Journal: Respiratory Research

Article Title: TIGIT/SHIP-1/RelB regulating Th1 inflammation in smoking induced COPD

doi: 10.1186/s12931-025-03400-9

Figure Lengend Snippet: RELB is an important transcriptional regulator of the COPD-Th1 inflammation. A t-SNE plot of cell annotations from the GSE173896 dataset. B t-SNE plot of extracted CD4 + T cell subpopulations from the GSE173896 dataset. C Heatmap of differential gene expression across CD4 + T cell clusters. D t-SNE plot of annotated groups of CD4 + T cells from the GSE173896 dataset. E Volcano plot of differential genes in Th1 subpopulations between the COPD and Control groups. F , G KEGG enrichment analysis results for differential genes in Th1; F represents upregulated genes, while G represents downregulated genes. H Venn diagram of upregulated differential genes in Th1 related to the transcription factor T-bet

Article Snippet: Immunoprecipitation was performed using 10 μl of ChIP-grade RelB antibody (Cell Signaling Technology, 10544 S) and 2 μl of the corresponding anti-rabbit IgG antibody. qRT-PCR was conducted on the ChIP products using primers targeting the TBX21 promoter binding site (Forward: ACTTCTGATCCTCTACCAACCCTC, Reverse: CATACACCCACGCTTCTGGTT).

Techniques: Gene Expression, Control

Journal: Respiratory Research

Article Title: TIGIT/SHIP-1/RelB regulating Th1 inflammation in smoking induced COPD

doi: 10.1186/s12931-025-03400-9

Figure Lengend Snippet: RelB activation in CD4 + T cells of CS mice enhances activation in a Th1 polarizing environment. A - C GSEA enrichment analysis of RelB in Th1 and Th2 differentiation, T cell receptor signaling pathway, and NF-Kappa B signaling pathway from GSE76925 . D , E Flow cytometry analysis representative plots and statistical analysis bar graphs of pRelB and T-bet in CD4 + T cells from Air and CS mice lungs ( n = 6). G , H Flow cytometry analysis representative plots and statistical analysis bar graphs of pRelB and T-bet after in vitro Th1 polarization of naive CD4 + T cells ( n = 3). Data are representative of three independent experiments and are presented as medians. * P < 0.05, ** P < 0.01

Article Snippet: Immunoprecipitation was performed using 10 μl of ChIP-grade RelB antibody (Cell Signaling Technology, 10544 S) and 2 μl of the corresponding anti-rabbit IgG antibody. qRT-PCR was conducted on the ChIP products using primers targeting the TBX21 promoter binding site (Forward: ACTTCTGATCCTCTACCAACCCTC, Reverse: CATACACCCACGCTTCTGGTT).

Techniques: Activation Assay, Flow Cytometry, In Vitro

Journal: Respiratory Research

Article Title: TIGIT/SHIP-1/RelB regulating Th1 inflammation in smoking induced COPD

doi: 10.1186/s12931-025-03400-9

Figure Lengend Snippet: RelB is a key transcription factor regulating T-bet in CD4 + T cells, while TIGIT/SHIP-1 can influence the expression levels of pRelB and T-bet in CD4 + T cells through the PI3K/AKT signaling pathway. A , B Co-localization analysis of SHIP-1 and CD4 in double immunofluorescence staining of lung tissues from Air and CS mice ( n = 3). C Electrophoresis of DNA binding sites in agarose gel. D PCR results analysis of TBX21 precipitated by anti-RelB antibody and IgG ( n = 3). E , F Flow cytometry analysis of pRelB and T-bet after co-culturing CD4 + T cells with different concentrations of the PI3K inhibitor LY294002 under Th1 polarization conditions, with representative images and statistical analysis dot plots ( n = 3). G , H Flow cytometry analysis of pRelB and T-bet after co-culturing CD4 + T cells with the TIGIT ligand CD155 recombinant protein, CD155 + 3-AC under Th1 polarization conditions, with representative images and statistical analysis dot plots ( n = 3). Data are representative of three independent experiments and are presented as medians. * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: Immunoprecipitation was performed using 10 μl of ChIP-grade RelB antibody (Cell Signaling Technology, 10544 S) and 2 μl of the corresponding anti-rabbit IgG antibody. qRT-PCR was conducted on the ChIP products using primers targeting the TBX21 promoter binding site (Forward: ACTTCTGATCCTCTACCAACCCTC, Reverse: CATACACCCACGCTTCTGGTT).

