|
Eurofins
gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv Gene Desert Region Fw Tttcctgcctctgcctttta Eurofins Gene Desert Region Rv, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pm40460200-785-203-202?v=Eurofins Average 86 stars, based on 1 article reviews
gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Aviva Systems
recombinant adnp peptide ![]() Recombinant Adnp Peptide, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pm38926592-220-16-1?v=Aviva+Systems Average 92 stars, based on 1 article reviews
recombinant adnp peptide - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Aviva Systems
tead ![]() Tead, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pmc05733494__supp_gad__301184__117_Supplemental_material-169-38-40?v=Aviva+Systems Average 90 stars, based on 1 article reviews
tead - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Aviva Systems
psmal antibody center affinity purified rabbit polycolonal antibody catalog oaab02483 aviva systems biology ![]() Psmal Antibody Center Affinity Purified Rabbit Polycolonal Antibody Catalog Oaab02483 Aviva Systems Biology, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/us11591395-194-20-30?v=Aviva+Systems Average 91 stars, based on 1 article reviews
psmal antibody center affinity purified rabbit polycolonal antibody catalog oaab02483 aviva systems biology - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Aviva Systems
polyclonal rabbit anti muc1 antibody ![]() Polyclonal Rabbit Anti Muc1 Antibody, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/us09845362-1178-44-48?v=Aviva+Systems Average 91 stars, based on 1 article reviews
polyclonal rabbit anti muc1 antibody - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Aviva Systems
oaab19416 fbxl2 ![]() Oaab19416 Fbxl2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pmc11263397__41467_2024_50031_MOESM5_ESM-57-17-13?v=Aviva+Systems Average 92 stars, based on 1 article reviews
oaab19416 fbxl2 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Aviva Systems
asbt n ![]() Asbt N, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pmc03933907__srep04163___s1-41-9-14?v=Aviva+Systems Average 90 stars, based on 1 article reviews
asbt n - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Aviva Systems
prss55 antibody ![]() Prss55 Antibody, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pmc12729118-173-0-6?v=Aviva+Systems Average 93 stars, based on 1 article reviews
prss55 antibody - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Aviva Systems
anti ptdss1 ![]() Anti Ptdss1, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/10__36721_slash_pjps__2025__38__2__reg__12295__1-79-9-19?v=Aviva+Systems Average 93 stars, based on 1 article reviews
anti ptdss1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
ECM Biosciences
ap3851 ![]() Ap3851, supplied by ECM Biosciences, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/us10703811-767-1-3?v=ECM+Biosciences Average 91 stars, based on 1 article reviews
ap3851 - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Aviva Systems
anti cars2 ![]() Anti Cars2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pm40738651-36-31-38?v=Aviva+Systems Average 93 stars, based on 1 article reviews
anti cars2 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Boster Bio
anti zbp1 ![]() Anti Zbp1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/region/pmc13006297-220-20-27?v=Boster+Bio Average 93 stars, based on 1 article reviews
anti zbp1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 1. Common commercially available ADNP antibodies give rise to non-specific binding. HEK293T, HeLa, SHSY-5Y and a lymphoblastoid control cell line (LCL) were lysed in RIPA buffer and used as protein samples for the assessment of the published ADNP antibodies. Samples were blocked and incubated in 5% blocking-grade non-fat dry milk/TBST with the optimized dilution listed in Table 3. The predicted molecular weight of ADNP is 124 kDa. However, only non-specific signals were detectable. GAPDH was used as a loading control. The datasheet of the tested antibodies indicated that whole or nuclear extracts from HeLa cells should be used as a positive control, which fails to raise a reliable ADNP signal in all tested antibody conditions.
Article Snippet: Recently,
Techniques: Binding Assay, Control, Incubation, Blocking Assay, Molecular Weight, Positive Control
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 2. Verification of the specificity of an N-terminal ADNP antibody (Aviva Systems) by performing a blocking peptide competition assay. (A) HEK293T, HeLa, SHSY-5Y and a control lymphoblastoid cell line (LCL) were lysed in RIPA buffer and used as protein samples for the assessment of N-terminal antibody of Aviva systems in a 1:1000 dilution. GAPDH was used as a loading control. The predicted molecular weight of ADNP is 124 kDa. The antibody recognizes ADNP specifically at 150 kDa in HEK293T, HeLa and SHSY-5Y cell lines, but a faint signal ranging from 75 to 150 kDa in the control LCL. (B) Western blot analysis of the blocking peptide competition assay. Supplementation of the immunization peptide in a 5 × excess to antibody concentration reduced the signal detected at 75- 150 kDa in all tested cell lines. Non-specific binding was detected after use of the immunization peptide presenting as a faint signal below the 37 kDa marker.
