Journal: Scientific reports

Article Title: CD147 regulates the Rap1 signaling pathway to promote proliferation, migration, and invasion, and inhibit apoptosis in colorectal cancer cells.

doi: 10.1038/s41598-025-98266-8

Figure Lengend Snippet: Fig. 5. Rap1 overexpression reverses the expression of key proteins in CD147 knockdown mediated cell proliferation, apoptosis and EMT. (A, B) Western blot analysis of Rap1 and Rap1GAP protein levels in HCT116 and SW620 cells after CD147 knockdown (shCD147). β-actin served as a loading control. Data represent mean ± SD (n = 3; **P < 0.01, ***P < 0.001 vs. shNC, Student’s t-test). Original blots are presented in Supplementary Fig. 3. (C) qRT-PCR validation of Rap1 mRNA overexpression in CD147-knockdown cells. Expression normalized to β-actin (n = 3; ***P < 0.001 vs. HCT116 or SW620, Student’s t-test). (D, E) Western blot analysis of c-Myc, Bcl-2, Bax, N-cadherin, and E-cadherin protein levels in CD147-Knockdown cells with Rap1 overexpression (n = 3; *P < 0.05, **P < 0.01, ***P < 0.001 vs. shNC, #P < 0.05, ##P < 0.01, ###P < 0.001 vs. shCD147, one-way ANOVA). Original blots are presented in Supplementary Fig. 4.

Article Snippet: Supplier Antibody dilution used WB/IF Anti CD147 mouse monoclonal antibody 66443-1-AP ProteinTech Group, Inc. 1:5000 /1:200 Anti N-cadherin rabbit polyclonal antibody 22018-1-AP ProteinTech Group, Inc. 1:5000 Anti E-cadherin rabbit polyclonal antibody 20874-1-AP ProteinTech Group, Inc. 1:10000 Anti c-myc mouse monoclonal antibody 67,447-AP ProteinTech Group, Inc. 1:5000 Anti RAP1GAP rabbit polyclonal antibody 19174-1-AP ProteinTech Group, Inc. 1:2000 Anti RAP1 rabbit polyclonal antibody 14595-1-AP ProteinTech Group, Inc. 1:1000 Anti β-actin rabbit polyclonal antibody 20536-1-AP ProteinTech Group, Inc. 1:8000 HRP-conjugated Goat Anti-Mouse IgG(H + L) SA00001-1 ProteinTech Group, Inc. 1:10000 Goat Anti-Mouse IgG H&L (Alexa Fluor® 594) ab150116 Abcam 1:200 Table 1.

Techniques: Over Expression, Expressing, Knockdown, Western Blot, Control, Quantitative RT-PCR, Biomarker Discovery

Journal: Scientific reports

Article Title: CD147 regulates the Rap1 signaling pathway to promote proliferation, migration, and invasion, and inhibit apoptosis in colorectal cancer cells.

doi: 10.1038/s41598-025-98266-8

Figure Lengend Snippet: Fig. 7. Rap1 restores CD147-mediated migration and invasion in colorectal cancer cells. (A, C) Scratch wound healing assay in HCT116 cells. Healing rates were quantified at 24 h and 48 h (n = 3; ***P < 0.001 vs. shNC, ##P < 0.01, ###P < 0.001 vs. shCD147, one-way ANOVA). (B, D) Transwell migration and Matrigel invasion assays. Migrated/invaded cells were counted and normalized to shCtrl (n = 3; ***P < 0.001 vs. shNC, ###P < 0.001 vs. shCD147, one-way ANOVA). SW620 cells showed consistent trends. (E) Mechanistic diagram of CD147 promoting tumor progression through Rap1/Rap1GAP signaling in colorectal cancer cells.