Techniques: Expressing, Double Immunofluorescence Staining, Electrophoresis, Binding Assay, Agarose Gel Electrophoresis, Flow Cytometry, Recombinant

Journal: Respiratory Research

Article Title: TIGIT/SHIP-1/RelB regulating Th1 inflammation in smoking induced COPD

doi: 10.1186/s12931-025-03400-9

Figure Lengend Snippet: The inhibition of RelB activation by (-)-DHMEQ significantly suppresses the expression of Th1. A - D Following co-culture of CD4 + T cells with the RelB inhibitor (-)-DHMEQ under Th1 polarization conditions, representative flow cytometry analysis and statistical violin plots of pRelB, T-bet, and IFN-γ are shown ( n = 4). E - G Flow cytometry analysis of pRelB, T-bet, and IFN-γ in lung CD4 + T cells from CS+(-)-DHMEQ and CS + Vehicle mice, along with representative plots and statistical violin plots ( n = 7). Data are representative of three independent experiments and are presented as medians. * P < 0.05, ** P < 0.01, **** P < 0.0001

Article Snippet: Immunoprecipitation was performed using 10 μl of ChIP-grade RelB antibody (Cell Signaling Technology, 10544 S) and 2 μl of the corresponding anti-rabbit IgG antibody. qRT-PCR was conducted on the ChIP products using primers targeting the TBX21 promoter binding site (Forward: ACTTCTGATCCTCTACCAACCCTC, Reverse: CATACACCCACGCTTCTGGTT).

Techniques: Inhibition, Activation Assay, Expressing, Co-Culture Assay, Flow Cytometry

Journal: International Journal of Molecular Sciences

Article Title: The RelB-BLNK Axis Determines Cellular Response to a Novel Redox-Active Agent Betamethasone during Radiation Therapy in Prostate Cancer

doi: 10.3390/ijms23126409

Figure Lengend Snippet: RelB expression determines radioprotector effect of BET in non-PCa cells and radio-killing effect of BET. PZ cells were treated with BET and/or RT (2 Gy) for 24 h. NF-kB transcription factor family expression levels and function were measured. ( A ) RT-PCR of RelB. ( B ) RelB binding activity. ( C ) Chip assay with RelB antibody to I2E promoter of MnSOD. ( D ) Representative Western blots and quantitative analysis of protein expression for PrEC cells and PZ cells. * p -value ≤ 0.05 when compared with vehicle. PCa cells (LNCaP, PC3, DU145) were treated with either BET and/or RT (2 Gy) for 24 h. NF-kB transcription factor family expression levels and function were measured. ( E ) RT-PCR of RelB of PC3 cells. ( F ) RelB binding activity of PCa cells. ( G ) Chip assay with RelB antibody to I2E promoter of MnSOD of PC3 cells. ( H ) Representative Western blots and quantitative analysis of protein expression of PCa cells. n = 3. * p -value ≤ 0.05 when compared with vehicle.

Article Snippet: siRNA RelB, siRNA BLNK, and scrambles were purchased from Santa Cruz Biotechnology and Thermo Fisher.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Activity Assay, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: The RelB-BLNK Axis Determines Cellular Response to a Novel Redox-Active Agent Betamethasone during Radiation Therapy in Prostate Cancer

doi: 10.3390/ijms23126409

Figure Lengend Snippet: RNA sequencing identifies BLNK as a novel complementary protein that is upregulated by BET-mediated RelB expression. ( A ) Upregulated molecules that were most significantly changed (threshold exp-value 10). The rank order is determined by the indicated p -values. ( B ) 5 regulator pathways that were most significantly changed (threshold p -value 1.3). All these top regulators contain NF-kB family, and regulator star (*) contains BLNK. ( C ) Venn diagrams identified BLNK as the one of the proteins that is upregulated in PZ cells and downregulated in PC3 cells. ( D ) Heat map demonstrated ~2000 common genes that are diversely expressed in PC3 and PZ cells by all the treatments. Red = Upregulation vs. vehicle; Blue = Downregulation vs. vehicle, in PZ vs. PC3 cells. ( E ) RelB and ( F ) BLNK in PCa ( n = 499) vs. normal prostate ( n = 52) from TCGA database vs. vehicle. PARD = Prostate Adenocarcinoma. RELB and BLNK expressions are presented in log2-transformed transcripts per kilobase million (TPM) values. p -value calculated from linear mixed model. ( G ) PPI between RELB (magenta) and BLNK (orange). Contacts (1–4) given following: (1) Hydrogen bond at Cys 343 (BLNK) and Leu127 (RelB); (2) Ionic bond at Arg427 (BLNK) and Glu290 (RelB); (3) Hydrogen bond at His431 (BLNK) and Arg136 (RelB); and (4) Hydrogen bond at Arg448 (BLNK) and Cys389 (RelB). ( H ) Docking and binding analysis with ZDOCK and PyMol suggesting the interaction at the Y300 residue of RelB and the conserved R32 and R51 residues of BLNK.