Article Snippet: Recently,
Techniques: Blocking Assay, Competitive Binding Assay, Control, Molecular Weight, Western Blot, Concentration Assay, Binding Assay, Marker
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 3. A polyclonal N-terminal ADNP antibody from Aviva Systems detects ADNP specifically in murine and rat tissues and suggests proteolytic processing of the protein in the human brain. Cerebellum, frontal cortex or lobe, hippocampus and whole brains of control mice, rats and humans were lysed in RIPA buffer and used as protein samples for the assessment of N-terminal antibody of Aviva systems. (A–C) The predicted molecular weight of ADNP is 124 kDa. The antibody recognizes ADNP in a range of 145 kDa with (E) additional lower mass signal of 85 kDa in all human brain regions. (B–D–F) Western blot analysis of the blocking peptide competition assay. Supplementation of the immunization peptide in a 5 × excess to antibody concentration reduced the signal observed at 145 kDa in all tested cell lines. Importantly, the 85 kDa band suggestive for proteolytic cleavage as well as degraded ADNP signal disappeared completely after immunization peptide supplementation. GAPDH was used as a loading control.
Article Snippet: Recently,
Techniques: Control, Molecular Weight, Western Blot, Blocking Assay, Competitive Binding Assay, Concentration Assay
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 4. Three independent commercially available C-terminal polyclonal ADNP antibodies detect ADNP specifically in different in vitro sample materials and show clear instability of the protein. HEK293T, HeLa, SHSY-5Y and a lymphoblastoid cell line (LCL) were lysed in RIPA buffer and used as protein samples for three different C-terminal ADNP antibodies. GAPDH was used as a loading control. The predicted molecular weight of ADNP is 124 kDa. All the tested antibodies recognized ADNP with a molecular weight of 150 kDa. Samples were blocked and incubated in 5% blocking-grade non-fat dry milk/TBST with the optimized dilution listed in Table 3.
Article Snippet: Recently,
Techniques: In Vitro, Control, Molecular Weight, Incubation, Blocking Assay
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 5. Different C-terminal ADNP antibodies detect ADNP in the range of 150 kDa and suggest proteolytic processing of the protein in the brain. Cerebellum, frontal cortex or lobe, hippocampus and whole brains of control mice, rats, and humans were lysed in RIPA buffer and used as protein samples for the assessment with three C-terminal antibodies with the optimized dilutions listed in Table 3. GAPDH was used as a loading control. The predicted molecular weight of ADNP is 124 kDa. (A)C) Murine samples indicate detection of ADNP in the range of 150 kDa with bands suggesting proteolytic processing at 50 kDa. (D–F) Rat samples indicate detection of ADNP in the range of 150 kDa with bands indicating proteolytic processing at 82 kDa after incubation with the C-terminal Abcam antibody. (G–I) Human brain samples indicate detection of ADNP at different molecular weights of 124 – 150 kDa in the adult frontal lobe and hippocampus and highlight the antibody differences in detection of ADNP. The three tested antibodies showed strong band signals at lower molecular weights, which could indicate proteolytic cleavage or degradation of the protein.
