region Search Results


86
Eurofins gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv
Gene Desert Region Fw Tttcctgcctctgcctttta Eurofins Gene Desert Region Rv, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/desert+desert+eurofins+fw+gene+gene+region+region+rv+tttcctgcctctgcctttta/pm40460200-785-203-202
Average 86 stars, based on 1 article reviews
gene desert region fw tttcctgcctctgcctttta eurofins gene desert region rv - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

93
ECM Biosciences tacstd2
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Tacstd2, supplied by ECM Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/Trop-2%2FTACSTD2+(Extracellular+region)/pmc10942866-113-52-54
Average 93 stars, based on 1 article reviews
tacstd2 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

91
Bio-Rad rabbit anti human mmp 1
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Rabbit Anti Human Mmp 1, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/Rabbit+anti+Human+MMP-10+(Hinge+Region)/pm07489254-73-4-26
Average 91 stars, based on 1 article reviews
rabbit anti human mmp 1 - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

85
Aviva Systems anti cct4
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Anti Cct4, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/CCT4+antibody+-+C-terminal+region+(ARP34271_P050)/pmc04000444-415-43-44
Average 85 stars, based on 1 article reviews
anti cct4 - by Bioz Stars, 2026-10
85/100 stars
  Buy from Supplier

93
Aviva Systems arp48205 t100 arp43517 t100
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Arp48205 T100 Arp43517 T100, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/GOT1+antibody+-+N-terminal+region+(ARP48205_T100)/pmc03660588-84-31-35
Average 93 stars, based on 1 article reviews
arp48205 t100 arp43517 t100 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

92
Aviva Systems bach2
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Bach2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/BACH2+antibody+-+middle+region+(ARP39513_P050)/pmc07384961-1378-48-51
Average 92 stars, based on 1 article reviews
bach2 - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

91
Aviva Systems anti zdhhc3
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Anti Zdhhc3, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/ZDHHC3+antibody+-+C-terminal+region+(ARP59576_P050)/pm37039765-206-24-26
Average 91 stars, based on 1 article reviews
anti zdhhc3 - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

93
Aviva Systems romo 1
Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For <t>TACSTD2,</t> Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.
Romo 1, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/Romo1+antibody+-+N-terminal+region+(ARP58431_P050)/pmc06964721-113-74-78
Average 93 stars, based on 1 article reviews
romo 1 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

93
Aviva Systems anti rabbit nt5dc2
A) Binding procedure . Anti-DYKDDDDK-tag antibody magnetic beads were reacted with 60 µL of cell lysate (1 mg/mL protein) expressing <t>NT5DC2-tag</t> or control-tag at 4°C for 2 h to bind NT5DC2-tag-binding proteins. After washing with PBS/Ca/Mg, 15 µL of SDS/2-mercaptoethanol sample buffer was added, followed by incubation at 80°C for 20 min. The resulting solution was analyzed as the “binding fraction.” B) Detection of MAO A . Proteins in “binding fraction” were analyzed via western blotting using SDS-PAGE and Phos-tag SDS-PAGE.
Anti Rabbit Nt5dc2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/NT5DC2+antibody+-+N-terminal+region+(ARP46322_P050)/bio_rxiv__2025__05__07__651779-37-5-7
Average 93 stars, based on 1 article reviews
anti rabbit nt5dc2 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

93
Aviva Systems prss55 antibody
<t>PRSS55</t> deletion leads to impaired mitochondrial function in mouse testes and sperm. A in vitro sperm (marked by white cycle) migration in 10% MC4000 solution (n = 4). Capacitated sperm that migrate over 1 cm from the bottom of the capillary slide were counted under a microscope, 200 × magnification. Sperm were highlighted in white circle. B ATP levels in Prss55 −/− testes and sperm is shown as mean ± SE (n = 3). The liver in which PRSS55 is not expressed was used as unrelated control. C NAD+ , NADH levels and NAD+ /NADH ratio in wt and Prss55 −/− testicular cells were determined and presented as mean ± SE (n = 3). D The mitochondrial membrane potential (MMP) of spermatozoa from wt and Prss55 −/− mice was determined using JC-1 probes (n = 4). JC-1 polymer/JC-1 monomer fluorescence ratios were calculated and shown as mean ± SE (n = 4). (*, P ≤ 0.05, **, P ≤ 0.01, ***, P ≤ 0.001, n.s., no significant difference.)
Prss55 Antibody, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/PRSS55+Antibody+-+C-terminal+region+(ARP71472_P050)/pmc12729118-173-0-6
Average 93 stars, based on 1 article reviews
prss55 antibody - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

91
Aviva Systems mt2
Figure 1 Effect of 10−7 M melatonin on expression of Nrf2/ ARE signaling pathway-related genes in IVF- derived porcine blastocysts. (A) Nrf2/ARE signaling pathway-related genes <t>(MT2,</t> Nrf2, Keap1, UCHL1, SOD1, and HO-1). (B) Apoptosis-related genes (Bax and Bcl-2). Within the same mRNA, bars with different alphabetical letters are significantly different among the groups (P < 0.05). The experiment was replicated at least three times.
Mt2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/MTNR1B+antibody+-+N-terminal+region+(ARP64072_P050)/10__1530_slash_jme___19___0093-66-27-30
Average 91 stars, based on 1 article reviews
mt2 - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