Article Snippet: siRNA RelB, siRNA BLNK, and scrambles were purchased from Santa Cruz Biotechnology and Thermo Fisher.

Techniques: RNA Sequencing, Expressing, Transformation Assay, Binding Assay, Residue

Journal: International Journal of Molecular Sciences

Article Title: The RelB-BLNK Axis Determines Cellular Response to a Novel Redox-Active Agent Betamethasone during Radiation Therapy in Prostate Cancer

doi: 10.3390/ijms23126409

Figure Lengend Snippet: RelB and BLNK exert their roles reversely in non-PCa cells vs. PCa cells with BET treatment. Cells were treated with BET for 24 h and then harvested for analysis. ( A ) Western blots of BLNK, RelB, and MnSOD upon BET treatment. ( B ) IP with RelB antibody in whole cells nuclear fraction (NE) after treatment with BET. R = Anti-rabbit antibody. G = Anti-goat antibody. ( C ) Proximity Ligation assay. Red = Binding of RelB and BLNK. Blue = Nucleus. Inserts indicate the binding of RelB and BLNK in the nuclei of PZ cells (yellow) but not in the nuclei of PC3 cells (yellow). Bar = 50 μm. ( D ) Representation of double immunogold electron microscopy of cells and quantification of gold bead number in nuclei. PZ cells or PC3 cells were labeled with anti-rabbit RelB antibody (6 nm gold beads, arrow heads) and anti-goat BLNK antibody (10 nm gold beads, arrow). The gold beads were localized primarily in the nuclei of PZ cells after BET treatment but less in the nuclei of PC3 cells. * p -value ≤ 0.05 when compared with vehicle. Twenty nuclei were counted per group.

Article Snippet: siRNA RelB, siRNA BLNK, and scrambles were purchased from Santa Cruz Biotechnology and Thermo Fisher.

Techniques: Western Blot, Proximity Ligation Assay, Binding Assay, Electron Microscopy, Labeling

Journal: International Journal of Molecular Sciences

Article Title: The RelB-BLNK Axis Determines Cellular Response to a Novel Redox-Active Agent Betamethasone during Radiation Therapy in Prostate Cancer

doi: 10.3390/ijms23126409

Figure Lengend Snippet: BLNK interaction with RelB is a signal for BET protection of RT-induced injury in normal tissues. Cells were transfected with siRNA (Santa Cruz biotechnology) for 48 h and then treated with BET for 24 h. Western blot analysis ( A ) and protein quantification of ( B ) PC3 and ( C ) PZ cells. n = 2. ( D ) IP analysis confirmed a decrease in RelB:BLNK axis with RelB knockdown. WC = Whole cell lysates. R = Anti-rabbit antibody. G = Anti-goat antibody. ( E ) Trypan Blue assay and ( F ) representative photograph indicates a decrease in cell viability with siRNA against RelB, BLNK, or RelB + BLNK with or without BET treatment. n = 3. * p -value < 0.05 vs. non-BET. Scale bar = 50 µm.

Article Snippet: siRNA RelB, siRNA BLNK, and scrambles were purchased from Santa Cruz Biotechnology and Thermo Fisher.

Techniques: Transfection, Western Blot, Knockdown

Journal: International Journal of Molecular Sciences

Article Title: The RelB-BLNK Axis Determines Cellular Response to a Novel Redox-Active Agent Betamethasone during Radiation Therapy in Prostate Cancer

doi: 10.3390/ijms23126409

Figure Lengend Snippet: Schematic of how BET-mediated ROS production sensitizes PCa cells toward death caused by RT while protecting non-PCa cells against injury from RT off-target effects. Aberrant redox homeostasis of cancer cells enables redox-modifying agent BET to enhance radiation therapy efficacy by selective sensitization. In normal cells under physiologic conditions, cellular redox status is kept at a low oxidizing level. A shift in cell redox status toward an oxidizing condition, from BET + RT, will stimulate the expression of RelB-BLNK and translocation to the nucleus, which leads to upregulation of the antioxidant system, including MnSOD. The upregulation of MnSOD maintains redox status in normal cells and promotes cell survival. To the contrary, cancer cells are usually under high oxidizing conditions. A comparable shift in ROS levels modulated by BET + RT to an extreme oxidizing condition will cause cell death. Green arrows = activation; Red line = inhibition.

