rack 1 gfp Search Results


N/A
Full length Clone DNA of Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with C terminal GFPSpark tag.
  Buy from Supplier

92
Addgene inc zebrafish gnb2l1
Non-coding nucleotide features that increase protein expression. ( a ) Schematic of sequence features, showing the position of the inserted intron, PRE element and 3′ UTRs tested. ( b ) Microinjection of plasmid DNA and transposase for testing features of gene structure on protein expression. Protein is extracted at 5 dpf to ensure that expression from integrated transgenes is analyzed. Here the transgene is a nitroreductase-TagRFPT fusion, similar in size to α-tubulin. Expression from embryos where transposase is omitted from the injection mix (left lane) and where transposase is included resulting in expression from the integrated transgene (right lane). ( c ) Reporter expression in transgenic larvae, generated using constructs without (−) and with (+) the indicated intron. Introns from zgc:77112 and ubc were tested in the 5′UTR of the gene encoding Cer in HuC:Cer transgenic larvae ( N = 6 groups each for control and intron-containing versions). The rabbit β-globin intron was tested in the 5′UTR of the gene encoding mCherry in Et(SCP1:Gal4)y271 ; UAS:GCaMP3–2a-mCherry transgenic ( N = 6 groups each). * P < 0.05. ( d ) Cer expression in embryos injected with a mRNA for Cer-STOP-TagRFPT, where the stop codon and next nucleotide are as indicated ( N = 6). * P < 0.05. ( e ) TagRFPT expression in embryos injected with mRNA synthesized from pCS2-based constructs with alternate 3′ UTRs: zebrafish rps26 ( N = 3), zebrafish <t>gnb2l1</t> ( N = 3), p10 ( N = 5), pout afp ( N = 6), rabbit β-globin ( N = 3). Also expression from mRNA derived from the pSP64T vector ( N = 3). In each case expression was normalized to injections using mRNA with the unmodified pCS2 which contains a sv40 3′UTR. The x-axis indicates the number of nucleotides in the 3′UTR from the stop codon to the first AAUAAA polyadenylation motif. * P < 0.05. ( f ) Cer expression in transgenic larvae, generated with constructs using a HuC promoter with the indicated combinations of the ubc intron, the sv40, afp or β-globin 3′UTR and codon-modified Cerulean. N = 5–8 groups per combination. * P < 0.05. ( g ) Plasmid backbones containing elements that promote gene expression in zebrafish. Plasmid pT1UciMP contains tol1 arms (gray), a 14xUAS-E1b promoter and carp β-actin initiator sequence, the ubc intron, a multiple cloning site and the afp 3′UTR. Plasmid pT1QciMP is similar but with a QUAS regulatory element in place of the 14xUAS sequence.
Zebrafish Gnb2l1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rack+1+gfp/pORANGE+Tubb3-GFP+KI+(Plasmid+%23131444)/pmc04402511-47-14-42
Average 92 stars, based on 1 article reviews
zebrafish gnb2l1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Addgene inc rack 1 gfp
Non-coding nucleotide features that increase protein expression. ( a ) Schematic of sequence features, showing the position of the inserted intron, PRE element and 3′ UTRs tested. ( b ) Microinjection of plasmid DNA and transposase for testing features of gene structure on protein expression. Protein is extracted at 5 dpf to ensure that expression from integrated transgenes is analyzed. Here the transgene is a nitroreductase-TagRFPT fusion, similar in size to α-tubulin. Expression from embryos where transposase is omitted from the injection mix (left lane) and where transposase is included resulting in expression from the integrated transgene (right lane). ( c ) Reporter expression in transgenic larvae, generated using constructs without (−) and with (+) the indicated intron. Introns from zgc:77112 and ubc were tested in the 5′UTR of the gene encoding Cer in HuC:Cer transgenic larvae ( N = 6 groups each for control and intron-containing versions). The rabbit β-globin intron was tested in the 5′UTR of the gene encoding mCherry in Et(SCP1:Gal4)y271 ; UAS:GCaMP3–2a-mCherry transgenic ( N = 6 groups each). * P < 0.05. ( d ) Cer expression in embryos injected with a mRNA for Cer-STOP-TagRFPT, where the stop codon and next nucleotide are as indicated ( N = 6). * P < 0.05. ( e ) TagRFPT expression in embryos injected with mRNA synthesized from pCS2-based constructs with alternate 3′ UTRs: zebrafish rps26 ( N = 3), zebrafish <t>gnb2l1</t> ( N = 3), p10 ( N = 5), pout afp ( N = 6), rabbit β-globin ( N = 3). Also expression from mRNA derived from the pSP64T vector ( N = 3). In each case expression was normalized to injections using mRNA with the unmodified pCS2 which contains a sv40 3′UTR. The x-axis indicates the number of nucleotides in the 3′UTR from the stop codon to the first AAUAAA polyadenylation motif. * P < 0.05. ( f ) Cer expression in transgenic larvae, generated with constructs using a HuC promoter with the indicated combinations of the ubc intron, the sv40, afp or β-globin 3′UTR and codon-modified Cerulean. N = 5–8 groups per combination. * P < 0.05. ( g ) Plasmid backbones containing elements that promote gene expression in zebrafish. Plasmid pT1UciMP contains tol1 arms (gray), a 14xUAS-E1b promoter and carp β-actin initiator sequence, the ubc intron, a multiple cloning site and the afp 3′UTR. Plasmid pT1QciMP is similar but with a QUAS regulatory element in place of the 14xUAS sequence.
Rack 1 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rack+1+gfp/pEGFP-N1-RACK1+(Plasmid+%2341088)/pm34623515-27-31-33
Average 93 stars, based on 1 article reviews
rack 1 gfp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

