-RRM2) or a control (pcDNA3) plasmid for 48 h, and then treated with indicated doses of GW8510 for 24 h. The protein expressions were analyzed by western blots. ( f ) HCT116 cells were transiently transfected with a RRM2-overexpressing (pcDNA3-RRM2) or a control (pcDNA3) plasmid for 24 h, and then treated with indicated doses of GW8510 for 72 h. The cell viability was analyzed by an MTT assay.

Article Snippet: Horseradish peroxidase-labeled goat anti-rabbit and anti-mouse secondary antibodies were purchased from Jackson ImmunoResearch (West Grove, PA, USA). pcDNA3-RRM2 plasmid was purchased from Addgene (Cambridge, MA, USA).

Techniques: MTT Assay, Western Blot, Transfection, Control, Plasmid Preparation

Journal: Cell Death Discovery

Article Title: Repositioning of a cyclin-dependent kinase inhibitor GW8510 as a ribonucleotide reductase M2 inhibitor to treat human colorectal cancer

doi: 10.1038/cddiscovery.2016.27

Figure Lengend Snippet: The gene expression signatures of compounds most positively (mean score> 0.7 and P <0.01) correlated with that of RRM2 siRNA

Article Snippet: Horseradish peroxidase-labeled goat anti-rabbit and anti-mouse secondary antibodies were purchased from Jackson ImmunoResearch (West Grove, PA, USA). pcDNA3-RRM2 plasmid was purchased from Addgene (Cambridge, MA, USA).

Techniques: Gene Expression, Activity Assay

Journal: Cell Death Discovery

Article Title: Repositioning of a cyclin-dependent kinase inhibitor GW8510 as a ribonucleotide reductase M2 inhibitor to treat human colorectal cancer

doi: 10.1038/cddiscovery.2016.27

Figure Lengend Snippet: GW8510 induced autophagic cell death of CRC cells. ( a ) HCT116 cells were treated with various doses of GW8510 for 24 h. The protein expressions were analyzed by western blots. ( b ) HCT116 cells were treated with various doses of GW8510 for 48 h. The protein expressions were analyzed by western blots. ( c ) HCT116 cells were treated with 2 μ M GW8510 for 48 h in the absence or presence of 50 μ M ZVAD-FMK. The protein expressions were analyzed by western blots. ( d ) HCT116 cells were transiently transfected with RRM2 siRNA for 48 h, and then treated with 4 μ M GW8510 for 24 h. The protein expressions were analyzed by western blots. ( e ) HCT116 cells were transiently transfected with a RRM2-overexpressing (pcDNA3-RRM2) or a control (pcDNA3) plasmid for 48 h, and then treated with 4 μ M GW8510 for 24 h. The protein expressions were analyzed by western blots.

Article Snippet: Horseradish peroxidase-labeled goat anti-rabbit and anti-mouse secondary antibodies were purchased from Jackson ImmunoResearch (West Grove, PA, USA). pcDNA3-RRM2 plasmid was purchased from Addgene (Cambridge, MA, USA).

Techniques: Western Blot, Transfection, Control, Plasmid Preparation