Article Snippet: Recently,
Techniques: Control, Molecular Weight, Incubation
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 6. Unambiguous detection of ADNP using homozygous CRISPR/Cas9 endonuclease-mediated Adnp knockout cell lines. mESCs containing either wild-type, homozygous mutants, or complete Adnp knockout were lysed in RIPA buffer and used as protein samples for the assessment with an N-terminal ADNP, 3x-DYKDDDDK, and C-terminal ADNP antibodies with the optimized dilutions listed in Table 1. GAPDH was used as a loading control. The predicted molecular weight of ADNP is 124 kDa. (A) The N-terminal antibody (Aviva Systems) recognizes ADNP in a range above its observed 150 kDa molecular weight with additional lower mass signal of 37—65 kDa in Adnp homozygous and parental control mESCs. (B) Supplementation of the immunization peptide in a 5 × excess to antibody concentration reduced all signals observed mESC lines, indicating that the N-terminal antibody does not bind ADNP specifically in mESCs. (C) Detection of wild- type and homozygous Adnp mutants by means of a C-terminal 3x-DYKDDDDK (Flag) epitope tag. Wild-type ADNP was detected in at 150 kDa in the C-terminal 3x-DYKDDDDK CRISPR/Cas9 engineered mESC line using a DYKDDDDK antibody. Truncated ADNP mutants, p.Tyr718* and p.Lys407Valfs*31, were detected at a lower molecular weight of 80 kDa, respectively 48 kDa. (D–F) Wild-type ADNP detection by means of three different C-terminal antibodies in mESC lines. Wild-type ADNP was detected with a strong signal at 150 kDa in the parental control line with a rather decreased signal in the C-terminal 3x-DYKDDDDK CRISPR/Cas9 engineered mESC line. Disappearance of the 150 kDa band was observed in the mESC line with complete Adnp homozygosity, indicating a reliable molecular weight of 150 kDa for ADNP.
Article Snippet: Recently,
Techniques: CRISPR, Knock-Out, Control, Molecular Weight, Concentration Assay, FLAG-tag
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 7. Unambiguous detection of ADNP using an N-terminal GFPSpark and N-DYKDDDDK (Flag) tag expression vector. (A) Western blot analysis of HEK293T cell lysates overexpressing wild-type ADNP- GFPSpark and mutated constructs using an anti-GFP antibody. (B) Western blot analysis of HEK293T cell lysates overexpressing wild-type ADNP-GFPSpark and mutated constructs using the N-terminal ADNP antibody (Aviva Systems). (C) Western blot analysis of HEK293T cell lysates overexpressing wild-type ADNP- DYKDDDDK (Flag) and mutated constructs using an anti-DYKDDDDK antibody. (D) Western blot analysis of HEK293T cell lysates overexpressing wild-type ADNP-DYKDDDDK and mutant constructs using the N-terminal ADNP antibody (Aviva Systems). The observed molecular weight of wild-type ADNP-GFPSpark is 175 kDa (including 25 kDa GFPSpark tag), respectively ADNP-DYKDDDDK 150 kDa, with each of their mutants showing a lower molecular weight as a consequence of the truncating mutations. Detection with antibodies for GFP, DYKDDDDK (Flag), and ADNP gave comparable results. GAPDH was used as a loading control in all experiments.
Article Snippet: Recently,
Techniques: FLAG-tag, Expressing, Plasmid Preparation, Western Blot, Construct, Mutagenesis, Molecular Weight, Control
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 8. Western blotting of ADNP in a HCT116 colon cancer cell line, carrying the prevalent heterozygous p.Tyr719* mutation. HCT116 cells containing a wild-type and p.Tyr719* mutant allele were lysed in RIPA buffer and used as protein samples for the assessment with an N-terminal antibody, 3x-DYKDDDDK, HA-tag, and C-terminal ADNP antibodies with the optimized dilutions listed in Table 1. GAPDH was used as a loading control in all experiment. The predicted molecular weight of ADNP is 124 kDa. (A) The N-terminal antibody (Aviva Systems) recognizes ADNP in a range above its observed 150 kDa molecular weight an additional signal of 45 kDa, indicating proteolytic cleavage or non-specific binding. (B) Administration of the immunization peptide in a 5 × excess to antibody concentration reduced all signals, indicating that the N-terminal antibody does not bind ADNP specifically in HCT116 cells. (C) Detection of wild-type ADNP by means of the 3x-DYKDDDDK (Flag) epitope tag. Wild-type ADNP was detected in at 182 kDa in the 3xFlag-V5-loxP- neonGreen/3xHA-loxP-mCherry engineered line using a DYKDDDDK antibody, 32 kDa by tag insertion. (D) Detection of mutant ADNP by means of the HA-epitope tag. A truncated mutant p.Tyr719 ADNP protein was detected in at 105 kDa in the 3xFlag-V5-loxP-neonGreen/3xHA-loxP-mCherry engineered line using a HA-antibody, 25 kDa above its predicted molecular weight by tag insertion. Instability of the truncated protein was observed by a degrading smear. (E–G) Wild-type ADNP detection by means of three different C-terminal antibodies. Non-processed ADNP was detected with a strong signal at 150 kDa in the control line and at a molecular weight of 182 kDa in the genome-edited cell line. In both cases, a degrading smear was observed, indicating instability of the wild-type protein.
Article Snippet: Recently,
Techniques: Western Blot, Mutagenesis, Control, Molecular Weight, Binding Assay, Concentration Assay, FLAG-tag
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 9. Western blotting of ADNP in human induced pluripotent stem cells (hiPSCs), carrying distinct heterozygous ADNP mutations mediated by CRIPSR/Cas9. (A, B) hiPSCs were lysed in RIPA buffer and analyzed by western blotting with the N-terminal antibody (Aviva Systems) with application of our blocking peptide competition assay. Here, no reliable ADNP signal was detected. The molecular weight of the ADNP mutant lines is expected to decrease to 127 kDa for the Asn832Lysfs*81, respectively to 48 kDa for the lys408Valfs*31 line. However, no signal is observed at the predicted weight for the mutations. (C–E) The C-terminal antibodies of Protein Technology, Abcam, and the Sarma Laboratory were able to visualize wild- type ADNP at 150 kDa. Possessing the desired epitope for mutant ADNP detection, the C-terminal antibody of Protein technology was not able to capture the predicted truncated protein. GAPDH was used as a loading control. (F) The ADNP signal was quantified determining the ratio of the wild-type protein in mutant to control cell lines. Here, the relative ADNP expression decreased in the Asn832Lysfs*81 cell line compared to the control, whereas mutant-to-wild-type expression ratio showed a higher signal with the antibodies of Protein Technology and Abcam in the lys408Valfs*31 cell line.
Article Snippet: Recently,
Techniques: Western Blot, Blocking Assay, Competitive Binding Assay, Molecular Weight, Mutagenesis, Control, Expressing
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 10. Absence of a mutant ADNP protein after immunoblotting of different lymphoblastoid cell lines from Helsmoortel-Van der Aa syndrome patients. (A) LCLs of four control subjects and six patients were lysed in RIPA buffer and analyzed by western blotting with the N-terminal antibody (Aviva Systems). The expected wild-type ADNP signal presented at 150 kDa together with two non-specific bands at 50 kDa and 75 kDa with no difference in expression (p = 0.42; ns) of the wild-type protein. However, the ADNP mutants at a lower molecular weight of 127 kDa for the Asn832Lysfs*81 and Leu831Ilefs*82 mutations, respectively to 45 kDa for the Ser404* mutation, and to 10 kDa for the cell line carrying the Gln40* mutation could not be visualized. (B) Administration of the immunization peptide in a 5 × excess to antibody concentration reduced all signals, indicating that the N-terminal antibody recognized ADNP specifically in LCLs alongside non-specific band signals. (C-E) C-terminal antibodies detected wild-type ADNP at a molecular weight of 150 kDa. No mutant ADNP was observed with the antibody of Protein Technology which is capable to recognize a part of the truncated Asn832Lysfs*81 and Leu831Ilefs*82 mutations. (F) All C-terminal antibodies visualized wild-type ADNP at 150 kDa, with only the Abcam (p = 0.04; *) and Sarma Laboratory (p = 0.02; *) antibodies showing the expected reduction of ADNP in LCLs of Helsmoortel-Van der Aa syndrome patients. GAPDH was used as a loading control.
