Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Delocalization of the shelterin TRF2-interacting partner RAP1 but not TRF1 after lamin B1 overexpression ( A ) Indirect immunofluorescence analysis of RAP1 in SV40-fibroblasts 48 h after transfection with CTRL or LMNB1 expression vectors. Representative images of cells overexpressing lamin B1 by 1–2-fold and 2–5-fold are shown on the left panel: cells were immunostained with antibodies specific for RAP1 (green) and lamin B1 (red) and nuclei were counterstained with DAPI. Percentages of cells with abnormal RAP1 staining are shown on the right panel in cells transfected with control vector (CTRL) or with lamin B1 vector (LMNB1), divided in two categories (cells overexpressing lamin B1 (+) or with no significant overexpression of lamin B1 compared to control (–)). Means ± SD of three independent experiments. *** t -test P value < 0.0002. ( B ) Western-blot analysis of RAP1 protein levels in cells described in (A). Cell lysates were processed for western blotting with antibodies specific for RAP1, lamin B1 and β-actin as loading control. Representative blots and quantification from six independent experiments are shown (right panel). Histograms show means ± SD; ns = t -test P value non-significant. ( C ) Indirect immunofluorescence staining of TRF1 in SV40-fibroblasts 48 h after lamin-B1 overexpression. Representative images are shown on top: cells were immunostained with antibodies specific for TRF1 (green) and lamin B1 (red) and nuclei were counterstained with DAPI. At bottom, quantification of TRF1 foci number per cells is shown on left from three independent experiments (means ± SEM; ns = t -test P value non-significant). Quantification of cells with abnormal staining pattern of TRF1, 48 h after lamin B1-overexpression, is shown on right (mean ± SEM from three independent experiments; ns = t -test P value non-significant)

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Immunofluorescence, Transfection, Expressing, Staining, Plasmid Preparation, Western Blot

Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Lamin B1 interacts endogenously with RAP1 and its overexpression enhances their association preferentially at the nuclear periphery ( A ) SV40-fibroblasts were subjected to proximity ligation assay (PLA) using antibodies against lamin B1 and RAP1. Right , representative confocal images showing in situ interaction between lamin B1 and RAP1 visualized as red fluorescent dots in nucleus delimited by DAPI counterstaining (blue). Left , quantification of RAP1-Lamin B1 PLA dots per nucleus (medians in red; n = 3 independent experiments; ≥129 nuclei per condition; *** t -test P value < 0.0001). PLA was also performed using one of the primary antibody against RAP1 or lamin B1 protein alone as a negative control (RAP1 Ab or Lamin B1 Ab). ( B ) Co-immunoprecipitation (co-IP) of lamin B1 and RAP1. SV40-fibroblasts were co-transfected with FLAG-Lamin B1 and HA-RAP1 expressing vectors and co-IP was carried out using anti-flag antibody on cellular lysates—pretreated with benzonase—and analyzed by Western blot using specific antibodies against lamin B1 or RAP1 protein. Similar results were found in two independent experiments. ( C ) Quantification of RAP1-Lamin B1 PLA dots in SV40-fibroblasts transfected either with lamin B1-expressing vector (LMNB1) or control vector (CTRL) and subjected to PLA as described in (A), 48 h after transfection. Data combined from 2 independent experiments are shown (means in red; ≥92 nuclei per condition; P value < 0.0001) ( D ) Quantification of the percentage of RAP1-lamin B1 PLA signals per nuclei that were localized in the area of the nuclear envelope in Z-stacks from 3D confocal images obtained from PLA experiments on lamin B1-overexpressing cells (LMNB1+) compared to control cells (mean ± SEM from n ≥ 50 nuclei analyzed per condition is shown; t -test P value < 0.0001). Similar results were obtained in three other independent experiments. On the left side (i), nucleus from LMNB1-transfected cell with RAP1-lamin B1 PLA signals (in red) and DAPI staining (in blue) and an enlargement (ii) of an area of the nucleus showing PLA dots (in red) localized at the nuclear periphery. (E, F) Impact of RAP1 depletion on TRF2-lamin B1 interaction and reciprocally, impact of TRF2 depletion on RAP1-lamin B1 interaction. SV40-fibroblasts transfected either with siRNA targeting RAP1 (siRAP1), TRF2 (siTRF2) or control siRNA (siCTRL) for 48 h were processed for lamin B1-TRF2 PLA ( E ) or lamin B1-RAP1 PLA ( F ) with specific antibodies (Ab) or one antibody alone as control. Quantification of PLA dots per nucleus (medians are in red; n > 100 nuclei per conditions per experiment; *** t -test P value < 0.0001, n = 4 and n = 6 independent experiments for panels (E) and (F), respectively). Negative PLA controls performed with one of the primary antibody against RAP1, TRF2 or lamin B1 protein alone (RAP1 Ab, TRF2 Ab or Lamin B1 Ab) are shown.

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Proximity Ligation Assay, In Situ, Negative Control, Immunoprecipitation, Co-Immunoprecipitation Assay, Transfection, Expressing, Western Blot, Plasmid Preparation, Staining

Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Model for lamin B1 overexpression-induced telomere instability in human cells. Lamin B1 overexpression leads to the mislocalization of the shelterin protein TRF2 and its binding partner RAP1 through enhanced interactions preferentially located at the nuclear periphery. Mislocalization of TRF2 and RAP1 could lead to telomere uncapping. Deprotected telomeres become recognized as damage by the DNA repair machinery (as assessed by the observation of TIFs). They could therefore undergo inappropriate repairs resulting in telomere instability marked by the observed telomeric fusions and telomere losses.

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Binding Assay