93
Aviva Systems primary antibodies against slc44a2
a RNA levels of <t>Slc44a2</t> relative to ß-actin in murine organs were measured by qPCR ( n = 3 ± biologically independent samples ±S.D.). b Protein levels of SLC44A2 in normal human platelets were measured by immunoblotting. c Protein levels of Slc44a2 in mouse platelets and mouse bone marrow were measured by immunoblotting. d The bleeding time of Slc44a2(WT) and Slc44a2(KO) mice was measured after tail transection ( n = 6 WT and 8 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). e The time for mesenteric arterial thrombosis after FeCl 3 treatment was measured by intravital microscopy. *For WT vs. KO, the Fisher’s exact test statistic is 0.0001 and the result is significant at P < 0.05. f Representative image of inferior vena cava 6 h after IVC constriction, with WT above and KO below. g Quantification of IVC mass containing IVC segment and thrombus 6 h after IVC constriction ( n = 13 WT and 15 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). h Quantification of thrombus mass isolated from IVC 6 h after IVC constriction ( n = 5 WT and 6 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). i Bleeding times were repeated after bone marrow transplantation between Slc44a2(WT) and Slc44a2(KO) mice ( n = 10, 7, 9, and 4 mice as shown in the chart ±S.D. and * P < 0.01 for WT–WT vs. KO–WT and * P < 0.01 for KO–KO vs. WT–KO in Tukey’s range test). Bone marrow from Slc44a2(KO) donor mice prolongs the bleeding time of recipient mice. j Percent maximal blood flow in carotid artery after treatment with FeCl 3 was measured by ultrasound. k Quantitation of j . For WT–WT vs. KO–WT, the Fisher’s exact test statistic is 0.02 and the result is significant at P < 0.05. For WT–KO vs. KO–KO, the Fisher’s exact test statistic is 0.3 and the result is not significant at P < 0.05 Sample size includes: 10, 12, 7, 6, and 8 as shown in chart. l The bleeding time of Slc44a2(WT) and Slc44a2(KO ) mice was measured after tail transection (WT and KO). ( n = 6, 9, 9, and 8 mice as shown in the chart ±S.D. and * P < 0.01 for WT vs. KO). The bleeding time of Slc44a2(KO) mice after transfusion with platelets from Slc44a2(WT) or Slc44a2(KO) mice was measured after tail transection (WT to KO and also KO to KO). ( n = 10 mice ±S.D. and * P < 0.01 for WT to KO vs. KO to KO compared in Tukey’s range test). Source data are provided as a file.
Primary Antibodies Against Slc44a2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/region/SLC44A2+Antibody+-+middle+region+(ARP44009_P050)/pmc07359028-166-0-7
Average 93 stars, based on 1 article reviews
primary antibodies against slc44a2 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

Image Search Results


Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For TACSTD2, Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.

Journal: Journal of Extracellular Vesicles

Article Title: Proteomic analysis of ascitic extracellular vesicles describes tumour microenvironment and predicts patient survival in ovarian cancer

doi: 10.1002/jev2.12420

Figure Lengend Snippet: Identification of ‘HGSC‐specific EV‐associated proteins’. S = proteins from EVs isolated by size‐exclusion chromatography, U = proteins from EVs isolated by ultracentrifugation, S&U = protein is present in both S and U. (a) Schematic overview of identification of eight HGSC‐specific EV‐associated proteins. (b) Presence of eight HGSC‐specific EV‐associated proteins among patient samples. (c) Western blotting for selected HGSC‐specific EV‐associated proteins on U fractions of 11 patients and Caov‐3 and Kuramochi HGSC cell lines. Caov‐3 and Kuramochi cells are used as negative controls for macrophage markers MRC1, CD68, and FCGR1A. For TACSTD2, Caov‐3 serves as a positive control, while Kuramochi serves as a negative control. (d) Schematic overview of identification of 157 HGSC‐specific EV‐associated proteins. These data were augmented by proteins identified by UC.

Article Snippet: The following antibodies were used: rabbit anti Flotillin1 (A3023, Exbio, dilution 1:500), mouse anti Flotillin2 (BD610383, BD, dilution 1:500), mouse anti CD81 (105601, Caprico Biotechnologies, dilution 1:500), rabbit anti CD9 (A19027, ABclonal, dilution 1:500), rabbit anti ApoA‐I (sc‐30089, Santa Cruz Biotechnology, dilution 1:1,000), rabbit anti FAS (A21903, ABclonal, dilution 1:1,000), mouse anti TACSTD2 (TM0051, ECM Biosciences, dilution 1:500), mouse anti CD68 (BD556078, BD, dilution 1:500), goat anti MRC1 (sc‐34577, Santa Cruz Biotechnology, dilution 1:500), mouse anti FCGR1A (sc‐1184, Santa Cruz Biotechnology, dilution 1:500).

Techniques: Isolation, Size-exclusion Chromatography, Western Blot, Positive Control, Negative Control

A) Binding procedure . Anti-DYKDDDDK-tag antibody magnetic beads were reacted with 60 µL of cell lysate (1 mg/mL protein) expressing NT5DC2-tag or control-tag at 4°C for 2 h to bind NT5DC2-tag-binding proteins. After washing with PBS/Ca/Mg, 15 µL of SDS/2-mercaptoethanol sample buffer was added, followed by incubation at 80°C for 20 min. The resulting solution was analyzed as the “binding fraction.” B) Detection of MAO A . Proteins in “binding fraction” were analyzed via western blotting using SDS-PAGE and Phos-tag SDS-PAGE.

Journal: bioRxiv

Article Title: NT5DC2 downregulation suppresses monoamine oxidase activity and increases catecholamine levels in PC12D cells

doi: 10.1101/2025.05.07.651779

Figure Lengend Snippet: A) Binding procedure . Anti-DYKDDDDK-tag antibody magnetic beads were reacted with 60 µL of cell lysate (1 mg/mL protein) expressing NT5DC2-tag or control-tag at 4°C for 2 h to bind NT5DC2-tag-binding proteins. After washing with PBS/Ca/Mg, 15 µL of SDS/2-mercaptoethanol sample buffer was added, followed by incubation at 80°C for 20 min. The resulting solution was analyzed as the “binding fraction.” B) Detection of MAO A . Proteins in “binding fraction” were analyzed via western blotting using SDS-PAGE and Phos-tag SDS-PAGE.

Article Snippet: The primary antibodies used were anti-rabbit NT5DC2 (Aviva Systems Biology, San Diego, CA, USA), anti-mouse DYKDDDDK (FUJIFILM Wako), anti-rabbit MAO A (Proteintech, Rosemont, IL, USA), and anti-mouse GAPDH (FUJIFILM Wako) antibodies.

Techniques: Binding Assay, Magnetic Beads, Expressing, Control, Incubation, Western Blot, SDS Page

PRSS55 deletion leads to impaired mitochondrial function in mouse testes and sperm. A in vitro sperm (marked by white cycle) migration in 10% MC4000 solution (n = 4). Capacitated sperm that migrate over 1 cm from the bottom of the capillary slide were counted under a microscope, 200 × magnification. Sperm were highlighted in white circle. B ATP levels in Prss55 −/− testes and sperm is shown as mean ± SE (n = 3). The liver in which PRSS55 is not expressed was used as unrelated control. C NAD+ , NADH levels and NAD+ /NADH ratio in wt and Prss55 −/− testicular cells were determined and presented as mean ± SE (n = 3). D The mitochondrial membrane potential (MMP) of spermatozoa from wt and Prss55 −/− mice was determined using JC-1 probes (n = 4). JC-1 polymer/JC-1 monomer fluorescence ratios were calculated and shown as mean ± SE (n = 4). (*, P ≤ 0.05, **, P ≤ 0.01, ***, P ≤ 0.001, n.s., no significant difference.)

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: PRSS55 deletion leads to impaired mitochondrial function in mouse testes and sperm. A in vitro sperm (marked by white cycle) migration in 10% MC4000 solution (n = 4). Capacitated sperm that migrate over 1 cm from the bottom of the capillary slide were counted under a microscope, 200 × magnification. Sperm were highlighted in white circle. B ATP levels in Prss55 −/− testes and sperm is shown as mean ± SE (n = 3). The liver in which PRSS55 is not expressed was used as unrelated control. C NAD+ , NADH levels and NAD+ /NADH ratio in wt and Prss55 −/− testicular cells were determined and presented as mean ± SE (n = 3). D The mitochondrial membrane potential (MMP) of spermatozoa from wt and Prss55 −/− mice was determined using JC-1 probes (n = 4). JC-1 polymer/JC-1 monomer fluorescence ratios were calculated and shown as mean ± SE (n = 4). (*, P ≤ 0.05, **, P ≤ 0.01, ***, P ≤ 0.001, n.s., no significant difference.)

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: In Vitro, Migration, Microscopy, Control, Membrane, Polymer, Fluorescence

PRSS55 is localized in mitochondria and facilitates mitochondrial energy metabolism in cultured cell lines. A Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in NIH-3T3 cells (PRSS55, green; MitoTracker, red; DAPI, blue). pixel profile analysis revealed colocalization of green and red signals. Empty vector plasmid (Ctrl) was utilized as a control. B Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in matured sperm (PRSS55, green; COXIV, red; DAPI, blue). Mouse and rabbit IgG staining (Ctrl) was used as a negative control. C Mitochondrial fraction from Prss55 transfected HEK293T cells was subject to immunoblotting analysis. Tubulin was used as a marker for cytoplasm, histone H2A for nuclear, and COXIV for mitochondria (Total, total cell lysates; Mito, isolated mitochondria). D ATP levels in HEK293T cells transfected with PRSS55-Myc expression vector were detected and shown as mean ± SE (n = 4). E NAD+ , NADH levels and NAD+ /NADH ratio in PRSS55-overexpressed HEK293T cells are shown as mean ± SE (n = 3). (*, P ≤ 0.05, **, P ≤ 0.01.)

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: PRSS55 is localized in mitochondria and facilitates mitochondrial energy metabolism in cultured cell lines. A Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in NIH-3T3 cells (PRSS55, green; MitoTracker, red; DAPI, blue). pixel profile analysis revealed colocalization of green and red signals. Empty vector plasmid (Ctrl) was utilized as a control. B Immunofluorescence staining shows co-localization of PRSS55 and mitochondria in matured sperm (PRSS55, green; COXIV, red; DAPI, blue). Mouse and rabbit IgG staining (Ctrl) was used as a negative control. C Mitochondrial fraction from Prss55 transfected HEK293T cells was subject to immunoblotting analysis. Tubulin was used as a marker for cytoplasm, histone H2A for nuclear, and COXIV for mitochondria (Total, total cell lysates; Mito, isolated mitochondria). D ATP levels in HEK293T cells transfected with PRSS55-Myc expression vector were detected and shown as mean ± SE (n = 4). E NAD+ , NADH levels and NAD+ /NADH ratio in PRSS55-overexpressed HEK293T cells are shown as mean ± SE (n = 3). (*, P ≤ 0.05, **, P ≤ 0.01.)

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: Cell Culture, Immunofluorescence, Staining, Plasmid Preparation, Control, Negative Control, Transfection, Western Blot, Marker, Isolation, Expressing

Data-Independent Acquisition (DIA)-based quantitative proteomic analysis of wt and Prss55 −/− testicular layer 3 (TL3) cells and sperm. A Immunofluorescence staining of PRSS55 at the luminal side of the seminiferous tubules (PRSS55: red; PNA: green; DAPI: blue). B Work-flow displays the strategy of PRSS55-enrichment cells for both wild-type (wt) and Prss55 −/− mice. C Flow cytometry analysis of DNA ploid types of wt and Prss55 −/− mice T, L1, L2, and L3 testicular cells. D Immunoblotting analysis of PRSS55 levels in wild-type T, L1, L2, and L3 testicular cells. β-Actin was used as a loading control. E, F Volcano plot of TL3 ( E ) and sperm ( F ) proteomics showing significant (fold-change > 1.5, adjusted P ≤ 0.05, blue = down, red = up) differentially expressed proteins (DEPs). G , H Heatmap representation of TL3 DEPs ( G ) and sperm DEPs ( H )

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: Data-Independent Acquisition (DIA)-based quantitative proteomic analysis of wt and Prss55 −/− testicular layer 3 (TL3) cells and sperm. A Immunofluorescence staining of PRSS55 at the luminal side of the seminiferous tubules (PRSS55: red; PNA: green; DAPI: blue). B Work-flow displays the strategy of PRSS55-enrichment cells for both wild-type (wt) and Prss55 −/− mice. C Flow cytometry analysis of DNA ploid types of wt and Prss55 −/− mice T, L1, L2, and L3 testicular cells. D Immunoblotting analysis of PRSS55 levels in wild-type T, L1, L2, and L3 testicular cells. β-Actin was used as a loading control. E, F Volcano plot of TL3 ( E ) and sperm ( F ) proteomics showing significant (fold-change > 1.5, adjusted P ≤ 0.05, blue = down, red = up) differentially expressed proteins (DEPs). G , H Heatmap representation of TL3 DEPs ( G ) and sperm DEPs ( H )

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: Data-independent acquisition, Immunofluorescence, Staining, Flow Cytometry, Western Blot, Control

DEPs between wt and Prss55 −/− TL3 cells and sperm are enriched in metabolic pathways. Top 5 significantly enriched GO and KEGG terms were selected to show potential functions of DEPs in TL3 cells A and sperm B and presented as bubble plots. Bubble size represents the number of DEPs. Bubble color represents the adjusted P. The x-axis shows the Z-score of proteins classified into each functional annotation. C Venn diagram exhibits the DEPs common in TL3 cells (red) and sperm (green). D The enriched canonical pathways identified in IPA by 153 DEPs common in testicular TL3 cells and sperm are indicated on the y-axis. On the x-axis, the enrichment score (- log 10 (P)) for each pathway is indicated by the bars. Color of each bar reflects its activation z-score upon IPA algorithm

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: DEPs between wt and Prss55 −/− TL3 cells and sperm are enriched in metabolic pathways. Top 5 significantly enriched GO and KEGG terms were selected to show potential functions of DEPs in TL3 cells A and sperm B and presented as bubble plots. Bubble size represents the number of DEPs. Bubble color represents the adjusted P. The x-axis shows the Z-score of proteins classified into each functional annotation. C Venn diagram exhibits the DEPs common in TL3 cells (red) and sperm (green). D The enriched canonical pathways identified in IPA by 153 DEPs common in testicular TL3 cells and sperm are indicated on the y-axis. On the x-axis, the enrichment score (- log 10 (P)) for each pathway is indicated by the bars. Color of each bar reflects its activation z-score upon IPA algorithm

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: Functional Assay, Activation Assay

Branched chain amino acids were accumulated in Prss55 −/− testes and sperm. A, B Heatmap representation ( A ) and orthogonal partial least squares discrimination analysis (OPLS-DA) score plot B of untargeted testicular metabolomic profiles between wt and Prss55 − / − . (wt, n = 6; Prss55 − / − , n = 8) C Volcano plot of untargeted testicular metabolomics showing significant abundant metabolites (fold-change > 1.2, FDR ≤ 0.1, green = down, red = up). D The enrichment of the untargeted Prss55 −/− differential metabolites in the KEGG pathways sorted by -log 10 (P). Color of each bar reflects its enrichment ratio. E, F Relative contents of BCAAs in testes ( E , n = 4) and sperm ( F , n = 3) detected by targeted metabolomic analysis. G, H Determination of BCAAs in testes ( G , wt = 3, Prss55 − /− = 4) and sperm ( H , wt = 3, Prss55 − /− = 5) by ELISA. (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.)

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: Branched chain amino acids were accumulated in Prss55 −/− testes and sperm. A, B Heatmap representation ( A ) and orthogonal partial least squares discrimination analysis (OPLS-DA) score plot B of untargeted testicular metabolomic profiles between wt and Prss55 − / − . (wt, n = 6; Prss55 − / − , n = 8) C Volcano plot of untargeted testicular metabolomics showing significant abundant metabolites (fold-change > 1.2, FDR ≤ 0.1, green = down, red = up). D The enrichment of the untargeted Prss55 −/− differential metabolites in the KEGG pathways sorted by -log 10 (P). Color of each bar reflects its enrichment ratio. E, F Relative contents of BCAAs in testes ( E , n = 4) and sperm ( F , n = 3) detected by targeted metabolomic analysis. G, H Determination of BCAAs in testes ( G , wt = 3, Prss55 − /− = 4) and sperm ( H , wt = 3, Prss55 − /− = 5) by ELISA. (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.)

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: Enzyme-linked Immunosorbent Assay

Interaction of PRSS55 with BCKDK and BCKDHA. A The V5-PRSS55-Flag fusion protein was immunoprecipitated from the testis lysates of 3 Prss55 KI/KI mice with an anti-V5 mAb magnetic beads and detected by anti-V5 antibody. Wt mice were used as negative controls. B The volcano plot shows 56 proteins identified with LC/MS in the V5-PRSS55 precipitates. BCKDK and DBT were pointed. C The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDK and DBT were probed with their specific antibodies, respectively. GAPDH was shown as a loading control. D, E Co-IP of PRSS55 ( D ) or BCKDK ( E ) tagged as indicated with anti-tag antibodies shows the existence of BCKDK or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. F Immunoblotting analysis of endogenous BCKDHA protein levels upon overexpression of PRSS55 and BCKDK (left), and quantitative analysis of relative intensities of BCKDHA protein levels (right). G The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDHA was probed with specific antibody. H, I Co-IP of PRSS55 ( H ) or BCKDHA ( I ) tagged as indicated with anti-tag antibodies shows the existence of BCKDHA or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. J Immunoblotting analysis of isolated mitochondria between wt and Prss55 −/− testes (left), and quantitative analysis of relative intensities of BCKDK, p-BCKDHA, and BCKDHA protein levels (right, n = 3). Bubble size and color represent the relative protein level. Tubulin was used as a marker for cytoplasm, Histone H2A for nuclei, and COXIV for mitochondria. (* P ≤ 0.05, ** P ≤ 0.01)

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: Interaction of PRSS55 with BCKDK and BCKDHA. A The V5-PRSS55-Flag fusion protein was immunoprecipitated from the testis lysates of 3 Prss55 KI/KI mice with an anti-V5 mAb magnetic beads and detected by anti-V5 antibody. Wt mice were used as negative controls. B The volcano plot shows 56 proteins identified with LC/MS in the V5-PRSS55 precipitates. BCKDK and DBT were pointed. C The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDK and DBT were probed with their specific antibodies, respectively. GAPDH was shown as a loading control. D, E Co-IP of PRSS55 ( D ) or BCKDK ( E ) tagged as indicated with anti-tag antibodies shows the existence of BCKDK or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. F Immunoblotting analysis of endogenous BCKDHA protein levels upon overexpression of PRSS55 and BCKDK (left), and quantitative analysis of relative intensities of BCKDHA protein levels (right). G The PRSS55-EGFP fusion protein was immunoprecipitated from the HEK293T cell lysates. Endogenous BCKDHA was probed with specific antibody. H, I Co-IP of PRSS55 ( H ) or BCKDHA ( I ) tagged as indicated with anti-tag antibodies shows the existence of BCKDHA or PRSS55 in the precipitates from the cell lysates of co-transfected HEK293T cells by immunoblot. J Immunoblotting analysis of isolated mitochondria between wt and Prss55 −/− testes (left), and quantitative analysis of relative intensities of BCKDK, p-BCKDHA, and BCKDHA protein levels (right, n = 3). Bubble size and color represent the relative protein level. Tubulin was used as a marker for cytoplasm, Histone H2A for nuclei, and COXIV for mitochondria. (* P ≤ 0.05, ** P ≤ 0.01)

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques: Immunoprecipitation, Magnetic Beads, Liquid Chromatography with Mass Spectroscopy, Control, Co-Immunoprecipitation Assay, Transfection, Western Blot, Over Expression, Isolation, Marker

Schematic illustration of PRSS55 participating in BCAA metabolism and energy homeostasis

Journal: Cell & Bioscience

Article Title: PRSS55 regulates BCAA metabolism and interacts with BCKDK and BCKDHA in mouse testes and sperm

doi: 10.1186/s13578-025-01511-w

Figure Lengend Snippet: Schematic illustration of PRSS55 participating in BCAA metabolism and energy homeostasis

Article Snippet: PRSS55 antibody (1:500, MA43587) was from Aviva Systems Biology; BCKDK (1:1000, ab151297) antibody and BCKDHA (1:1000, ab126173) antibody were from Abcam.

Techniques:

Figure 1 Effect of 10−7 M melatonin on expression of Nrf2/ ARE signaling pathway-related genes in IVF- derived porcine blastocysts. (A) Nrf2/ARE signaling pathway-related genes (MT2, Nrf2, Keap1, UCHL1, SOD1, and HO-1). (B) Apoptosis-related genes (Bax and Bcl-2). Within the same mRNA, bars with different alphabetical letters are significantly different among the groups (P < 0.05). The experiment was replicated at least three times.