N/A
Standard format: Plasmid sent in bacteria as agar stab
  Buy from Supplier

N/A
Full length Clone DNA of Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1.
  Buy from Supplier

N/A
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 with C terminal GFPSpark tag.
  Buy from Supplier

N/A
Full length Clone DNA of Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with N terminal GFPSpark tag.
  Buy from Supplier

N/A
Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with C terminal GFPSpark tag.
  Buy from Supplier

N/A
Full length Clone DNA of Rattus norvegicus receptor for activated C kinase 1
  Buy from Supplier

Image Search Results


Non-coding nucleotide features that increase protein expression. ( a ) Schematic of sequence features, showing the position of the inserted intron, PRE element and 3′ UTRs tested. ( b ) Microinjection of plasmid DNA and transposase for testing features of gene structure on protein expression. Protein is extracted at 5 dpf to ensure that expression from integrated transgenes is analyzed. Here the transgene is a nitroreductase-TagRFPT fusion, similar in size to α-tubulin. Expression from embryos where transposase is omitted from the injection mix (left lane) and where transposase is included resulting in expression from the integrated transgene (right lane). ( c ) Reporter expression in transgenic larvae, generated using constructs without (−) and with (+) the indicated intron. Introns from zgc:77112 and ubc were tested in the 5′UTR of the gene encoding Cer in HuC:Cer transgenic larvae ( N = 6 groups each for control and intron-containing versions). The rabbit β-globin intron was tested in the 5′UTR of the gene encoding mCherry in Et(SCP1:Gal4)y271 ; UAS:GCaMP3–2a-mCherry transgenic ( N = 6 groups each). * P < 0.05. ( d ) Cer expression in embryos injected with a mRNA for Cer-STOP-TagRFPT, where the stop codon and next nucleotide are as indicated ( N = 6). * P < 0.05. ( e ) TagRFPT expression in embryos injected with mRNA synthesized from pCS2-based constructs with alternate 3′ UTRs: zebrafish rps26 ( N = 3), zebrafish gnb2l1 ( N = 3), p10 ( N = 5), pout afp ( N = 6), rabbit β-globin ( N = 3). Also expression from mRNA derived from the pSP64T vector ( N = 3). In each case expression was normalized to injections using mRNA with the unmodified pCS2 which contains a sv40 3′UTR. The x-axis indicates the number of nucleotides in the 3′UTR from the stop codon to the first AAUAAA polyadenylation motif. * P < 0.05. ( f ) Cer expression in transgenic larvae, generated with constructs using a HuC promoter with the indicated combinations of the ubc intron, the sv40, afp or β-globin 3′UTR and codon-modified Cerulean. N = 5–8 groups per combination. * P < 0.05. ( g ) Plasmid backbones containing elements that promote gene expression in zebrafish. Plasmid pT1UciMP contains tol1 arms (gray), a 14xUAS-E1b promoter and carp β-actin initiator sequence, the ubc intron, a multiple cloning site and the afp 3′UTR. Plasmid pT1QciMP is similar but with a QUAS regulatory element in place of the 14xUAS sequence.

Journal: Nucleic Acids Research

Article Title: Increased functional protein expression using nucleotide sequence features enriched in highly expressed genes in zebrafish

doi: 10.1093/nar/gkv035

Figure Lengend Snippet: Non-coding nucleotide features that increase protein expression. ( a ) Schematic of sequence features, showing the position of the inserted intron, PRE element and 3′ UTRs tested. ( b ) Microinjection of plasmid DNA and transposase for testing features of gene structure on protein expression. Protein is extracted at 5 dpf to ensure that expression from integrated transgenes is analyzed. Here the transgene is a nitroreductase-TagRFPT fusion, similar in size to α-tubulin. Expression from embryos where transposase is omitted from the injection mix (left lane) and where transposase is included resulting in expression from the integrated transgene (right lane). ( c ) Reporter expression in transgenic larvae, generated using constructs without (−) and with (+) the indicated intron. Introns from zgc:77112 and ubc were tested in the 5′UTR of the gene encoding Cer in HuC:Cer transgenic larvae ( N = 6 groups each for control and intron-containing versions). The rabbit β-globin intron was tested in the 5′UTR of the gene encoding mCherry in Et(SCP1:Gal4)y271 ; UAS:GCaMP3–2a-mCherry transgenic ( N = 6 groups each). * P < 0.05. ( d ) Cer expression in embryos injected with a mRNA for Cer-STOP-TagRFPT, where the stop codon and next nucleotide are as indicated ( N = 6). * P < 0.05. ( e ) TagRFPT expression in embryos injected with mRNA synthesized from pCS2-based constructs with alternate 3′ UTRs: zebrafish rps26 ( N = 3), zebrafish gnb2l1 ( N = 3), p10 ( N = 5), pout afp ( N = 6), rabbit β-globin ( N = 3). Also expression from mRNA derived from the pSP64T vector ( N = 3). In each case expression was normalized to injections using mRNA with the unmodified pCS2 which contains a sv40 3′UTR. The x-axis indicates the number of nucleotides in the 3′UTR from the stop codon to the first AAUAAA polyadenylation motif. * P < 0.05. ( f ) Cer expression in transgenic larvae, generated with constructs using a HuC promoter with the indicated combinations of the ubc intron, the sv40, afp or β-globin 3′UTR and codon-modified Cerulean. N = 5–8 groups per combination. * P < 0.05. ( g ) Plasmid backbones containing elements that promote gene expression in zebrafish. Plasmid pT1UciMP contains tol1 arms (gray), a 14xUAS-E1b promoter and carp β-actin initiator sequence, the ubc intron, a multiple cloning site and the afp 3′UTR. Plasmid pT1QciMP is similar but with a QUAS regulatory element in place of the 14xUAS sequence.

Article Snippet: For testing 3′UTRs, the SV40 3′UTR in pCS2+ TagRFPT was replaced with: 3′UTR from zebrafish gnb2l1 (NCBI accession NM_131444; amplified from genomic DNA with primers 5-gccttttctaatgtctgaataaaatcc, 5-ttcccagaagctgttaacttg), 3′UTR from zebrafish rps26 (NM_200025; amplified using primers 5-ctggagccgtttacataattttt, 5-cacaatatactgaaaaacatcccact), the p10 3′UTR from pJFRC28 (Addgene 36431) , the ocean pout antifreeze protein 3′UTR from pT2.2 ( , ) (kind gift of Yusuke Kamachi) and the rabbit β-globin 3′UTR from pCAG-CreERT2 (Addgene 14797)( ). pCS2z was derived from pCS2 TagRFPT- afp -UTR by replacing TagRFPT with a polylinker between the BamHI and XhoI sites (5-gatcccatcgattcgaattcaaggcctctagagccaccatggggtaactcgag).

Techniques: Expressing, Sequencing, Microinjection, Plasmid Preparation, Injection, Transgenic Assay, Generated, Construct, Control, Synthesized, Derivative Assay, Modification, Gene Expression, Cloning