Article Snippet: siRNA RelB, siRNA BLNK, and scrambles were purchased from Santa Cruz Biotechnology and Thermo Fisher.

Techniques: Expressing, Translocation Assay, Activation Assay, Inhibition

Journal: Nature communications

Article Title: Transcriptional repression by the HDAC4-RelB-p52 complex regulates multiple myeloma survival and growth.

doi: 10.1038/ncomms9428

Figure Lengend Snippet: Figure 2 | Transcriptional repression of Bim and BMF genes by RelB-p52. (a,b) Total RNA from JJN3 cells infected with lentiviruses expressing Control-Sh RNA or sh-RNAs targeting RelB or NF-kB2 was analysed by qRT–PCR for the expression of Bim and BMF. (c,d) Whole cell lysates from JJN3 cells and Bortezomib resistant RPMI-8226 cells infected with lentiviruses expressing the indicated sh-RNAs, were analysed for the indicated proteins by immunoblotting. (e,f) Recruitment of RelB and p52 to the endogenous Bim and BMF promoters. Chromatin from JJN3 cells was immunoprecipitated using a-RelB or a-p52 antibodies. Normal IgG was used as a control. Recruitment of RelB and p52 to the Bim (e) and BMF (f) promoters was analysed by PCR- amplification of the immunoprecipitated DNA using specific primers that amplified a 154-bp region ( 300 to 146) close to the Bim gene transcriptional start site and a 160-bp region ( 164 to 4) proximal to the BMF transcriptional start site. As a control, a region spanning 2476 to 2201 of the Bim promoter was also amplified using primers specific to this region (e lower panel). Amplified PCR products were analysed by running on agarose gels as indicated. Note that RelB-p52 were recruited specifically to a site that is 300 bp upstream but not to a region that is 2.4-kb upstream to the Bim transcriptional start site. (g) Combined depletion of Bim and BMF rescues RelB-depleted cells from apoptosis. JJN3 cells were infected with lentiviruses expressing control Sh-RNA or Sh-RNAs targeting Bim and BMF and were selected in puromycin prior to silencing RelB. Apoptosis was measured as explained above. Note the significant rescue from apoptosis of RelB-silenced cells in the absence of Bim and BMF. Error bars indicate s.d. n ¼ 3. Representative figures from —three to five experimental replicates are shown.

Article Snippet: The samples whole cell lysates, nuclear/cytosolic extracts and immunoprecipitates were separated by SDS–PAGE and analysed by immunoblotting with antibodies to NF-kB2 (Millipore, #06–413), RelB (Santa Cruz, Sc-226), HDAC4 (Cell Signaling, #5392), acetyl-Histone H3 (Cell Signaling, #9649), HA (12CA5, Roche), Flag (Sigma, F3165), alpha Tubulin (DM-1A, Biogenex), Bim (Cell Signaling #2933), BMF (Cell Signaling, #5889), cIAP2 (R&D systems, #AF8171), IkBa (Santa Cruz, #Sc371), phospho- IkBa (Cell Signaling, #2859), anti-LDH (Santa Cruz, Sc-33781), anti-HDAC1 (Cell Siganling #5356), b-catenin (Cell Signaling #8480), ERK1 (Cell Signaling, #9102), phospho-ERK1 (Cell Signaling, #9101), phospho-RelB (Cell Signaling, #5025), normal rabbit IgG (Santa Cruz, Sc-2027), normal mouse IgG (Santa Cruz, Sc#2025), HRP-conjugated anti-Rabbit (Cell Signaling #7074), and HRP-conjugated anti-Mouse (Cell Signaling #7076).