Article Snippet: Recently,
Techniques: Mutagenesis, Western Blot, Control, Expressing, Molecular Weight, Concentration Assay
Journal: Scientific reports
Article Title: Tracing the invisible mutant ADNP protein in Helsmoortel-Van der Aa syndrome patients.
doi: 10.1038/s41598-024-65608-x
Figure Lengend Snippet: Figure 11. Wild-type and mutant ADNP enrichment through immunoprecipitation. The N-terminal sc-F5 ADNP IP-competent antibody was crosslinked to agarose beads and sequentially eluted in fractions (input; flow-through; three consecutive washes, W1-W3; and the immunoprecipitated fracted. IgG non-reactive beads were used as a negative control. In each lane, 20 μg of protein was separated by SDS-PAGE electrophoresis. GAPDH has been used as loading control for all western blots, and critical assessment of the accuracy of the IP method. (A) Immunoprecipitation assay of recombinant wild-type (WT) ADNP and truncating mutants (p.Tyr719*; p.Arg730*; p.Asn832Lysfs*81) in HEK293T overexpression lysates. (B) Immunoprecipitation assay of native wild-type (WT) ADNP and truncating mutants in protein extracts of LCLs derived from a control subject (CTR) and patients with the p.Ser404*, p.Leu831Ilefs*82, or p.Asn832Lysfs*81 ADNP mutation.
Article Snippet: Recently,
Techniques: Mutagenesis, Immunoprecipitation, Negative Control, SDS Page, Electrophoresis, Control, Western Blot, Recombinant, Over Expression, Derivative Assay
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: PRSS55 deletion leads to impaired mitochondrial function in mouse testes and sperm. A in vitro sperm (marked by white cycle) migration in 10% MC4000 solution (n = 4). Capacitated sperm that migrate over 1 cm from the bottom of the capillary slide were counted under a microscope, 200 × magnification. Sperm were highlighted in white circle. B ATP levels in Prss55 −/− testes and sperm is shown as mean ± SE (n = 3). The liver in which PRSS55 is not expressed was used as unrelated control. C NAD+ , NADH levels and NAD+ /NADH ratio in wt and Prss55 −/− testicular cells were determined and presented as mean ± SE (n = 3). D The mitochondrial membrane potential (MMP) of spermatozoa from wt and Prss55 −/− mice was determined using JC-1 probes (n = 4). JC-1 polymer/JC-1 monomer fluorescence ratios were calculated and shown as mean ± SE (n = 4). (*, P ≤ 0.05, **, P ≤ 0.01, ***, P ≤ 0.001, n.s., no significant difference.)
Article Snippet:
Techniques: In Vitro, Migration, Microscopy, Control, Membrane, Polymer, Fluorescence
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: PRSS55 is localized in mitochondria and facilitates mitochondrial energy metabolism in cultured cell lines. A Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in NIH-3T3 cells (PRSS55, green; MitoTracker, red; DAPI, blue). pixel profile analysis revealed colocalization of green and red signals. Empty vector plasmid (Ctrl) was utilized as a control. B Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in matured sperm (PRSS55, green; COXIV, red; DAPI, blue). Mouse and rabbit IgG staining (Ctrl) was used as a negative control. C Mitochondrial fraction from Prss55 transfected HEK293T cells was subject to immunoblotting analysis. Tubulin was used as a marker for cytoplasm, histone H2A for nuclear, and COXIV for mitochondria (Total, total cell lysates; Mito, isolated mitochondria). D ATP levels in HEK293T cells transfected with PRSS55-Myc expression vector were detected and shown as mean ± SE (n = 4). E NAD+ , NADH levels and NAD+ /NADH ratio in PRSS55-overexpressed HEK293T cells are shown as mean ± SE (n = 3). (*, P ≤ 0.05, **, P ≤ 0.01.)