Article Snippet: Supplier Antibody dilution used WB/IF Anti CD147 mouse monoclonal antibody 66443-1-AP ProteinTech Group, Inc. 1:5000 /1:200 Anti N-cadherin rabbit polyclonal antibody 22018-1-AP ProteinTech Group, Inc. 1:5000 Anti E-cadherin rabbit polyclonal antibody 20874-1-AP ProteinTech Group, Inc. 1:10000 Anti c-myc mouse monoclonal antibody 67,447-AP ProteinTech Group, Inc. 1:5000 Anti RAP1GAP rabbit polyclonal antibody 19174-1-AP ProteinTech Group, Inc. 1:2000 Anti RAP1 rabbit polyclonal antibody 14595-1-AP ProteinTech Group, Inc. 1:1000 Anti β-actin rabbit polyclonal antibody 20536-1-AP ProteinTech Group, Inc. 1:8000 HRP-conjugated Goat Anti-Mouse IgG(H + L) SA00001-1 ProteinTech Group, Inc. 1:10000 Goat Anti-Mouse IgG H&L (Alexa Fluor® 594) ab150116 Abcam 1:200 Table 1.

Techniques: Migration, Wound Healing Assay

Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Delocalization of the shelterin TRF2-interacting partner RAP1 but not TRF1 after lamin B1 overexpression ( A ) Indirect immunofluorescence analysis of RAP1 in SV40-fibroblasts 48 h after transfection with CTRL or LMNB1 expression vectors. Representative images of cells overexpressing lamin B1 by 1–2-fold and 2–5-fold are shown on the left panel: cells were immunostained with antibodies specific for RAP1 (green) and lamin B1 (red) and nuclei were counterstained with DAPI. Percentages of cells with abnormal RAP1 staining are shown on the right panel in cells transfected with control vector (CTRL) or with lamin B1 vector (LMNB1), divided in two categories (cells overexpressing lamin B1 (+) or with no significant overexpression of lamin B1 compared to control (–)). Means ± SD of three independent experiments. *** t -test P value < 0.0002. ( B ) Western-blot analysis of RAP1 protein levels in cells described in (A). Cell lysates were processed for western blotting with antibodies specific for RAP1, lamin B1 and β-actin as loading control. Representative blots and quantification from six independent experiments are shown (right panel). Histograms show means ± SD; ns = t -test P value non-significant. ( C ) Indirect immunofluorescence staining of TRF1 in SV40-fibroblasts 48 h after lamin-B1 overexpression. Representative images are shown on top: cells were immunostained with antibodies specific for TRF1 (green) and lamin B1 (red) and nuclei were counterstained with DAPI. At bottom, quantification of TRF1 foci number per cells is shown on left from three independent experiments (means ± SEM; ns = t -test P value non-significant). Quantification of cells with abnormal staining pattern of TRF1, 48 h after lamin B1-overexpression, is shown on right (mean ± SEM from three independent experiments; ns = t -test P value non-significant)

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Immunofluorescence, Transfection, Expressing, Staining, Plasmid Preparation, Western Blot

Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Lamin B1 interacts endogenously with RAP1 and its overexpression enhances their association preferentially at the nuclear periphery ( A ) SV40-fibroblasts were subjected to proximity ligation assay (PLA) using antibodies against lamin B1 and RAP1. Right , representative confocal images showing in situ interaction between lamin B1 and RAP1 visualized as red fluorescent dots in nucleus delimited by DAPI counterstaining (blue). Left , quantification of RAP1-Lamin B1 PLA dots per nucleus (medians in red; n = 3 independent experiments; ≥129 nuclei per condition; *** t -test P value < 0.0001). PLA was also performed using one of the primary antibody against RAP1 or lamin B1 protein alone as a negative control (RAP1 Ab or Lamin B1 Ab). ( B ) Co-immunoprecipitation (co-IP) of lamin B1 and RAP1. SV40-fibroblasts were co-transfected with FLAG-Lamin B1 and HA-RAP1 expressing vectors and co-IP was carried out using anti-flag antibody on cellular lysates—pretreated with benzonase—and analyzed by Western blot using specific antibodies against lamin B1 or RAP1 protein. Similar results were found in two independent experiments. ( C ) Quantification of RAP1-Lamin B1 PLA dots in SV40-fibroblasts transfected either with lamin B1-expressing vector (LMNB1) or control vector (CTRL) and subjected to PLA as described in (A), 48 h after transfection. Data combined from 2 independent experiments are shown (means in red; ≥92 nuclei per condition; P value < 0.0001) ( D ) Quantification of the percentage of RAP1-lamin B1 PLA signals per nuclei that were localized in the area of the nuclear envelope in Z-stacks from 3D confocal images obtained from PLA experiments on lamin B1-overexpressing cells (LMNB1+) compared to control cells (mean ± SEM from n ≥ 50 nuclei analyzed per condition is shown; t -test P value < 0.0001). Similar results were obtained in three other independent experiments. On the left side (i), nucleus from LMNB1-transfected cell with RAP1-lamin B1 PLA signals (in red) and DAPI staining (in blue) and an enlargement (ii) of an area of the nucleus showing PLA dots (in red) localized at the nuclear periphery. (E, F) Impact of RAP1 depletion on TRF2-lamin B1 interaction and reciprocally, impact of TRF2 depletion on RAP1-lamin B1 interaction. SV40-fibroblasts transfected either with siRNA targeting RAP1 (siRAP1), TRF2 (siTRF2) or control siRNA (siCTRL) for 48 h were processed for lamin B1-TRF2 PLA ( E ) or lamin B1-RAP1 PLA ( F ) with specific antibodies (Ab) or one antibody alone as control. Quantification of PLA dots per nucleus (medians are in red; n > 100 nuclei per conditions per experiment; *** t -test P value < 0.0001, n = 4 and n = 6 independent experiments for panels (E) and (F), respectively). Negative PLA controls performed with one of the primary antibody against RAP1, TRF2 or lamin B1 protein alone (RAP1 Ab, TRF2 Ab or Lamin B1 Ab) are shown.

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Proximity Ligation Assay, In Situ, Negative Control, Immunoprecipitation, Co-Immunoprecipitation Assay, Transfection, Expressing, Western Blot, Plasmid Preparation, Staining

Journal: Nucleic Acids Research

Article Title: Increase in lamin B1 promotes telomere instability by disrupting the shelterin complex in human cells

doi: 10.1093/nar/gkab761

Figure Lengend Snippet: Model for lamin B1 overexpression-induced telomere instability in human cells. Lamin B1 overexpression leads to the mislocalization of the shelterin protein TRF2 and its binding partner RAP1 through enhanced interactions preferentially located at the nuclear periphery. Mislocalization of TRF2 and RAP1 could lead to telomere uncapping. Deprotected telomeres become recognized as damage by the DNA repair machinery (as assessed by the observation of TIFs). They could therefore undergo inappropriate repairs resulting in telomere instability marked by the observed telomeric fusions and telomere losses.

Article Snippet: The HA-RAP1 expression vector was obtained by cloning a PCR product (Primer forward: GAAAACCTGTATTTTCAGGGCGCTCCGGAAGCGGAGGCGATGGATTTG; primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCGAGTCATTTCTTTCGAAATTCAATCCTCC) amplified from pCMV6-AC-GFP-RAP1 (RC205112, OriGene) into pDONOR207.

Techniques: Over Expression, Binding Assay

Journal: Biochemical pharmacology

Article Title: mTORC2 is an important target for simvastatin-associated toxicity in C2C12 cells and mouse skeletal muscle - Roles of Rap1 geranylgeranylation and mitochondrial dysfunction.