Techniques: Infection, Expressing, Control, Quantitative RT-PCR, Western Blot, Immunoprecipitation

Journal: Nature communications

Article Title: Transcriptional repression by the HDAC4-RelB-p52 complex regulates multiple myeloma survival and growth.

doi: 10.1038/ncomms9428

Figure Lengend Snippet: Figure 4 | RelB recruits HDAC4 and maintains repressive chromatin on Bim and BMF promters. Chromatin from control or RelB-depleted JJN3 cells was immunoprecipitrated with a-HDAC4, a-Acetyl H3 or normal IgG antibodies. Recruitment of HDAC4 to the BMF (a) and Bim (b) promoters (a and b left and middle panels) was analysed by PCR-amplification of the immunoprecipitated DNA using specific primers corresponding to BMF and Bim promoters. Note the loss of HDAC4 recruitment in the absence of RelB. Acetylation of Histone H3 on BMF and Bim promoters was analysed by ChIP assay using a-acetyl H3 antibody and PCR-amplification of immunoprecipitated DNA as explained above (a and b right panels). (c) Increased expression of proapoptotic Bim and BMF genes on HDAC4 depletion. Total RNA from JJN3 cells infected with lentiviruses expressing Control-Sh RNA or sh-RNA targeting HDAC4, was analysed by quantitative PCR for the expression of Bim and BMF and relative expression was plotted as indicated. (d) Increase in proapoptotic Bim but not BMF protein levels on HDAC4 depletion. Whole cell lysates from JJN3 cells infected with lentiviruses expressing indicated sh-RNAs, were analysed for the indicated proteins by immunoblotting. Note the elevation of Bim but not BMF protein levels on depletion of HDAC4. (e) RelB-p52 regulation of miR-221 in MM cells. RNA from JJN3 cells infected with lentiviruses expressing Control-sh RNA or sh-RNAs targeting RelB, NF- kB2 or HDAC4 were analysed by quantitative PCR for miR-221 expression. Note the down regulation of miR-221 on RelB or NF-kB2 depletion but not on HDAC4-depletion. (f) Exogenous miR-221 prevents elevation of BMF protein levels in RelB-depleted cells. JJN3 cells infected with control or miR-221 expressing lentiviruses were superinfected with lentiviruses expressing control-Sh RNA or sh-RNA targeting RelB. Whole cell lysates were analysed by immunoblotting for the indicated proteins. Note the elevation of Bim protein levels in RelB depleted cells in both control and miR-221 overexpressing cells, whereas BMF protein levels were increased only in RelB depleted control but not in miR-221 over expressing cells. *non-specific band. Error bars indicate s.d. n ¼ 3. Representative figures from 3 experimental replicates are shown.

Article Snippet: The samples whole cell lysates, nuclear/cytosolic extracts and immunoprecipitates were separated by SDS–PAGE and analysed by immunoblotting with antibodies to NF-kB2 (Millipore, #06–413), RelB (Santa Cruz, Sc-226), HDAC4 (Cell Signaling, #5392), acetyl-Histone H3 (Cell Signaling, #9649), HA (12CA5, Roche), Flag (Sigma, F3165), alpha Tubulin (DM-1A, Biogenex), Bim (Cell Signaling #2933), BMF (Cell Signaling, #5889), cIAP2 (R&D systems, #AF8171), IkBa (Santa Cruz, #Sc371), phospho- IkBa (Cell Signaling, #2859), anti-LDH (Santa Cruz, Sc-33781), anti-HDAC1 (Cell Siganling #5356), b-catenin (Cell Signaling #8480), ERK1 (Cell Signaling, #9102), phospho-ERK1 (Cell Signaling, #9101), phospho-RelB (Cell Signaling, #5025), normal rabbit IgG (Santa Cruz, Sc-2027), normal mouse IgG (Santa Cruz, Sc#2025), HRP-conjugated anti-Rabbit (Cell Signaling #7074), and HRP-conjugated anti-Mouse (Cell Signaling #7076).

Techniques: Control, Immunoprecipitation, Expressing, Infection, Real-time Polymerase Chain Reaction, Western Blot

Journal: Nature communications

Article Title: Transcriptional repression by the HDAC4-RelB-p52 complex regulates multiple myeloma survival and growth.

doi: 10.1038/ncomms9428

Figure Lengend Snippet: Figure 7 | ERK1 dependent RelB phosphorylation and Bim repression. (a) Whole cell lysates from the indicated MM cell lines were analysed for phospho (S573) and total RelB by immunoblotting as indicated. (b) Whole-cell lysates from CD138 þ enriched primary MM cells from human patients and CD19 þ

Article Snippet: The samples whole cell lysates, nuclear/cytosolic extracts and immunoprecipitates were separated by SDS–PAGE and analysed by immunoblotting with antibodies to NF-kB2 (Millipore, #06–413), RelB (Santa Cruz, Sc-226), HDAC4 (Cell Signaling, #5392), acetyl-Histone H3 (Cell Signaling, #9649), HA (12CA5, Roche), Flag (Sigma, F3165), alpha Tubulin (DM-1A, Biogenex), Bim (Cell Signaling #2933), BMF (Cell Signaling, #5889), cIAP2 (R&D systems, #AF8171), IkBa (Santa Cruz, #Sc371), phospho- IkBa (Cell Signaling, #2859), anti-LDH (Santa Cruz, Sc-33781), anti-HDAC1 (Cell Siganling #5356), b-catenin (Cell Signaling #8480), ERK1 (Cell Signaling, #9102), phospho-ERK1 (Cell Signaling, #9101), phospho-RelB (Cell Signaling, #5025), normal rabbit IgG (Santa Cruz, Sc-2027), normal mouse IgG (Santa Cruz, Sc#2025), HRP-conjugated anti-Rabbit (Cell Signaling #7074), and HRP-conjugated anti-Mouse (Cell Signaling #7076).

Techniques: Phospho-proteomics, Western Blot

Journal: Nature communications

Article Title: Transcriptional repression by the HDAC4-RelB-p52 complex regulates multiple myeloma survival and growth.

doi: 10.1038/ncomms9428

Figure Lengend Snippet: Figure 8 | A Model that integrates HDAC4, p52, RelB and ERK1 into MM cell survival. (a) A novel HDAC4–RelB–p52 complex is frequently formed in MM cells that maintains deacetylated state of histones around Bim and BMF loci leading to transcriptional repression of both Bim and BMF genes and promotes MM cell survival. (b) Disruption of RelB–HDAC4 complex by a HDAC4-mimetic-peptide results in impaired repression of Bim and BMF loci leading to enhanced expression of Bim and BMF and apoptosis of MM cells. (c) RelB-p52 repress BMF in a two-step mechanism: 1) Transcriptional repression of BMF promoter by the HDAC4–RelB–p52 complex that maintains deacetylated state of histones and 2) Regulation of miR-221 expression by RelB-p52. RelB-p52 induced expression of miR-221 will further repress the BMF by impairing the translation of BMF mRNA. (d) ERK1 is a novel RelB-kinase. In MM cells RelB and ERK1 constitutively interact with each other. ERK1 is constitutively in an active form that phosphorylates RelB leading to nuclear accumulation of phospho-RelB and phospho-RelB dependent repression of Bim promoter. ERK1 might phosphorylate RelB in the cytoplasm, nucleus or on the promoter itself. Specific inhibition of ERK1 is sufficient to block RelB-phosphorylation leading to enhanced Bim expression and MM cell apoptosis.

Article Snippet: The samples whole cell lysates, nuclear/cytosolic extracts and immunoprecipitates were separated by SDS–PAGE and analysed by immunoblotting with antibodies to NF-kB2 (Millipore, #06–413), RelB (Santa Cruz, Sc-226), HDAC4 (Cell Signaling, #5392), acetyl-Histone H3 (Cell Signaling, #9649), HA (12CA5, Roche), Flag (Sigma, F3165), alpha Tubulin (DM-1A, Biogenex), Bim (Cell Signaling #2933), BMF (Cell Signaling, #5889), cIAP2 (R&D systems, #AF8171), IkBa (Santa Cruz, #Sc371), phospho- IkBa (Cell Signaling, #2859), anti-LDH (Santa Cruz, Sc-33781), anti-HDAC1 (Cell Siganling #5356), b-catenin (Cell Signaling #8480), ERK1 (Cell Signaling, #9102), phospho-ERK1 (Cell Signaling, #9101), phospho-RelB (Cell Signaling, #5025), normal rabbit IgG (Santa Cruz, Sc-2027), normal mouse IgG (Santa Cruz, Sc#2025), HRP-conjugated anti-Rabbit (Cell Signaling #7074), and HRP-conjugated anti-Mouse (Cell Signaling #7076).

Techniques: Disruption, Expressing, Inhibition, Blocking Assay, Phospho-proteomics

Journal: Brain, behavior, and immunity

Article Title: Intermittent cytomegalovirus infection alters neurobiological metabolism and induces cognitive deficits in mice

doi: 10.1016/j.bbi.2023.12.033

Figure Lengend Snippet: Brain cell characterization flow panel.

Article Snippet: GBP2 , CF405M , Biorbyt , orb763167 , 1:200.

Techniques: