recombinant g6pd Search Results



90
OriGene recombinant g6pd protein
Figure 1. Aspirin‑mediated acetylation of glucose‑6‑phosphate dehydrogenase <t>(G6PD)</t> is greater in (A) HCT 116 cells compared with in (B) HT‑29 cells. Subconfluent cells were left untreated or were treated with aspirin for 24 h, lysates were prepared, and equal amounts of protein were immunoprecipitated with rabbit agarose‑conjugated anti‑acetyl lysine antibody. Agarose‑bound proteins were eluted and immunoblotted with anti‑G6PD antibody. (C) HCT‑116 and (D) HT‑29 samples were immunoblotted with anti‑G6PD antibody. The experiments were repeated three times.
Recombinant G6pd Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+g6pd/Glucose+6+Phosphate+Dehydrogenase+(G6PD)+(NM_001042351)+Human+Recombinant+Protein/pm27356773-47-1-9
Average 90 stars, based on 1 article reviews
recombinant g6pd protein - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
R&D Systems g9391 g6pd recombinant r d systems
Figure 2. a-syn mutant hNs show flux through the PPP (A–E) Profiling of U-C13-glucose metabolism in hiPSC-derived hNs shows the major metabolites altered in A53T relative to corrected (A and B) grouped by metabolite class; glycolytic (C), adenosine phosphates (D) and redox substrates (E). *p < 0.05, **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (F) Profiling of [1,2]-C13-glucose metabolism to lactate shows that both glycolytic (M+2) and PPP (M+1) flux is decreased in A53T-hNs relative to Corr-hNs. **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (G) Schematic of the PPP, which regulates redox homeostasis via the GSH cycle. (H and I) Ratiometric levels of NADPH/NADP were assessed in hESC-derived WT and A53T hNs (H) or hiPSC-A53T and corrected hNs (I) to confirm a decrease in flux through the PPP. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 inde- pendent samples over three differentiations. DIV: 55–65. (J) Measurement of <t>G6PD</t> activity in hiPSC-A53T and corrected hNs shows significantly reduced G6PD activity in hiPSC-A53T-hNs relative to control. Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K and L) Ratiometric levels of GSH/GSSG were assessed in hESC-derived WT and A53T hNs (K) and hiPSC-A53T and corrected hNs (L) to confirm a decrease in GSH cycling. **p < 0.01 by t test. Data represent mean ± SEM. n = 8 inde- pendent samples over three differentiations. DIV: 55–65.
G9391 G6pd Recombinant R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+g6pd/Recombinant+Human+G6PD+His-tag+Protein%2C+CF/pm39772392-226-11-14
Average 93 stars, based on 1 article reviews
g9391 g6pd recombinant r d systems - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Calzyme Laboratories potassium salt of g6pd
Figure 2. a-syn mutant hNs show flux through the PPP (A–E) Profiling of U-C13-glucose metabolism in hiPSC-derived hNs shows the major metabolites altered in A53T relative to corrected (A and B) grouped by metabolite class; glycolytic (C), adenosine phosphates (D) and redox substrates (E). *p < 0.05, **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (F) Profiling of [1,2]-C13-glucose metabolism to lactate shows that both glycolytic (M+2) and PPP (M+1) flux is decreased in A53T-hNs relative to Corr-hNs. **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (G) Schematic of the PPP, which regulates redox homeostasis via the GSH cycle. (H and I) Ratiometric levels of NADPH/NADP were assessed in hESC-derived WT and A53T hNs (H) or hiPSC-A53T and corrected hNs (I) to confirm a decrease in flux through the PPP. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 inde- pendent samples over three differentiations. DIV: 55–65. (J) Measurement of <t>G6PD</t> activity in hiPSC-A53T and corrected hNs shows significantly reduced G6PD activity in hiPSC-A53T-hNs relative to control. Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K and L) Ratiometric levels of GSH/GSSG were assessed in hESC-derived WT and A53T hNs (K) and hiPSC-A53T and corrected hNs (L) to confirm a decrease in GSH cycling. **p < 0.01 by t test. Data represent mean ± SEM. n = 8 inde- pendent samples over three differentiations. DIV: 55–65.
Potassium Salt Of G6pd, supplied by Calzyme Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+g6pd/recombinant+G6PD+enzyme+Cat++078A0020/10__1128_slash_ec__4__8__1483___1492__2005-134-4-19
Average 90 stars, based on 1 article reviews
potassium salt of g6pd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Beijing Solarbio Science glucose 6 phosphate 1 dehydrogenase
Figure 2. a-syn mutant hNs show flux through the PPP (A–E) Profiling of U-C13-glucose metabolism in hiPSC-derived hNs shows the major metabolites altered in A53T relative to corrected (A and B) grouped by metabolite class; glycolytic (C), adenosine phosphates (D) and redox substrates (E). *p < 0.05, **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (F) Profiling of [1,2]-C13-glucose metabolism to lactate shows that both glycolytic (M+2) and PPP (M+1) flux is decreased in A53T-hNs relative to Corr-hNs. **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (G) Schematic of the PPP, which regulates redox homeostasis via the GSH cycle. (H and I) Ratiometric levels of NADPH/NADP were assessed in hESC-derived WT and A53T hNs (H) or hiPSC-A53T and corrected hNs (I) to confirm a decrease in flux through the PPP. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 inde- pendent samples over three differentiations. DIV: 55–65. (J) Measurement of <t>G6PD</t> activity in hiPSC-A53T and corrected hNs shows significantly reduced G6PD activity in hiPSC-A53T-hNs relative to control. Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K and L) Ratiometric levels of GSH/GSSG were assessed in hESC-derived WT and A53T hNs (K) and hiPSC-A53T and corrected hNs (L) to confirm a decrease in GSH cycling. **p < 0.01 by t test. Data represent mean ± SEM. n = 8 inde- pendent samples over three differentiations. DIV: 55–65.
Glucose 6 Phosphate 1 Dehydrogenase, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+g6pd/Recombinant+Human+G6PD%2FGlucose-6-phosphate+1-dehydrogenase/pm36062959-69-3-21
Average 90 stars, based on 1 article reviews
glucose 6 phosphate 1 dehydrogenase - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

N/A
Recombinant Human G6PD overexpression cell culture supernatant, secreted from the serum-free medium of transfected HEK293 cells (200 µl). Purchase will also include one vial of normal control, the culture supernatant of HEK293 cell transfected with
  Buy from Supplier


N/A
Human G6PD Recombinant Protein made in Human Cells with C-6 His tag.
  Buy from Supplier

N/A
E. coli G6PD Recombinant Protein expressed in E. coli (non-tagged). Sequence domain: 1-491aa. Application(s): Enzyme Activity, SDS-PAGE.
  Buy from Supplier

N/A
Recombinant Human G6PD overexpression cell lysate, derived from the transfected HEK293 cells. (100 µg). Purchase will also include one vial of normal control HEK293 cell lysate (Catalog # 230-10006) transfected with empty expression vector.
  Buy from Supplier

N/A
Recombinant protein of human glucose-6-phosphate dehydrogenase (G6PD), transcript variant 2
  Buy from Supplier

N/A
Glucose-6-Phosphate 1-Dehydrogenase (G6PD) is a cytosolic enzyme that belongs to the glucose-6-phosphate dehydrogenase family. G6PD participates in the pentose phosphate pathway that supplies reducing energy to cells by maintaining the level of the co-enzyme nicotinamide
  Buy from Supplier

Image Search Results


Figure 1. Aspirin‑mediated acetylation of glucose‑6‑phosphate dehydrogenase (G6PD) is greater in (A) HCT 116 cells compared with in (B) HT‑29 cells. Subconfluent cells were left untreated or were treated with aspirin for 24 h, lysates were prepared, and equal amounts of protein were immunoprecipitated with rabbit agarose‑conjugated anti‑acetyl lysine antibody. Agarose‑bound proteins were eluted and immunoblotted with anti‑G6PD antibody. (C) HCT‑116 and (D) HT‑29 samples were immunoblotted with anti‑G6PD antibody. The experiments were repeated three times.

Journal: Molecular medicine reports

Article Title: Aspirin inhibits glucose‑6‑phosphate dehydrogenase activity in HCT 116 cells through acetylation: Identification of aspirin-acetylated sites.

doi: 10.3892/mmr.2016.5449

Figure Lengend Snippet: Figure 1. Aspirin‑mediated acetylation of glucose‑6‑phosphate dehydrogenase (G6PD) is greater in (A) HCT 116 cells compared with in (B) HT‑29 cells. Subconfluent cells were left untreated or were treated with aspirin for 24 h, lysates were prepared, and equal amounts of protein were immunoprecipitated with rabbit agarose‑conjugated anti‑acetyl lysine antibody. Agarose‑bound proteins were eluted and immunoblotted with anti‑G6PD antibody. (C) HCT‑116 and (D) HT‑29 samples were immunoblotted with anti‑G6PD antibody. The experiments were repeated three times.

Article Snippet: The recombinant G6PD protein (isoform a) was obtained from Origene Technologies, Inc. (Rockville, MD, USA).

Techniques: Immunoprecipitation

Figure 2. Effects of aspirin on glucose‑6‑phosphate dehydrogenase (G6PD) activity in HCT 116 and HT‑29 cells. Cells were cultured and left untreated or were treated with aspirin for 24 h. Protein (100 µg) was used to conduct a G6PD assay. The reaction mixture was incubated at 37˚C for 30 min, and absorbance was measured at 450 nm. G6PD activity was expressed as a percentage of control. The experiments were repeated three times. Data are represented as mean ± standard deviation. *P<0.05, **P<0.01, ***P<0.001 vs. the control.

Journal: Molecular medicine reports

Article Title: Aspirin inhibits glucose‑6‑phosphate dehydrogenase activity in HCT 116 cells through acetylation: Identification of aspirin-acetylated sites.

doi: 10.3892/mmr.2016.5449

Figure Lengend Snippet: Figure 2. Effects of aspirin on glucose‑6‑phosphate dehydrogenase (G6PD) activity in HCT 116 and HT‑29 cells. Cells were cultured and left untreated or were treated with aspirin for 24 h. Protein (100 µg) was used to conduct a G6PD assay. The reaction mixture was incubated at 37˚C for 30 min, and absorbance was measured at 450 nm. G6PD activity was expressed as a percentage of control. The experiments were repeated three times. Data are represented as mean ± standard deviation. *P<0.05, **P<0.01, ***P<0.001 vs. the control.

Article Snippet: The recombinant G6PD protein (isoform a) was obtained from Origene Technologies, Inc. (Rockville, MD, USA).

Techniques: Activity Assay, Cell Culture, G6PD Assay, Incubation, Control, Standard Deviation

Figure 3. Mass spectrometry (MS) analysis of recombinant glucose‑6‑phosphate dehydrogenase (G6PD) isoform a. In vitro acetylation of recombinant G6PD by aspirin. (A) A total of 5 ng in vitro acetylated recombinant G6PD was immunoblotted with anti‑acetyl lysine antibody and the protein band was detected by enhanced chemiluminescence. (B‑D) MS/MS fragmentation spectra showing acetyl modification of (B) K77, (C) K201 and (D) K235.

Journal: Molecular medicine reports

Article Title: Aspirin inhibits glucose‑6‑phosphate dehydrogenase activity in HCT 116 cells through acetylation: Identification of aspirin-acetylated sites.

doi: 10.3892/mmr.2016.5449

Figure Lengend Snippet: Figure 3. Mass spectrometry (MS) analysis of recombinant glucose‑6‑phosphate dehydrogenase (G6PD) isoform a. In vitro acetylation of recombinant G6PD by aspirin. (A) A total of 5 ng in vitro acetylated recombinant G6PD was immunoblotted with anti‑acetyl lysine antibody and the protein band was detected by enhanced chemiluminescence. (B‑D) MS/MS fragmentation spectra showing acetyl modification of (B) K77, (C) K201 and (D) K235.

Article Snippet: The recombinant G6PD protein (isoform a) was obtained from Origene Technologies, Inc. (Rockville, MD, USA).

Techniques: Mass Spectrometry, Recombinant, In Vitro, Tandem Mass Spectroscopy, Modification

Figure 4. 3‑Dimension space‑filling model of recombinant glucose‑6‑phos phate dehydrogenase (G6PD; NP_000393), is shown. The location of aspirin‑acetylated lysine residues are highlighted in blue (K77, K112, K119, K201, K235, K390, K396, K416, K438, K459, K462, K527, K538, K544).

Journal: Molecular medicine reports

Article Title: Aspirin inhibits glucose‑6‑phosphate dehydrogenase activity in HCT 116 cells through acetylation: Identification of aspirin-acetylated sites.

doi: 10.3892/mmr.2016.5449

Figure Lengend Snippet: Figure 4. 3‑Dimension space‑filling model of recombinant glucose‑6‑phos phate dehydrogenase (G6PD; NP_000393), is shown. The location of aspirin‑acetylated lysine residues are highlighted in blue (K77, K112, K119, K201, K235, K390, K396, K416, K438, K459, K462, K527, K538, K544).

Article Snippet: The recombinant G6PD protein (isoform a) was obtained from Origene Technologies, Inc. (Rockville, MD, USA).

Techniques: Recombinant

Figure 2. a-syn mutant hNs show flux through the PPP (A–E) Profiling of U-C13-glucose metabolism in hiPSC-derived hNs shows the major metabolites altered in A53T relative to corrected (A and B) grouped by metabolite class; glycolytic (C), adenosine phosphates (D) and redox substrates (E). *p < 0.05, **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (F) Profiling of [1,2]-C13-glucose metabolism to lactate shows that both glycolytic (M+2) and PPP (M+1) flux is decreased in A53T-hNs relative to Corr-hNs. **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (G) Schematic of the PPP, which regulates redox homeostasis via the GSH cycle. (H and I) Ratiometric levels of NADPH/NADP were assessed in hESC-derived WT and A53T hNs (H) or hiPSC-A53T and corrected hNs (I) to confirm a decrease in flux through the PPP. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 inde- pendent samples over three differentiations. DIV: 55–65. (J) Measurement of G6PD activity in hiPSC-A53T and corrected hNs shows significantly reduced G6PD activity in hiPSC-A53T-hNs relative to control. Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K and L) Ratiometric levels of GSH/GSSG were assessed in hESC-derived WT and A53T hNs (K) and hiPSC-A53T and corrected hNs (L) to confirm a decrease in GSH cycling. **p < 0.01 by t test. Data represent mean ± SEM. n = 8 inde- pendent samples over three differentiations. DIV: 55–65.

Journal: Cell reports

Article Title: G6PD deficiency triggers dopamine loss and the initiation of Parkinson's disease pathogenesis.

doi: 10.1016/j.celrep.2024.115178

Figure Lengend Snippet: Figure 2. a-syn mutant hNs show flux through the PPP (A–E) Profiling of U-C13-glucose metabolism in hiPSC-derived hNs shows the major metabolites altered in A53T relative to corrected (A and B) grouped by metabolite class; glycolytic (C), adenosine phosphates (D) and redox substrates (E). *p < 0.05, **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (F) Profiling of [1,2]-C13-glucose metabolism to lactate shows that both glycolytic (M+2) and PPP (M+1) flux is decreased in A53T-hNs relative to Corr-hNs. **p < 0.01 by t test. Data represent mean ± SEM. n = 3 independent samples. (G) Schematic of the PPP, which regulates redox homeostasis via the GSH cycle. (H and I) Ratiometric levels of NADPH/NADP were assessed in hESC-derived WT and A53T hNs (H) or hiPSC-A53T and corrected hNs (I) to confirm a decrease in flux through the PPP. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 inde- pendent samples over three differentiations. DIV: 55–65. (J) Measurement of G6PD activity in hiPSC-A53T and corrected hNs shows significantly reduced G6PD activity in hiPSC-A53T-hNs relative to control. Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K and L) Ratiometric levels of GSH/GSSG were assessed in hESC-derived WT and A53T hNs (K) and hiPSC-A53T and corrected hNs (L) to confirm a decrease in GSH cycling. **p < 0.01 by t test. Data represent mean ± SEM. n = 8 inde- pendent samples over three differentiations. DIV: 55–65.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gelatin/Gelatin from bovine skin Sigma Cat# G9391 G6PD Recombinant R&D Systems Cat# 10096-DH Dopamine hydrochloride Standard Sigma Cat# 1225204 Doxycycline hyclate Sigma Cat# D9891 HiSpeed Maxi Plasmid kit Qiagen Cat# 12662 Opti-MEM Fisher Cat# 31985-062 Polyethyleneimine (PEI transfection reagent) Santacruz Cat# sc-507213 Polyethylene Glycol 8000 (PEG), Fisher BioReagents Fisher BP233-1 Nucleospin RNA Virus Takara Bio Cat# 740956.10 Lenti-X qRT-PCR Titration Kit Takara Bio Cat# 631235 Quantitect Reverse Transcription kit Qiagen Cat# 205311 SsoAdvanced Universal SYBR Green Supermix BioRad Cat# 1725270 Dynabeads protein G Invitrogen Cat#10004D Critical Commercial Assays Bio-Rad DC Protein assay Bio-Rad Cat#5000112 G6PD activity assay Abcam Cat# ab176722 Glutathione Colorimetric Detection Kit Invitrogen Cat# EIAGSHC Fluorometric NADP/NADPH Assay Kit Abcam Cat# ab176724 Deposited Data Metabolomic Data Metabolights Metabolights:MTBLS11250 Experimental Models: Cell Lines Human: hESC-derived WT and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: hiPSC-derived Corrected and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: SHSY5Y cells ATCC Cat# CRL-2266 Experimental models: Organisms/strains Mouse: B6C3F1/J The Jackson Laboratory Jax: 100010 Mouse: B6; C3-Tg(Prnp-SNCA*A53T)83Vle/J The Jackson Laboratory Jax: 004479 Oligonucleotides G6PD forward Sigma AGCTGGAGGACTTCTTTGCC G6PD reverse Sigma TGATGCGGTTCCAGCCTATC Recombinant DNA pET21a-alpha-synuclein Addgene Cat#51486 pET21a-alpha-synuclein-delta-C-Term (a.a. 1–119) Genscript Custom pET28a+-G6PD-Sumo Genscript Custom pWPXLd_EF1a_Trx1_IRES_EGFP Genscript Custom pWPXLd backbone Addgene 12258 pLenti6.2_mCherry_Grx1_roGFP2 Addgene 155045 shScramble-GFP Origene TR30021 shG6PD-A-GFP Origene TL312877A - ATGAGCCAGATAGGCTGG AACCGCATCAT shG6PD-D-GFP Origene TL312877D - CAGCCGTCGTCCTCTATG TGGAGAATGAG (Continued on next page) Cell Reports 44, 115178, January 28, 2025 19

Techniques: Mutagenesis, Derivative Assay, Activity Assay, Control

Figure 3. Synaptic tethering of the PPP enzyme G6PD is reduced in a-syn mutant hNs (A and B) Sucrose gradient (SG)-enriched synaptic vesicle (SV) fractions from hiPSC-derived A53T and corrected hNs were probed for PPP enzymes and a-syn, and the amount of SV-associated protein relative to input was quantified (B). WCE, whole-cell extract; NucP, nuclear pellet; VMP, vesicle and mitochondrial pellet; S2, supernatant 2. *p < 0.05, **p < 0.01 by ANOVA followed by Tukey’s post hoc test. Data represent mean ± SEM. n = 3 independent differentiations. DIV: 55–65. (C) Super-resolution micrographs of hiPSC- derived corrected and A53T hNs immunolabeled for G6PD and a-syn-PS129 relative to synapto- physin (SYP). Scale bar: 50 mm. (D and E) Distance analysis (DiAna) of G6PD relative to SYP (D) and a-syn-PS129 (E), coupled with colocalization analysis (F), shows that, in A53T-hNs, G6PD moves away from SVs while moving closer to a-syn-PS129. **p < 0.01 by t test. Data represent mean ± SEM. 4 independent cov- erslips over three differentiations were used to generate data. n = 10,000–12,000 individual dis- tance measurements. DIV: 55–65. (G and H) Immunohistochemistry of G6PD and a-syn in the putamen of human control or PD/LBD cases shows an increase in LB-like structures that are positive for G6PD. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 control and 6 LBD cases. Scale bar: 10 mm.

Journal: Cell reports

Article Title: G6PD deficiency triggers dopamine loss and the initiation of Parkinson's disease pathogenesis.

doi: 10.1016/j.celrep.2024.115178

Figure Lengend Snippet: Figure 3. Synaptic tethering of the PPP enzyme G6PD is reduced in a-syn mutant hNs (A and B) Sucrose gradient (SG)-enriched synaptic vesicle (SV) fractions from hiPSC-derived A53T and corrected hNs were probed for PPP enzymes and a-syn, and the amount of SV-associated protein relative to input was quantified (B). WCE, whole-cell extract; NucP, nuclear pellet; VMP, vesicle and mitochondrial pellet; S2, supernatant 2. *p < 0.05, **p < 0.01 by ANOVA followed by Tukey’s post hoc test. Data represent mean ± SEM. n = 3 independent differentiations. DIV: 55–65. (C) Super-resolution micrographs of hiPSC- derived corrected and A53T hNs immunolabeled for G6PD and a-syn-PS129 relative to synapto- physin (SYP). Scale bar: 50 mm. (D and E) Distance analysis (DiAna) of G6PD relative to SYP (D) and a-syn-PS129 (E), coupled with colocalization analysis (F), shows that, in A53T-hNs, G6PD moves away from SVs while moving closer to a-syn-PS129. **p < 0.01 by t test. Data represent mean ± SEM. 4 independent cov- erslips over three differentiations were used to generate data. n = 10,000–12,000 individual dis- tance measurements. DIV: 55–65. (G and H) Immunohistochemistry of G6PD and a-syn in the putamen of human control or PD/LBD cases shows an increase in LB-like structures that are positive for G6PD. **p < 0.01 by t test. Data represent mean ± SEM. n = 6 control and 6 LBD cases. Scale bar: 10 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gelatin/Gelatin from bovine skin Sigma Cat# G9391 G6PD Recombinant R&D Systems Cat# 10096-DH Dopamine hydrochloride Standard Sigma Cat# 1225204 Doxycycline hyclate Sigma Cat# D9891 HiSpeed Maxi Plasmid kit Qiagen Cat# 12662 Opti-MEM Fisher Cat# 31985-062 Polyethyleneimine (PEI transfection reagent) Santacruz Cat# sc-507213 Polyethylene Glycol 8000 (PEG), Fisher BioReagents Fisher BP233-1 Nucleospin RNA Virus Takara Bio Cat# 740956.10 Lenti-X qRT-PCR Titration Kit Takara Bio Cat# 631235 Quantitect Reverse Transcription kit Qiagen Cat# 205311 SsoAdvanced Universal SYBR Green Supermix BioRad Cat# 1725270 Dynabeads protein G Invitrogen Cat#10004D Critical Commercial Assays Bio-Rad DC Protein assay Bio-Rad Cat#5000112 G6PD activity assay Abcam Cat# ab176722 Glutathione Colorimetric Detection Kit Invitrogen Cat# EIAGSHC Fluorometric NADP/NADPH Assay Kit Abcam Cat# ab176724 Deposited Data Metabolomic Data Metabolights Metabolights:MTBLS11250 Experimental Models: Cell Lines Human: hESC-derived WT and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: hiPSC-derived Corrected and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: SHSY5Y cells ATCC Cat# CRL-2266 Experimental models: Organisms/strains Mouse: B6C3F1/J The Jackson Laboratory Jax: 100010 Mouse: B6; C3-Tg(Prnp-SNCA*A53T)83Vle/J The Jackson Laboratory Jax: 004479 Oligonucleotides G6PD forward Sigma AGCTGGAGGACTTCTTTGCC G6PD reverse Sigma TGATGCGGTTCCAGCCTATC Recombinant DNA pET21a-alpha-synuclein Addgene Cat#51486 pET21a-alpha-synuclein-delta-C-Term (a.a. 1–119) Genscript Custom pET28a+-G6PD-Sumo Genscript Custom pWPXLd_EF1a_Trx1_IRES_EGFP Genscript Custom pWPXLd backbone Addgene 12258 pLenti6.2_mCherry_Grx1_roGFP2 Addgene 155045 shScramble-GFP Origene TR30021 shG6PD-A-GFP Origene TL312877A - ATGAGCCAGATAGGCTGG AACCGCATCAT shG6PD-D-GFP Origene TL312877D - CAGCCGTCGTCCTCTATG TGGAGAATGAG (Continued on next page) Cell Reports 44, 115178, January 28, 2025 19

Techniques: Mutagenesis, Derivative Assay, Immunolabeling, Immunohistochemistry, Control

Figure 6. Loss of G6PD function is associ- ated with PD onset (A and B) Single-variant association analysis of G6PD missense mutations with an initial diagnosis of PD (G20) from 395,781 UK Biobank study par- ticipants showed several mutations with signifi- cant PD association. The allele frequency of each mutation in PD cases and controls is depicted (B). (C and D) G6PD knockdown in hiPSC-derived A53T and corrected hNs (C) was confirmed by qPCR analysis of gene expression (D). Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. Scale bar: 50 mm. (E–H) Western blot analysis in hiPSC-derived A53T and corrected hNs following G6PD knock- down (E) with quantification of G6PD (F), a-syn (G), and a-syn-PS129 (H) protein levels. Data repre- sent mean ± SEM. n = 4. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. #p < 0.05 by Fisher least significant difference. (I) GSH levels in in hiPSC-derived A53T and cor- rected hNs following G6PD knockdown. Data represent mean ± SEM. n = 4. *p < 0.05, **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. (J–K) nIRF Ox-DA blots (J) with quantification (K). Data represent mean ± SEM. n = 8. *p < 0.05, **p < 0.01 by ANOVA followed by post hoc Dun- nett’s test. S, scrambled; A, shG6PD-A; D, shG6PD-D; P, shG6PD-pooled.

Journal: Cell reports

Article Title: G6PD deficiency triggers dopamine loss and the initiation of Parkinson's disease pathogenesis.

doi: 10.1016/j.celrep.2024.115178

Figure Lengend Snippet: Figure 6. Loss of G6PD function is associ- ated with PD onset (A and B) Single-variant association analysis of G6PD missense mutations with an initial diagnosis of PD (G20) from 395,781 UK Biobank study par- ticipants showed several mutations with signifi- cant PD association. The allele frequency of each mutation in PD cases and controls is depicted (B). (C and D) G6PD knockdown in hiPSC-derived A53T and corrected hNs (C) was confirmed by qPCR analysis of gene expression (D). Data represent mean ± SEM. n = 6. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. Scale bar: 50 mm. (E–H) Western blot analysis in hiPSC-derived A53T and corrected hNs following G6PD knock- down (E) with quantification of G6PD (F), a-syn (G), and a-syn-PS129 (H) protein levels. Data repre- sent mean ± SEM. n = 4. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. #p < 0.05 by Fisher least significant difference. (I) GSH levels in in hiPSC-derived A53T and cor- rected hNs following G6PD knockdown. Data represent mean ± SEM. n = 4. *p < 0.05, **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. (J–K) nIRF Ox-DA blots (J) with quantification (K). Data represent mean ± SEM. n = 8. *p < 0.05, **p < 0.01 by ANOVA followed by post hoc Dun- nett’s test. S, scrambled; A, shG6PD-A; D, shG6PD-D; P, shG6PD-pooled.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gelatin/Gelatin from bovine skin Sigma Cat# G9391 G6PD Recombinant R&D Systems Cat# 10096-DH Dopamine hydrochloride Standard Sigma Cat# 1225204 Doxycycline hyclate Sigma Cat# D9891 HiSpeed Maxi Plasmid kit Qiagen Cat# 12662 Opti-MEM Fisher Cat# 31985-062 Polyethyleneimine (PEI transfection reagent) Santacruz Cat# sc-507213 Polyethylene Glycol 8000 (PEG), Fisher BioReagents Fisher BP233-1 Nucleospin RNA Virus Takara Bio Cat# 740956.10 Lenti-X qRT-PCR Titration Kit Takara Bio Cat# 631235 Quantitect Reverse Transcription kit Qiagen Cat# 205311 SsoAdvanced Universal SYBR Green Supermix BioRad Cat# 1725270 Dynabeads protein G Invitrogen Cat#10004D Critical Commercial Assays Bio-Rad DC Protein assay Bio-Rad Cat#5000112 G6PD activity assay Abcam Cat# ab176722 Glutathione Colorimetric Detection Kit Invitrogen Cat# EIAGSHC Fluorometric NADP/NADPH Assay Kit Abcam Cat# ab176724 Deposited Data Metabolomic Data Metabolights Metabolights:MTBLS11250 Experimental Models: Cell Lines Human: hESC-derived WT and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: hiPSC-derived Corrected and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: SHSY5Y cells ATCC Cat# CRL-2266 Experimental models: Organisms/strains Mouse: B6C3F1/J The Jackson Laboratory Jax: 100010 Mouse: B6; C3-Tg(Prnp-SNCA*A53T)83Vle/J The Jackson Laboratory Jax: 004479 Oligonucleotides G6PD forward Sigma AGCTGGAGGACTTCTTTGCC G6PD reverse Sigma TGATGCGGTTCCAGCCTATC Recombinant DNA pET21a-alpha-synuclein Addgene Cat#51486 pET21a-alpha-synuclein-delta-C-Term (a.a. 1–119) Genscript Custom pET28a+-G6PD-Sumo Genscript Custom pWPXLd_EF1a_Trx1_IRES_EGFP Genscript Custom pWPXLd backbone Addgene 12258 pLenti6.2_mCherry_Grx1_roGFP2 Addgene 155045 shScramble-GFP Origene TR30021 shG6PD-A-GFP Origene TL312877A - ATGAGCCAGATAGGCTGG AACCGCATCAT shG6PD-D-GFP Origene TL312877D - CAGCCGTCGTCCTCTATG TGGAGAATGAG (Continued on next page) Cell Reports 44, 115178, January 28, 2025 19

Techniques: Variant Assay, Biomarker Discovery, Mutagenesis, Knockdown, Derivative Assay, Gene Expression, Western Blot

Figure 7. Modulating GSH synthesis rescues dopamine loss in a-syn mutant hNs (A) Schematic of the NAC mode of action with respect to GSH cycling and reduction of DA adducts. (B) Effect of NAC on levels of free GSH in cultured neurons. Data represent mean ± SEM. n = 5. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. (C and D) Live imaging of the Grx1-roGFP (GSH/GSSG) sensor in corrected (Corr-hN) (C) or A53T-hNs (D) shows that NAC reduces rotenone-induced redox stress via GSH cycling. (E–G) HPLC of total DA levels shows that NAC rescues DA loss in hESC-derived A53T-hNs (E) by reducing Ox-DA adduct formation (F), as quantified in (G). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (H–J) HPLC of total DA levels shows that NAC rescues DA loss in hiPSC-derived A53T-hNs (H) by reducing Ox-DA adduct formation (I), as quantified in (J). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K) Schematic of the Trx mode of action from increasing NADPH and GSH cycling to reduction of DA-adducts. (L–N) HPLC of total DA levels shows that Trx1 expression rescues DA loss in hiPSC-derived A53T-hNs (L) by reducing Ox-DA adduct formation (M), as quantified in (N). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (O) Schematic of the AG1 mode of action by stabilizing G6PD and increasing G6PD activity, increasing GSH cycling and reduction of DA adducts. (P–R) Live imaging of the Grx1-roGFP (GSH/GSSG) sensor in corrected (Corr-hN) (P) or A53T-hNs (Q) shows that AG1 reduces rotenone-induced redox stress via GSH cycling. HPLC of total DA levels shows that AG1 treatment rescues in DA loss in hiPSC-derived A53T-hNs (R). Data represent mean ± SEM. n = 6 inde- pendent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test.

Journal: Cell reports

Article Title: G6PD deficiency triggers dopamine loss and the initiation of Parkinson's disease pathogenesis.

doi: 10.1016/j.celrep.2024.115178

Figure Lengend Snippet: Figure 7. Modulating GSH synthesis rescues dopamine loss in a-syn mutant hNs (A) Schematic of the NAC mode of action with respect to GSH cycling and reduction of DA adducts. (B) Effect of NAC on levels of free GSH in cultured neurons. Data represent mean ± SEM. n = 5. **p < 0.01 by ANOVA followed by post hoc Dunnett’s test. (C and D) Live imaging of the Grx1-roGFP (GSH/GSSG) sensor in corrected (Corr-hN) (C) or A53T-hNs (D) shows that NAC reduces rotenone-induced redox stress via GSH cycling. (E–G) HPLC of total DA levels shows that NAC rescues DA loss in hESC-derived A53T-hNs (E) by reducing Ox-DA adduct formation (F), as quantified in (G). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (H–J) HPLC of total DA levels shows that NAC rescues DA loss in hiPSC-derived A53T-hNs (H) by reducing Ox-DA adduct formation (I), as quantified in (J). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (K) Schematic of the Trx mode of action from increasing NADPH and GSH cycling to reduction of DA-adducts. (L–N) HPLC of total DA levels shows that Trx1 expression rescues DA loss in hiPSC-derived A53T-hNs (L) by reducing Ox-DA adduct formation (M), as quantified in (N). Data represent mean ± SEM. n = 6 independent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test. (O) Schematic of the AG1 mode of action by stabilizing G6PD and increasing G6PD activity, increasing GSH cycling and reduction of DA adducts. (P–R) Live imaging of the Grx1-roGFP (GSH/GSSG) sensor in corrected (Corr-hN) (P) or A53T-hNs (Q) shows that AG1 reduces rotenone-induced redox stress via GSH cycling. HPLC of total DA levels shows that AG1 treatment rescues in DA loss in hiPSC-derived A53T-hNs (R). Data represent mean ± SEM. n = 6 inde- pendent cultures per condition over three differentiations. DIV: 45–55. **p < 0.01 by ANOVA followed by post hoc Tukey test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gelatin/Gelatin from bovine skin Sigma Cat# G9391 G6PD Recombinant R&D Systems Cat# 10096-DH Dopamine hydrochloride Standard Sigma Cat# 1225204 Doxycycline hyclate Sigma Cat# D9891 HiSpeed Maxi Plasmid kit Qiagen Cat# 12662 Opti-MEM Fisher Cat# 31985-062 Polyethyleneimine (PEI transfection reagent) Santacruz Cat# sc-507213 Polyethylene Glycol 8000 (PEG), Fisher BioReagents Fisher BP233-1 Nucleospin RNA Virus Takara Bio Cat# 740956.10 Lenti-X qRT-PCR Titration Kit Takara Bio Cat# 631235 Quantitect Reverse Transcription kit Qiagen Cat# 205311 SsoAdvanced Universal SYBR Green Supermix BioRad Cat# 1725270 Dynabeads protein G Invitrogen Cat#10004D Critical Commercial Assays Bio-Rad DC Protein assay Bio-Rad Cat#5000112 G6PD activity assay Abcam Cat# ab176722 Glutathione Colorimetric Detection Kit Invitrogen Cat# EIAGSHC Fluorometric NADP/NADPH Assay Kit Abcam Cat# ab176724 Deposited Data Metabolomic Data Metabolights Metabolights:MTBLS11250 Experimental Models: Cell Lines Human: hESC-derived WT and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: hiPSC-derived Corrected and A53T cell lines Gifted from Rudolf Jaenisch, Whitehead Inst, MIT, Boston, MA N/A Human: SHSY5Y cells ATCC Cat# CRL-2266 Experimental models: Organisms/strains Mouse: B6C3F1/J The Jackson Laboratory Jax: 100010 Mouse: B6; C3-Tg(Prnp-SNCA*A53T)83Vle/J The Jackson Laboratory Jax: 004479 Oligonucleotides G6PD forward Sigma AGCTGGAGGACTTCTTTGCC G6PD reverse Sigma TGATGCGGTTCCAGCCTATC Recombinant DNA pET21a-alpha-synuclein Addgene Cat#51486 pET21a-alpha-synuclein-delta-C-Term (a.a. 1–119) Genscript Custom pET28a+-G6PD-Sumo Genscript Custom pWPXLd_EF1a_Trx1_IRES_EGFP Genscript Custom pWPXLd backbone Addgene 12258 pLenti6.2_mCherry_Grx1_roGFP2 Addgene 155045 shScramble-GFP Origene TR30021 shG6PD-A-GFP Origene TL312877A - ATGAGCCAGATAGGCTGG AACCGCATCAT shG6PD-D-GFP Origene TL312877D - CAGCCGTCGTCCTCTATG TGGAGAATGAG (Continued on next page) Cell Reports 44, 115178, January 28, 2025 19

Techniques: Mutagenesis, Cell Culture, Imaging, Derivative Assay, Expressing, Activity Assay