Journal: Journal of Molecular Endocrinology

Article Title: Melatonin enhances porcine embryo development via the Nrf2/ARE signaling pathway

doi: 10.1530/jme-19-0093

Figure Lengend Snippet: Figure 1 Effect of 10−7 M melatonin on expression of Nrf2/ ARE signaling pathway-related genes in IVF- derived porcine blastocysts. (A) Nrf2/ARE signaling pathway-related genes (MT2, Nrf2, Keap1, UCHL1, SOD1, and HO-1). (B) Apoptosis-related genes (Bax and Bcl-2). Within the same mRNA, bars with different alphabetical letters are significantly different among the groups (P < 0.05). The experiment was replicated at least three times.

Article Snippet: Then, blastocysts were directly transferred into 2% BSA containing primary antibody for Nrf2 (1:200; 70R-50116; Fitzgerald Industries International, Acton, MA, USA), Keap1 (4 μL/mL; ab218815; Abcam), and MT2 (1:200; ARP64072_P050; Aviva Systems Biology, San Diego, CA, USA) and incubated at 4°C, overnight.

Techniques: Expressing, Derivative Assay

Figure 2 Immunocytochemical analysis of MT2 in porcine blastocysts. (A) Images of blastocysts were obtained by fluorescence microscopy. Representative in vitro-fertilized porcine blastocysts in each groups were stained with MT2 and counterstained with Hoechst 33342. (B) Statistical analysis of 10−7 M melatonin, 50 nM brusatol, and co-treatment effects on MT2 protein expression in porcine blastocysts. Five replicates were carried out for this experiment. Data are shown as the means ± s.e.m. Groups marked with different alphabetical letters are significantly different (P < 0.05). Mtn, 10−7 M melatonin; Bru, 50 nM brusatol. Original magnification 200×. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0093.

Journal: Journal of Molecular Endocrinology

Article Title: Melatonin enhances porcine embryo development via the Nrf2/ARE signaling pathway

doi: 10.1530/jme-19-0093

Figure Lengend Snippet: Figure 2 Immunocytochemical analysis of MT2 in porcine blastocysts. (A) Images of blastocysts were obtained by fluorescence microscopy. Representative in vitro-fertilized porcine blastocysts in each groups were stained with MT2 and counterstained with Hoechst 33342. (B) Statistical analysis of 10−7 M melatonin, 50 nM brusatol, and co-treatment effects on MT2 protein expression in porcine blastocysts. Five replicates were carried out for this experiment. Data are shown as the means ± s.e.m. Groups marked with different alphabetical letters are significantly different (P < 0.05). Mtn, 10−7 M melatonin; Bru, 50 nM brusatol. Original magnification 200×. A full colour version of this figure is available at https://doi.org/10.1530/JME-19-0093.

Article Snippet: Then, blastocysts were directly transferred into 2% BSA containing primary antibody for Nrf2 (1:200; 70R-50116; Fitzgerald Industries International, Acton, MA, USA), Keap1 (4 μL/mL; ab218815; Abcam), and MT2 (1:200; ARP64072_P050; Aviva Systems Biology, San Diego, CA, USA) and incubated at 4°C, overnight.

Techniques: Fluorescence, Microscopy, In Vitro, Staining, Expressing

a RNA levels of Slc44a2 relative to ß-actin in murine organs were measured by qPCR ( n = 3 ± biologically independent samples ±S.D.). b Protein levels of SLC44A2 in normal human platelets were measured by immunoblotting. c Protein levels of Slc44a2 in mouse platelets and mouse bone marrow were measured by immunoblotting. d The bleeding time of Slc44a2(WT) and Slc44a2(KO) mice was measured after tail transection ( n = 6 WT and 8 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). e The time for mesenteric arterial thrombosis after FeCl 3 treatment was measured by intravital microscopy. *For WT vs. KO, the Fisher’s exact test statistic is 0.0001 and the result is significant at P < 0.05. f Representative image of inferior vena cava 6 h after IVC constriction, with WT above and KO below. g Quantification of IVC mass containing IVC segment and thrombus 6 h after IVC constriction ( n = 13 WT and 15 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). h Quantification of thrombus mass isolated from IVC 6 h after IVC constriction ( n = 5 WT and 6 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). i Bleeding times were repeated after bone marrow transplantation between Slc44a2(WT) and Slc44a2(KO) mice ( n = 10, 7, 9, and 4 mice as shown in the chart ±S.D. and * P < 0.01 for WT–WT vs. KO–WT and * P < 0.01 for KO–KO vs. WT–KO in Tukey’s range test). Bone marrow from Slc44a2(KO) donor mice prolongs the bleeding time of recipient mice. j Percent maximal blood flow in carotid artery after treatment with FeCl 3 was measured by ultrasound. k Quantitation of j . For WT–WT vs. KO–WT, the Fisher’s exact test statistic is 0.02 and the result is significant at P < 0.05. For WT–KO vs. KO–KO, the Fisher’s exact test statistic is 0.3 and the result is not significant at P < 0.05 Sample size includes: 10, 12, 7, 6, and 8 as shown in chart. l The bleeding time of Slc44a2(WT) and Slc44a2(KO ) mice was measured after tail transection (WT and KO). ( n = 6, 9, 9, and 8 mice as shown in the chart ±S.D. and * P < 0.01 for WT vs. KO). The bleeding time of Slc44a2(KO) mice after transfusion with platelets from Slc44a2(WT) or Slc44a2(KO) mice was measured after tail transection (WT to KO and also KO to KO). ( n = 10 mice ±S.D. and * P < 0.01 for WT to KO vs. KO to KO compared in Tukey’s range test). Source data are provided as a file.

Journal: Nature Communications

Article Title: The choline transporter Slc44a2 controls platelet activation and thrombosis by regulating mitochondrial function

doi: 10.1038/s41467-020-17254-w

Figure Lengend Snippet: a RNA levels of Slc44a2 relative to ß-actin in murine organs were measured by qPCR ( n = 3 ± biologically independent samples ±S.D.). b Protein levels of SLC44A2 in normal human platelets were measured by immunoblotting. c Protein levels of Slc44a2 in mouse platelets and mouse bone marrow were measured by immunoblotting. d The bleeding time of Slc44a2(WT) and Slc44a2(KO) mice was measured after tail transection ( n = 6 WT and 8 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). e The time for mesenteric arterial thrombosis after FeCl 3 treatment was measured by intravital microscopy. *For WT vs. KO, the Fisher’s exact test statistic is 0.0001 and the result is significant at P < 0.05. f Representative image of inferior vena cava 6 h after IVC constriction, with WT above and KO below. g Quantification of IVC mass containing IVC segment and thrombus 6 h after IVC constriction ( n = 13 WT and 15 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). h Quantification of thrombus mass isolated from IVC 6 h after IVC constriction ( n = 5 WT and 6 KO mice ±S.D. and * P < 0.01 in a two-tailed Student’s t test). i Bleeding times were repeated after bone marrow transplantation between Slc44a2(WT) and Slc44a2(KO) mice ( n = 10, 7, 9, and 4 mice as shown in the chart ±S.D. and * P < 0.01 for WT–WT vs. KO–WT and * P < 0.01 for KO–KO vs. WT–KO in Tukey’s range test). Bone marrow from Slc44a2(KO) donor mice prolongs the bleeding time of recipient mice. j Percent maximal blood flow in carotid artery after treatment with FeCl 3 was measured by ultrasound. k Quantitation of j . For WT–WT vs. KO–WT, the Fisher’s exact test statistic is 0.02 and the result is significant at P < 0.05. For WT–KO vs. KO–KO, the Fisher’s exact test statistic is 0.3 and the result is not significant at P < 0.05 Sample size includes: 10, 12, 7, 6, and 8 as shown in chart. l The bleeding time of Slc44a2(WT) and Slc44a2(KO ) mice was measured after tail transection (WT and KO). ( n = 6, 9, 9, and 8 mice as shown in the chart ±S.D. and * P < 0.01 for WT vs. KO). The bleeding time of Slc44a2(KO) mice after transfusion with platelets from Slc44a2(WT) or Slc44a2(KO) mice was measured after tail transection (WT to KO and also KO to KO). ( n = 10 mice ±S.D. and * P < 0.01 for WT to KO vs. KO to KO compared in Tukey’s range test). Source data are provided as a file.

Article Snippet: Primary antibodies against Slc44a2 were purchased from Aviva Systems Biology (ARP44009_P050) and used at a dilution of 1:500.

Techniques: Western Blot, Two Tailed Test, Intravital Microscopy, Isolation, Transplantation Assay, Quantitation Assay

a Representative transmission electron microscopy images of platelets from Slc44a2(WT) and Slc44a2(KO) mice. Arrow indicates an individual mitochondrion. b Platelet mitochondria DNA copy number measured by qPCR. n = 4. * P < 0.05 in a two-tailed Student’s t test ( c ) Slc44a2 is present in lysate of mitochondria purified from platelets (left immunoblot) and Slc44a2 is enriched in the mitochondrial fraction of platelets but not in the cytosolic fraction of platelets (right immunoblot). d Slc44a2 does not regulate choline transport into whole cells, as measured by cellular uptake of radiolabeled choline competed with nonlabeled choline. ( n = 3 biologically independent samples ±S.D. and * P < 0.05 for WT vs. KO). e Slc44a2 regulates transport of choline into isolated mitochondria, as measured by mitochondrial uptake of radiolabeled choline competed with nonlabeled choline. ( n = 3 biologically independent samples ±S.D. and * P < 0.05 for WT vs. KO). f Metabolite profiles in platelets from Slc44a2(KO) mice relative to Slc44a2(WT) mice as measured by mass spectroscopy. ( n = 2–3). g Mitochondrial oxygen consumption rate (OCR) of platelets from Slc44a2(KO) and Slc44a2(WT) mice: basal and uncoupled OCR are decreased in Slc44a2(KO) platelets ( n = 4 biologically independent samples ±S.D.; * P < 0.05 WT vs. KO in a two-tailed Student’s t test). h Mitochondrial OCR during treatment with choline ( n = 4 biologically independent samples ±S.D.; * P < 0.05 WT vs. KO in a two-tailed Student’s t test). For stress testing, Antimycin A = 1.0 µM, FCCP = 1.0 µM and Rotenone = 0.5 µM. Choline was added at 20 µM for all experiments. (For all panels, * P < 0.05 WT vs. KO in a two-tailed Student’s t test). Source data are provided as a file.

Journal: Nature Communications

Article Title: The choline transporter Slc44a2 controls platelet activation and thrombosis by regulating mitochondrial function

doi: 10.1038/s41467-020-17254-w

Figure Lengend Snippet: a Representative transmission electron microscopy images of platelets from Slc44a2(WT) and Slc44a2(KO) mice. Arrow indicates an individual mitochondrion. b Platelet mitochondria DNA copy number measured by qPCR. n = 4. * P < 0.05 in a two-tailed Student’s t test ( c ) Slc44a2 is present in lysate of mitochondria purified from platelets (left immunoblot) and Slc44a2 is enriched in the mitochondrial fraction of platelets but not in the cytosolic fraction of platelets (right immunoblot). d Slc44a2 does not regulate choline transport into whole cells, as measured by cellular uptake of radiolabeled choline competed with nonlabeled choline. ( n = 3 biologically independent samples ±S.D. and * P < 0.05 for WT vs. KO). e Slc44a2 regulates transport of choline into isolated mitochondria, as measured by mitochondrial uptake of radiolabeled choline competed with nonlabeled choline. ( n = 3 biologically independent samples ±S.D. and * P < 0.05 for WT vs. KO). f Metabolite profiles in platelets from Slc44a2(KO) mice relative to Slc44a2(WT) mice as measured by mass spectroscopy. ( n = 2–3). g Mitochondrial oxygen consumption rate (OCR) of platelets from Slc44a2(KO) and Slc44a2(WT) mice: basal and uncoupled OCR are decreased in Slc44a2(KO) platelets ( n = 4 biologically independent samples ±S.D.; * P < 0.05 WT vs. KO in a two-tailed Student’s t test). h Mitochondrial OCR during treatment with choline ( n = 4 biologically independent samples ±S.D.; * P < 0.05 WT vs. KO in a two-tailed Student’s t test). For stress testing, Antimycin A = 1.0 µM, FCCP = 1.0 µM and Rotenone = 0.5 µM. Choline was added at 20 µM for all experiments. (For all panels, * P < 0.05 WT vs. KO in a two-tailed Student’s t test). Source data are provided as a file.

Article Snippet: Primary antibodies against Slc44a2 were purchased from Aviva Systems Biology (ARP44009_P050) and used at a dilution of 1:500.

Techniques: Transmission Assay, Electron Microscopy, Two Tailed Test, Purification, Western Blot, Isolation, Mass Spectrometry

a Platelets from Slc44a2(KO) mice contain less ADP than platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. b Platelets from Slc44a2(KO) mice contain less ATP than platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. c Platelets from Slc44a2(KO) mice have an altered ADP/ATP ratio compared to platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ± S.D. * P < 0.05 in a two-tailed Student’s t test. d Platelets from Slc44a2(KO) mice release less ATP in response to 0.5 µ/mL thrombin. n = 4 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. e Choline increases ROS production in a manner that depends upon Slc44a2 in purified mitochondria. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. f Choline increases ATP production in a manner that depends upon Slc44a2 in isolated mitochondria. Choline was added at 20 µM. n = 6 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. g Exogenous ADP rescues platelet activation defect in Slc44a2(KO) platelets. Platelets were treated with 0.5 µ/mL thrombin and 5 µM 2-MeSADP. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. h ADP increases platelet ROS production. i ADP increases mitochondrial ROS production. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. Source data are provided as a file.

Journal: Nature Communications

Article Title: The choline transporter Slc44a2 controls platelet activation and thrombosis by regulating mitochondrial function

doi: 10.1038/s41467-020-17254-w

Figure Lengend Snippet: a Platelets from Slc44a2(KO) mice contain less ADP than platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. b Platelets from Slc44a2(KO) mice contain less ATP than platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. c Platelets from Slc44a2(KO) mice have an altered ADP/ATP ratio compared to platelets from Slc44a2(WT) mice. n = 7 biologically independent samples ± S.D. * P < 0.05 in a two-tailed Student’s t test. d Platelets from Slc44a2(KO) mice release less ATP in response to 0.5 µ/mL thrombin. n = 4 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. e Choline increases ROS production in a manner that depends upon Slc44a2 in purified mitochondria. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. f Choline increases ATP production in a manner that depends upon Slc44a2 in isolated mitochondria. Choline was added at 20 µM. n = 6 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. g Exogenous ADP rescues platelet activation defect in Slc44a2(KO) platelets. Platelets were treated with 0.5 µ/mL thrombin and 5 µM 2-MeSADP. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. h ADP increases platelet ROS production. i ADP increases mitochondrial ROS production. n = 3 biologically independent samples ±S.D. * P < 0.05 in a two-tailed Student’s t test. Source data are provided as a file.

Article Snippet: Primary antibodies against Slc44a2 were purchased from Aviva Systems Biology (ARP44009_P050) and used at a dilution of 1:500.

Techniques: Two Tailed Test, Purification, Isolation, Activation Assay

We propose that Slc44a2 transports choline into mitochondria, where it is metabolized and regulates the production of ATP and release of ROS. ATP is released from platelets and hydrolyzed to ADP which acts upon platelet purinergic receptors and drives further platelet activation.

Journal: Nature Communications

Article Title: The choline transporter Slc44a2 controls platelet activation and thrombosis by regulating mitochondrial function

doi: 10.1038/s41467-020-17254-w

Figure Lengend Snippet: We propose that Slc44a2 transports choline into mitochondria, where it is metabolized and regulates the production of ATP and release of ROS. ATP is released from platelets and hydrolyzed to ADP which acts upon platelet purinergic receptors and drives further platelet activation.

Article Snippet: Primary antibodies against Slc44a2 were purchased from Aviva Systems Biology (ARP44009_P050) and used at a dilution of 1:500.

Techniques: Activation Assay