doi: 10.1016/j.bcp.2021.114750

Figure Lengend Snippet: Fig. 3. mTORC2 inactivation in C2C12 myoblasts leads to a similar toxicity as treatment with simvastatin. C2C12 myoblasts were transfected for 24 h with control siRNA or 60 pmol Rictor siRNA and treated with 10 μM simvastatin and/or 100 ng/mL insulin and/or 100 µM mevalonate and/or 50 µM geranylgeraniol and/or 50 µM farnesol. DMSO 0.1% was used as negative control and 1% Triton-X 100 as positive control (not shown). A. Membrane toxicity (AK release) in transfected cells treated for 24 h. B. Intracellular ATP in transfected cells treated for 24 h. C. Quantification for Rictor, P-Akt Ser473 and P-S6rp 235/236 based on the immunoblots 3D and 3E. D and E. Representative immunoblots of Rictor, P-Akt and P-S6rp. Data represent the mean ± SEM of at least three independent experiments. F. Expression of Ki-67 mRNA. *P < 0.05 versus 0.1 % respective DMSO control sample; +P < 0.05 versus respective 10 μM simvastatin sample. #P < 0.05 Rictor siRNA samples versus respective control siRNA samples. SMV: simvastatin, INS: insulin, MEVA: mevalonate, GGOH: geranylgeraniol, FOH: farnesol.

Article Snippet: Rap1 siRNA (mouse), Rictor siRNA (mouse) and Control siRNA-A were purchased from Santa Cruz Biotechnology (sc-61479 and sc-37007, respectively; USA).

Techniques: Transfection, Control, Negative Control, Positive Control, Membrane, Western Blot, Expressing

Journal: Biochemical pharmacology

Article Title: mTORC2 is an important target for simvastatin-associated toxicity in C2C12 cells and mouse skeletal muscle - Roles of Rap1 geranylgeranylation and mitochondrial dysfunction.

doi: 10.1016/j.bcp.2021.114750

Figure Lengend Snippet: Fig. 7. Simvastatin increases mitochondrial ROS production, which can be mitigated by antioxidants and which contributes to impaired function of mTORC2 and cytotoxicity. C2C12 myoblasts or myotubes were treated for 24 h with 10 μM simvastatin and/or 10 to 20 μM MitoTEMPO and/or 10 to 50 µM geranylgeraniol. MitoSOX Red dye was used to quantify mitochondrial superoxide production. DMSO 0.1% was used as a negative control and 100 μM antimycin A as a positive control (1 h exposure) A. Mitochondrial O2 •- accumulation in C2C12 myoblasts transfected with control siRNA or Rap1 siRNA. B. Mitochondrial O2 •- accumulation in C2C12 myotubes treated with simvastatin or antimycin A. C. Membrane integrity (AK release) of C2C12 myotubes treated with simvastatin, MitoTEMPO, or anti mycin A. D. Intracellular ATP of C2C12 myotubes treated with simvastatin, MitoTEMPO or antimycin A. E. mTORC2 activity assessed by phosphorylation levels of Akt (Ser473) in C2C12 myotubes treated with simvastatin, MitoTEMPO or antimycin A. F. Quantification of Akt (Ser473) phosphorylation shown in E. Data represent the mean ± SEM of at least three independent experiments. *P < 0.05 versus the respective DMSO control; +P < 0.05 versus 10 μM simvastatin or 100 μM antimycin A. SMV: simvastatin, GGOH: geranylgeraniol, MITOT: MitoTEMPO, ANT.A: antimycin A.

Article Snippet: Rap1 siRNA (mouse), Rictor siRNA (mouse) and Control siRNA-A were purchased from Santa Cruz Biotechnology (sc-61479 and sc-37007, respectively; USA).

Techniques: Negative Control, Positive Control, Transfection, Control, Membrane, Activity Assay, Phospho-proteomics

Journal: Biochemical pharmacology

Article Title: mTORC2 is an important target for simvastatin-associated toxicity in C2C12 cells and mouse skeletal muscle - Roles of Rap1 geranylgeranylation and mitochondrial dysfunction.

doi: 10.1016/j.bcp.2021.114750

Figure Lengend Snippet: Fig. 8. Effects of simvastatin on mTORC1 and mTORC2. Simvastatin impairs the function of mTORC2 by inhibition of Rap1 and by mitochondrial damage. Impaired function of mTORC2 reduces the function of Akt (impaired phosphorylation of Ser473), which limits the function of mTORC1 and increases the expression of atrogin- 1. Impaired function of mTORC1 reduces the activity of S6rp. Cell death associated with simvastatin can be explained by apoptosis (via inhibition of Akt and mitochondrial damage) and necrosis (mitochondrial damage).

Article Snippet: Rap1 siRNA (mouse), Rictor siRNA (mouse) and Control siRNA-A were purchased from Santa Cruz Biotechnology (sc-61479 and sc-37007, respectively; USA).

Techniques: Inhibition, Phospho-proteomics, Expressing, Activity Assay

Journal: Journal of Cell Science

Article Title: Talin, a Rap1 effector for integrin activation at the plasma membrane, also promotes Rap1 activity by disrupting sequestration of Rap1 by SHANK3

doi: 10.1242/jcs.263595

Figure Lengend Snippet: Optogenetic recruitment of talin to the plasma membrane of endothelial cells leads to activation of Rap1. (A) Schematic representation of the optogenetic constructs CIBN–GFP–CAAX and CRY2–mCherry–talin expressed in immortalized mouse lung endothelial cells. The CIBN moiety is anchored to the plasma membrane and recruits CRY2–mCherry–talin upon exposure of the cells to 450 nm (blue) light. Previous work has shown that such recruitment leads to activation of integrin αVβ3 . Rap1 activation, the transition from Rap1–GDP to Rap1–GTP, can also be monitored during this process. (B) Time course of Rap1 activation in endothelial cells in response to blue light illumination. Rap1–GTP was selectively pulled down using agarose beads loaded with the Rap-binding domain of RalGDS and detected using an anti-Rap1 antibody. Upper panel: representative western blots of the Rap1–GTP pull-down assay and total Rap1 in whole-cell lysates (input: 5%). Lower panel: quantitative analysis of Rap1–GTP. The ratio of Rap1–GTP to total Rap1 was calculated and normalized to that observed at time zero when the cells were maintained in the dark. Data represent means±s.e.m. of four experiments (* P <0.05; paired two-tailed Student's t -test). (C) Time course of Rap1 activation in response to blue light in A5 CHO cells stably expressing integrin αIIbβ3, CIBN–GFP–CAAX and CRY2–mCherry–talin. Data represent means±s.e.m. of four experiments (* P <0.05; ** P <0.01; paired two-tailed Student's t -test). (D) Recruitment to the plasma membrane of a CRY2–mCherry–talin mutant (R118E) that cannot interact with Rap1 fails to activate Rap1 in A5 CHO cells. Data represent means±s.e.m. of four experiments (N.S., not significant; ** P <0.01; paired two-tailed Student's t -test). (E) Expression of a CRY2–mCherry–talin mutant (L325R) defective in activating integrins still enables Rap1 activation in these cells upon recruitment of CRY2–mCherry–talin to the plasma membrane in A5 CHO cells. Data represent means±s.e.m. of four experiments (* P <0.05; paired two-tailed Student's t -test).

Article Snippet: The mouse monoclonal antibody to Rap1 was from Proteintech (Rosemont, IL, USA; 67174).

Techniques: Clinical Proteomics, Membrane, Activation Assay, Construct, Binding Assay, Western Blot, Pull Down Assay, Two Tailed Test, Stable Transfection, Expressing, Mutagenesis

Journal: Journal of Cell Science

Article Title: Talin, a Rap1 effector for integrin activation at the plasma membrane, also promotes Rap1 activity by disrupting sequestration of Rap1 by SHANK3

doi: 10.1242/jcs.263595

Figure Lengend Snippet: Optogenetic recruitment of talin to the plasma membrane promotes active Rap1 localization to cell edges. (A) Optogenetic recruitment of talin to the plasma membrane promotes active Rap1 localization to the cell periphery in suspended cells. Immortalized murine endothelial cells in suspension expressing CIBN–GFP–CAAX and CRY2–mCherry–talin were illuminated using blue light for 30 min before Rap1–GTP was detected in situ as described in the Materials and Methods. Samples without GST–RalGDS were used as a control (column 1). White arrows indicate enrichment of active Rap1 and CRY2–mCherry–talin at the cell periphery, the former only in response to blue light. Scale bar: 10 µm. (B) Optogenetic recruitment of talin to the plasma membrane enriches active Rap1 localization at cell protrusions in adherent cells. Immortalized murine endothelial cells expressing CIBN–GFP–CAAX and CRY2–mCherry–talin were plated on fibronectin-coated coverslips for 30 min before being illuminated with blue light or maintained in the dark for 30 min. Samples were fixed and in situ Rap1–GTP assay was performed as described in the Materials and Methods. Samples without GST–RalGDS incubation were used as a negative control and are shown in column 1. In these representative images, cell protrusions are highlighted by the small box in the main panel and presented as magnified insets on the bottom right of each image. Blue light illumination induces active Rap1 localization on cell lamellipodium-like protrusions (column 4) and pseudopodium-like protrusions (column 5). Note that such signal enrichment was not seen in cells maintained in the dark (columns 2 and 3) despite the formation of cell protrusions. Scale bars: 20 µm (main panel); 1 µm (inset). Images in A,B are representative of three independent experiments.

Article Snippet: The mouse monoclonal antibody to Rap1 was from Proteintech (Rosemont, IL, USA; 67174).

Techniques: Clinical Proteomics, Membrane, Suspension, Expressing, In Situ, Control, Incubation, Negative Control

Journal: Journal of Cell Science

Article Title: Talin, a Rap1 effector for integrin activation at the plasma membrane, also promotes Rap1 activity by disrupting sequestration of Rap1 by SHANK3

doi: 10.1242/jcs.263595

Figure Lengend Snippet: Overexpression of SHANK3 blocks Rap1 activation induced by talin recruitment to the plasma membrane. (A–C) SHANK3 tagged with Myc–mAzurite was transfected into A5 CHO cells stably expressing CIBN–GFP–CAAX and CRY2–mCherry–talin. Cells triple positive for mAzurite, GFP and mCherry were sorted by flow cytometry. Cells expressing Myc–mAzurite without SHANK3 served as a control. (A) Western blot analysis of SHANK3–Myc–mAzurite expression in these cells. β-actin served as a loading control. SHANK3 overexpression did not affect the levels of CRY2–mCherry–talin. The images represent two independent experiments. (B) SHANK3 overexpression inhibits Rap1 activation in response to the optogenetic recruitment of talin to the plasma membrane. Data represent means±s.e.m. of five experiments (N.S., not significant; ** P <0.01; paired two-tailed Student's t -test). (C) SHANK3 blunts activation of integrin αIIbβ3 in response to the optogenetic recruitment of talin to the plasma membrane. Activation of integrin αIIbβ3 was monitored by flow cytometry using the PAC-1 antibody and expressed as the fold increase relative to that observed when cells were maintained in the dark. Data represent means±s.e.m. of five experiments (* P <0.05; paired two-tailed Student's t -test). (D–G) Lentiviruses encoding the WT SPN domain of SHANK3 [mAzurite–FLAG–SPN (WT)], the R12C SPN mutant [mAzurite–FLAG–SPN (R12C)] or the L68P SPN mutant [Myc–mAzurite–FLAG–SPN (L68P)] were transduced into immortalized murine lung endothelial cells expressing CIBN–GFP–CAAX and CRY2–mCherry–talin. Cells infected with empty lentiviral vector served as controls. (D) WT SPN, but not R12C or L68P SPN, inhibits Rap1 activation following optogenetic recruitment of talin to the plasma membrane. Data represent mean±s.e.m. of four experiments (N.S., not significant; * P <0.05; paired two-tailed Student's t -test). (E) WT SPN, but not the R12C or L68P SPN mutants, inhibits specific fibrinogen binding to integrin αVβ3 upon optogenetic recruitment of talin to the plasma membrane. Data represent means±s.e.m. of eight experiments (N.S., not significant; * P <0.05; ** P <0.01; paired two-tailed Student's t -test). (F,G) Duolink proximity ligation assay (PLA) was performed to examine the effects of SHANK3 SPN on the association of Rap1 with CRY2–mCherry–talin in endothelial cells. (F) Schematic representation of the Duolink PLA. Created in BioRender by Liao, Z., 2025. https://BioRender.com/m47c469 . This figure was sublicensed under CC-BY 4.0 terms. (G) After 30 min of incubation at room temperature in the absence or presence of blue light illumination, cells were fixed, permeabilized and stained with rabbit anti-mCherry and mouse anti-Rap1 antibodies. Then, Duolink PLA flow cytometry was performed to assess the interaction between CRY2–mCherry–talin and Rap1. Cells kept in the dark and untreated with primary antibodies served as controls. Data represent means±s.e.m. of four experiments (* P <0.05; paired two-tailed Student's t -test).

Article Snippet: The mouse monoclonal antibody to Rap1 was from Proteintech (Rosemont, IL, USA; 67174).

Techniques: Over Expression, Activation Assay, Clinical Proteomics, Membrane, Transfection, Stable Transfection, Expressing, Flow Cytometry, Control, Western Blot, Two Tailed Test, Mutagenesis, Infection, Plasmid Preparation, Binding Assay, Proximity Ligation Assay, Incubation, Staining

Journal: Journal of Cell Science

Article Title: Talin, a Rap1 effector for integrin activation at the plasma membrane, also promotes Rap1 activity by disrupting sequestration of Rap1 by SHANK3

doi: 10.1242/jcs.263595

Figure Lengend Snippet: Optogenetic recruitment of talin to the plasma membrane impairs Rap1 interaction with SHANK3. (A) Schematic representation of the Duolink proximity ligation assay (PLA). Cells were fixed, permeabilized and stained with rabbit anti-SHANK3 and mouse anti-Rap1 antibodies before Duolink PLA was performed to assess the proximity of SHANK3 to Rap1. Created in BioRender by Liao, Z., 2025. https://BioRender.com/b40n281 . This figure was sublicensed under CC-BY 4.0 terms. (B) Immortalized murine lung endothelial cells expressing CRY2–mCherry–talin and CIBN–GFP–CAAX were plated on fibrinogen overnight, fixed, permeabilized and stained with anti-SHANK3 and anti-Rap1 antibodies. PLA was performed to evaluate colocalization of endogenous SHANK3 and Rap1. Cell nuclei were counterstained with DAPI and cells were imaged by confocal microscopy. Cells kept in the dark and untreated with primary antibodies served as controls. Two areas within the images with merged signals for PLA and CIBN–GFP–CAAX are highlighted with boxes and presented as magnified insets on the bottom. PLA signals were observed within the cytoplasm (inset on the left) and on the plasma membrane (inset on the right). Scale bars: 35 µm (main panel); 10 µm (inset). Images represent two independent experiments. (C) Immortalized murine lung endothelial cells in suspension were either kept in the dark or exposed to blue light illumination for the indicated times, before being subjected to Duolink PLA assay and analyzed by flow cytometry to quantitatively assess the interaction of endogenous SHANK3 and Rap1. Cells kept in the dark and untreated with primary antibodies served as controls. Data represent means±s.e.m. of five experiments (N.S., not significant; * P <0.05; paired two-tailed Student's t -test). Cells transduced with lentivirus encoding shRNA to knock down SHANK3 were also used as a further control to demonstrate the specificity of the PLA signal in four out of the five experiments (* P <0.05; unpaired two-tailed Student's t -test).

Article Snippet: The mouse monoclonal antibody to Rap1 was from Proteintech (Rosemont, IL, USA; 67174).

Techniques: Clinical Proteomics, Membrane, Proximity Ligation Assay, Staining, Expressing, Confocal Microscopy, Suspension, Flow Cytometry, Two Tailed Test, Transduction, shRNA, Knockdown, Control