Article Snippet:
Techniques: Cell Culture, Immunofluorescence, Staining, Plasmid Preparation, Control, Negative Control, Transfection, Western Blot, Marker, Isolation, Expressing
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: Data-Independent Acquisition (DIA)-based quantitative proteomic analysis of wt and Prss55 −/− testicular layer 3 (TL3) cells and sperm. A Immunofluorescence staining of PRSS55 at the luminal side of the seminiferous tubules (PRSS55: red; PNA: green; DAPI: blue). B Work-flow displays the strategy of PRSS55-enrichment cells for both wild-type (wt) and Prss55 −/− mice. C Flow cytometry analysis of DNA ploid types of wt and Prss55 −/− mice T, L1, L2, and L3 testicular cells. D Immunoblotting analysis of PRSS55 levels in wild-type T, L1, L2, and L3 testicular cells. β-Actin was used as a loading control. E, F Volcano plot of TL3 ( E ) and sperm ( F ) proteomics showing significant (fold-change > 1.5, adjusted P ≤ 0.05, blue = down, red = up) differentially expressed proteins (DEPs). G , H Heatmap representation of TL3 DEPs ( G ) and sperm DEPs ( H )
Article Snippet:
Techniques: Data-independent acquisition, Immunofluorescence, Staining, Flow Cytometry, Western Blot, Control
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: DEPs between wt and Prss55 −/− TL3 cells and sperm are enriched in metabolic pathways. Top 5 significantly enriched GO and KEGG terms were selected to show potential functions of DEPs in TL3 cells A and sperm B and presented as bubble plots. Bubble size represents the number of DEPs. Bubble color represents the adjusted P. The x-axis shows the Z-score of proteins classified into each functional annotation. C Venn diagram exhibits the DEPs common in TL3 cells (red) and sperm (green). D The enriched canonical pathways identified in IPA by 153 DEPs common in testicular TL3 cells and sperm are indicated on the y-axis. On the x-axis, the enrichment score (- log 10 (P)) for each pathway is indicated by the bars. Color of each bar reflects its activation z-score upon IPA algorithm
Article Snippet:
Techniques: Functional Assay, Activation Assay
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: Branched chain amino acids were accumulated in Prss55 −/− testes and sperm. A, B Heatmap representation ( A ) and orthogonal partial least squares discrimination analysis (OPLS-DA) score plot B of untargeted testicular metabolomic profiles between wt and Prss55 − / − . (wt, n = 6; Prss55 − / − , n = 8) C Volcano plot of untargeted testicular metabolomics showing significant abundant metabolites (fold-change > 1.2, FDR ≤ 0.1, green = down, red = up). D The enrichment of the untargeted Prss55 −/− differential metabolites in the KEGG pathways sorted by -log 10 (P). Color of each bar reflects its enrichment ratio. E, F Relative contents of BCAAs in testes ( E , n = 4) and sperm ( F , n = 3) detected by targeted metabolomic analysis. G, H Determination of BCAAs in testes ( G , wt = 3, Prss55 − /− = 4) and sperm ( H , wt = 3, Prss55 − /− = 5) by ELISA. (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.)
Article Snippet:
Techniques: Enzyme-linked Immunosorbent Assay
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: Interaction of PRSS55 with BCKDK and BCKDHA. A The V5-PRSS55-Flag fusion protein was immunoprecipitated from the testis lysates of 3 Prss55 KI/KI mice with an anti-V5 mAb magnetic beads and detected by anti-V5 antibody. Wt mice were used as negative controls. B The volcano plot shows 56 proteins identified with LC/MS in the V5-PRSS55 precipitates. BCKDK and DBT were pointed. C The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDK and DBT were probed with their specific antibodies, respectively. GAPDH was shown as a loading control. D, E Co-IP of PRSS55 ( D ) or BCKDK ( E ) tagged as indicated with anti-tag antibodies shows the existence of BCKDK or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. F Immunoblotting analysis of endogenous BCKDHA protein levels upon overexpression of PRSS55 and BCKDK (left), and quantitative analysis of relative intensities of BCKDHA protein levels (right). G The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDHA was probed with specific antibody. H, I Co-IP of PRSS55 ( H ) or BCKDHA ( I ) tagged as indicated with anti-tag antibodies shows the existence of BCKDHA or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. J Immunoblotting analysis of isolated mitochondria between wt and Prss55 −/− testes (left), and quantitative analysis of relative intensities of BCKDK, p-BCKDHA, and BCKDHA protein levels (right, n = 3). Bubble size and color represent the relative protein level. Tubulin was used as a marker for cytoplasm, Histone H2A for nuclei, and COXIV for mitochondria. (* P ≤ 0.05, ** P ≤ 0.01)
Article Snippet:
Techniques: Immunoprecipitation, Magnetic Beads, Liquid Chromatography with Mass Spectroscopy, Control, Co-Immunoprecipitation Assay, Transfection, Western Blot, Over Expression, Isolation, Marker
Journal: Cell & Bioscience
Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm
doi: 10.1186/s13578-025-01511-w
Figure Lengend Snippet: Schematic illustration of PRSS55 participating in BCAA metabolism and energy homeostasis
Article Snippet:
Techniques: