rabbit antibodies against arid1a Search Results


arid1a rabbit mab  (Genecopoeia)
95
Genecopoeia arid1a rabbit mab
Arid1a Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/custom%40mab-00500%4010%2E31351%2Fvol30iss1pp196-203?v=Genecopoeia
Average 95 stars, based on 1 article reviews
arid1a rabbit mab - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier
baf250  (Bethyl)
93
Bethyl baf250
Enhanced <t>BAF250</t> recruitment to IL-10 locus in stimulated Th2 cells in the absence of BAF180 Binding of BRG1, BAF180 and BAF250 was detected by ChIP-PCR at the indicated sites in the IL-10 locus . Signal is expressed as percent of the input chromatin. Control IP levels are less than 0.05% input. Nfm is a locus in the neuron-specific medium neurofilament gene, a binding site for BRG1 in neurons and brain but not in T cells. The results are the average and standard deviation of three ChIP experiments. A) BRG1 binding. B) BAF180 binding. C) BAF250 binding.
Baf250, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pmc03313858-164-45-47?v=Bethyl
Average 93 stars, based on 1 article reviews
baf250 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
mouse anti arid1a  (Santa Cruz Biotechnology)
94
Santa Cruz Biotechnology mouse anti arid1a
a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating <t>ARID1A</t> sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.
Mouse Anti Arid1a, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pmc07341683-613-38-43?v=Santa+Cruz+Biotechnology
Average 94 stars, based on 1 article reviews
mouse anti arid1a - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
rabbit anti arid1a polyclonal atlas antibodies  (Atlas Antibodies)
93
Atlas Antibodies rabbit anti arid1a polyclonal atlas antibodies
a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating <t>ARID1A</t> sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.
Rabbit Anti Arid1a Polyclonal Atlas Antibodies, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pmc07956405__cancers___13___00950___s001-1-46-49?v=Atlas+Antibodies
Average 93 stars, based on 1 article reviews
rabbit anti arid1a polyclonal atlas antibodies - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
arid1a mouse monoclonal  (Novus Biologicals)
93
Novus Biologicals arid1a mouse monoclonal
a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating <t>ARID1A</t> sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.
Arid1a Mouse Monoclonal, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pm40846763-593-86-89?v=Novus+Biologicals
Average 93 stars, based on 1 article reviews
arid1a mouse monoclonal - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
pcdna6  (Addgene inc)
93
Addgene inc pcdna6
a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating <t>ARID1A</t> sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.
Pcdna6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/10__1038_slash_npre__2010__4554__1-232-25-13?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pcdna6 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
anti arid1a  (Bethyl)
93
Bethyl anti arid1a
a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating <t>ARID1A</t> sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.
Anti Arid1a, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pm39892702-357-13-27?v=Bethyl
Average 93 stars, based on 1 article reviews
anti arid1a - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
arid1a  (Novus Biologicals)
93
Novus Biologicals arid1a
The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets <t>Arid1a</t> and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.
Arid1a, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pmc06687095-128-35-36?v=Novus+Biologicals
Average 93 stars, based on 1 article reviews
arid1a - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
anti ta349170  (OriGene)
93
OriGene anti ta349170
The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets <t>Arid1a</t> and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.
Anti Ta349170, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/us12473334-560-23-28?v=OriGene
Average 93 stars, based on 1 article reviews
anti ta349170 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology
The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets <t>Arid1a</t> and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.
Arid1a Gcccugaacaauaaccuca Ugagguuauuguucagggc Brm Guccuggaccuccaagugucu Agacacuuggagguccaggac Brg1 Santa Cruz Biotechnology, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/pmc11166463__joces___137___261744___s1-35-44-51?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
arid1a gcccugaacaauaaccuca ugagguuauuguucagggc brm guccuggaccuccaagugucu agacacuuggagguccaggac brg1 santa cruz biotechnology - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
gene exp glul mm00725701 s1  (Thermo Fisher)
91
Thermo Fisher gene exp glul mm00725701 s1
The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets <t>Arid1a</t> and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.
Gene Exp Glul Mm00725701 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+antibodies+against+arid1a/10__7554_slash_elife__53550-302-148-143?v=Thermo+Fisher
Average 91 stars, based on 1 article reviews
gene exp glul mm00725701 s1 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

Image Search Results


Enhanced BAF250 recruitment to IL-10 locus in stimulated Th2 cells in the absence of BAF180 Binding of BRG1, BAF180 and BAF250 was detected by ChIP-PCR at the indicated sites in the IL-10 locus . Signal is expressed as percent of the input chromatin. Control IP levels are less than 0.05% input. Nfm is a locus in the neuron-specific medium neurofilament gene, a binding site for BRG1 in neurons and brain but not in T cells. The results are the average and standard deviation of three ChIP experiments. A) BRG1 binding. B) BAF180 binding. C) BAF250 binding.

Journal: BMC Immunology

Article Title: IL-10 transcription is negatively regulated by BAF180, a component of the SWI/SNF chromatin remodeling enzyme

doi: 10.1186/1471-2172-13-9

Figure Lengend Snippet: Enhanced BAF250 recruitment to IL-10 locus in stimulated Th2 cells in the absence of BAF180 Binding of BRG1, BAF180 and BAF250 was detected by ChIP-PCR at the indicated sites in the IL-10 locus . Signal is expressed as percent of the input chromatin. Control IP levels are less than 0.05% input. Nfm is a locus in the neuron-specific medium neurofilament gene, a binding site for BRG1 in neurons and brain but not in T cells. The results are the average and standard deviation of three ChIP experiments. A) BRG1 binding. B) BAF180 binding. C) BAF250 binding.

Article Snippet: Sonicates were precleared with protein A Sepharose (Upstate) and IP was performed with the following antibodies: 1 ug H3K9Ac (Abcam ab4441), 0.5 ul BRG1 (J1, Weidong Wang), 1 ug H3K18Ac (Abcam ab1191), 1 ug H3K4Me (Abcam ab8895), 2 ug BAF180 (A301-591A Bethyl Laboratories), 2 ug BAF250 (A301-041A Bethyl Laboratories), 1 ug CBP (Assay Biotech Ab-1535) or rabbit IgG (Santa Cruz sc-2027).

Techniques: Binding Assay, Control, Standard Deviation

a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating ARID1A sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.

Journal: Nature genetics

Article Title: ARID1A determines luminal identity and therapeutic response in estrogen-receptor-positive breast cancer

doi: 10.1038/s41588-019-0554-0

Figure Lengend Snippet: a, Gene-level enrichment analysis of mutations in genes that are significantly more common in metastases compared to primary tumors (q<0.05) in ER+/HER2− breast cancer (MSK primary = 739; TCGA primary = 579; MSK metastatic = 762). b, Workflow of the epigenome-wide CRISPR-CAS9 screen on treatment with fulvestrant. MOI, multiplicity of infection. NGS, next-generation sequencing. c, Sequencing data analysis demonstrating ARID1A sgRNAs (10 out of 12 sgRNAs targeting ARID1A) to mediate fulvestrant resistance. d, Cropped western blot with the indicated antibodies in MCF7 cells expressing sgNT as controls and distinct sgRNAs targeting ARID1A. e, In vitro proliferation assay of MCF7 cells expressing sgNT-1 and sgNT-2 as controls and four sgRNAs against ARID1A on DMSO or fulvestrant treatment (n = 3 independent experiments). f, In vivo xenografts of MCF7 ARID1A KO and control cells treated with vehicle or fulvestrant (3 mg per mouse per week) for 13 weeks. Error bars, s.e.m., n = 5 per group, center values represent the means. P values were calculated using a two-sided Mann-Whitney U-test. g, Cropped western blot with the indicated antibodies of MDA-MB-415 cells expressing sgNT-GFP, sgCOPGFP-GFP, sgARID1A-1-RFP and sgARID1A-2-RFP. h, Ratio of RFP+ ARID1A KO cells (sgARID1A-1 or sgARID1A-2) to GFP+ control cells (sgNT-GFP or sgCOPGFP-GFP) on DMSO or fulvestrant administration (100 nM) for 14d as measured by flow cytometry. P values are shown. A two-sided Student’st-test was used. The error bars indicate the mean±s.e.m.; n = 3 biologically independent samples; the center values are the means. i, Kaplan-Meier curves displaying the progression-free survival of patients receiving SERD therapy based on ARID1A alterations from the MSK-IMPACT cohort. Pvalue as indicated. A log-rank test was used.

Article Snippet: The primary antibodies used in this study were rabbit anti-vinculin (catalog no. 13901; Cell Signaling Technology); rabbit anti-β-actin (catalog no. 4970; Cell Signaling Technology); rabbit anti-AR (catalog no. SC-816; Santa Cruz Biotechnology); rabbit anti-BRG1 (catalog no. ab110641; Abcam); mouse anti-ARID1A (catalog no. SC-32761; Santa Cruz Biotechnology); rabbit anti-p63-α (catalog no. 13109; Cell Signaling Technology); rabbit anti-CD49F/integrin α6 (catalog no. 3750; Cell Signaling Technology); rabbit anti-GATA3 (catalog no. ab199428; Abcam); mouse anti- Ini1/SMARCB1 (catalog no. SC-166165; Santa Cruz Biotechnology); rabbit anti-SMARCE1/BAF57 (catalog no. 33360; Cell Signaling Technology); rabbit anti-ERα (catalog no. SC-543; Santa Cruz Biotechnology); and mouse anti-TEAD4 (catalog no. ab58310; Abcam).

Techniques: CRISPR, Infection, Next-Generation Sequencing, Sequencing, Western Blot, Expressing, In Vitro, Proliferation Assay, In Vivo, MANN-WHITNEY, Flow Cytometry

a, Heatmap displaying significantly differential gene expression as obtained by RNA-seq performed in two control (sgNT, sgCOPGFP) and three sgRNAs against ARID1A (sgARID1A-1, sgARID1A-2, sgARID1A-3) MCF7 cells (1,230 downregulated, 2,585 upregulated genes; absolute log2 fold change>0.5, Benjamini-Hochberg-adjusted P<0.01). b, ECDF plot of the log2 fold change of nearest gene expression (ARID1A KO versus control cells) in sites that have increased or decreased chromatin accessibility. P values are as shown. A two-sided Mann-Whitney U-test and effect size (Rosenthal’s coefficient) are also shown. Also shown is the difference in mean log2 fold change between two distributions (n = 9). c, GSEA in MCF7 after ARID1A KO (log2 fold change calculated using n = 9; nominal P values and FDR-adjusted P values were calculated using the GSEA package). NES, normalized enrichment score. d, Fold change (ARID1A KO versus control) of luminal and basal-like/stemness markers in MCF7 as obtained by RNA-seq (absolute log2 fold change> 0.5, Benjamini-Hochberg-adjusted P< 0.01). e, Cropped western blot with indicated antibodies of MDA-MB-415 cells expressing sgNT and two distinct sgRNAs against ARID1A. f, Enrichment of basal-like signatures in MDA-MB-415 on ARID1A KO; log2 fold change calculated using n = 6, nominal P values and FDR-adjusted P values were calculated using the GSEA package. g, Enrichment of basal signatures in patient samples with biallelic ARID1A loss versus patient samples WT for ARID1A; log2 fold change calculated using n = 12, nominal P values and FDR-adjusted P values were calculated using the GSEA package v.2.2.1.

Journal: Nature genetics

Article Title: ARID1A determines luminal identity and therapeutic response in estrogen-receptor-positive breast cancer

doi: 10.1038/s41588-019-0554-0

Figure Lengend Snippet: a, Heatmap displaying significantly differential gene expression as obtained by RNA-seq performed in two control (sgNT, sgCOPGFP) and three sgRNAs against ARID1A (sgARID1A-1, sgARID1A-2, sgARID1A-3) MCF7 cells (1,230 downregulated, 2,585 upregulated genes; absolute log2 fold change>0.5, Benjamini-Hochberg-adjusted P<0.01). b, ECDF plot of the log2 fold change of nearest gene expression (ARID1A KO versus control cells) in sites that have increased or decreased chromatin accessibility. P values are as shown. A two-sided Mann-Whitney U-test and effect size (Rosenthal’s coefficient) are also shown. Also shown is the difference in mean log2 fold change between two distributions (n = 9). c, GSEA in MCF7 after ARID1A KO (log2 fold change calculated using n = 9; nominal P values and FDR-adjusted P values were calculated using the GSEA package). NES, normalized enrichment score. d, Fold change (ARID1A KO versus control) of luminal and basal-like/stemness markers in MCF7 as obtained by RNA-seq (absolute log2 fold change> 0.5, Benjamini-Hochberg-adjusted P< 0.01). e, Cropped western blot with indicated antibodies of MDA-MB-415 cells expressing sgNT and two distinct sgRNAs against ARID1A. f, Enrichment of basal-like signatures in MDA-MB-415 on ARID1A KO; log2 fold change calculated using n = 6, nominal P values and FDR-adjusted P values were calculated using the GSEA package. g, Enrichment of basal signatures in patient samples with biallelic ARID1A loss versus patient samples WT for ARID1A; log2 fold change calculated using n = 12, nominal P values and FDR-adjusted P values were calculated using the GSEA package v.2.2.1.

Article Snippet: The primary antibodies used in this study were rabbit anti-vinculin (catalog no. 13901; Cell Signaling Technology); rabbit anti-β-actin (catalog no. 4970; Cell Signaling Technology); rabbit anti-AR (catalog no. SC-816; Santa Cruz Biotechnology); rabbit anti-BRG1 (catalog no. ab110641; Abcam); mouse anti-ARID1A (catalog no. SC-32761; Santa Cruz Biotechnology); rabbit anti-p63-α (catalog no. 13109; Cell Signaling Technology); rabbit anti-CD49F/integrin α6 (catalog no. 3750; Cell Signaling Technology); rabbit anti-GATA3 (catalog no. ab199428; Abcam); mouse anti- Ini1/SMARCB1 (catalog no. SC-166165; Santa Cruz Biotechnology); rabbit anti-SMARCE1/BAF57 (catalog no. 33360; Cell Signaling Technology); rabbit anti-ERα (catalog no. SC-543; Santa Cruz Biotechnology); and mouse anti-TEAD4 (catalog no. ab58310; Abcam).

Techniques: Expressing, RNA Sequencing Assay, MANN-WHITNEY, Western Blot

a, Volcano plot of ATAC-seq assays in control and ARID1A KO cells. The x axis shows the log2 fold change and the y axis shows the −log10(P). The red dots represent a significant increase in chromatin accessibility (1,701 sites) whereas the green dots represent a significant decrease in chromatin accessibility (3,537 sites) (absolute log2 fold change >0.5 and Benjamini-Hochberg-adjusted P<0.05). b, Heatmap of significantly differentially accessible sites in MCF7 cells expressing three distinct sgRNAs against ARID1A and two control sgRNAs (4,608 differential peaks; log2 fold change > 0.5 and Benjamini-Hochberg-adjusted P< 0.05). c, Pie chart showing the distributions of differential peaks to various genic parts. d, Heatmap of H3K27ac ChlP-seq in the differentially accessible sites obtained by ATAC-seq on ARID1A loss (±2-kb regions centered at the peak summit). PSS, peak start site; PES, peak end site. e, Box plot showing the mean signal across peaks that lost chromatin accessibility on ARID1A KO. Also shown is the H3K27ac ChlP-seq differential binding in control and ARID1A KO cells. P values are as shown. A two-sided Mann-Whitney U-test and effect size (Rosenthal’s coefficient) are also shown. The log2 fold change calculated as log2 (mean KO/mean control) is also shown (n = 15). The box shows the 25th, median and 75th percentiles with the whiskers extending to ±1.5× interquartile range (IQR). f, Top significant transcription factor motifs enriched in the lost or gained accessible sites on ARID1A KO as analyzed by a ridge regression model (FDR< 0.01). The x axis represents the ridge regression coefficients.

Journal: Nature genetics

Article Title: ARID1A determines luminal identity and therapeutic response in estrogen-receptor-positive breast cancer

doi: 10.1038/s41588-019-0554-0

Figure Lengend Snippet: a, Volcano plot of ATAC-seq assays in control and ARID1A KO cells. The x axis shows the log2 fold change and the y axis shows the −log10(P). The red dots represent a significant increase in chromatin accessibility (1,701 sites) whereas the green dots represent a significant decrease in chromatin accessibility (3,537 sites) (absolute log2 fold change >0.5 and Benjamini-Hochberg-adjusted P<0.05). b, Heatmap of significantly differentially accessible sites in MCF7 cells expressing three distinct sgRNAs against ARID1A and two control sgRNAs (4,608 differential peaks; log2 fold change > 0.5 and Benjamini-Hochberg-adjusted P< 0.05). c, Pie chart showing the distributions of differential peaks to various genic parts. d, Heatmap of H3K27ac ChlP-seq in the differentially accessible sites obtained by ATAC-seq on ARID1A loss (±2-kb regions centered at the peak summit). PSS, peak start site; PES, peak end site. e, Box plot showing the mean signal across peaks that lost chromatin accessibility on ARID1A KO. Also shown is the H3K27ac ChlP-seq differential binding in control and ARID1A KO cells. P values are as shown. A two-sided Mann-Whitney U-test and effect size (Rosenthal’s coefficient) are also shown. The log2 fold change calculated as log2 (mean KO/mean control) is also shown (n = 15). The box shows the 25th, median and 75th percentiles with the whiskers extending to ±1.5× interquartile range (IQR). f, Top significant transcription factor motifs enriched in the lost or gained accessible sites on ARID1A KO as analyzed by a ridge regression model (FDR< 0.01). The x axis represents the ridge regression coefficients.

Article Snippet: The primary antibodies used in this study were rabbit anti-vinculin (catalog no. 13901; Cell Signaling Technology); rabbit anti-β-actin (catalog no. 4970; Cell Signaling Technology); rabbit anti-AR (catalog no. SC-816; Santa Cruz Biotechnology); rabbit anti-BRG1 (catalog no. ab110641; Abcam); mouse anti-ARID1A (catalog no. SC-32761; Santa Cruz Biotechnology); rabbit anti-p63-α (catalog no. 13109; Cell Signaling Technology); rabbit anti-CD49F/integrin α6 (catalog no. 3750; Cell Signaling Technology); rabbit anti-GATA3 (catalog no. ab199428; Abcam); mouse anti- Ini1/SMARCB1 (catalog no. SC-166165; Santa Cruz Biotechnology); rabbit anti-SMARCE1/BAF57 (catalog no. 33360; Cell Signaling Technology); rabbit anti-ERα (catalog no. SC-543; Santa Cruz Biotechnology); and mouse anti-TEAD4 (catalog no. ab58310; Abcam).

Techniques: Expressing, Binding Assay, MANN-WHITNEY

Model depicting lineage plasticity and endocrine therapy resistance in ER+ breast cancer due to loss of ARID1A compared to ER+ breast cancer with WT ARID1A.

Journal: Nature genetics

Article Title: ARID1A determines luminal identity and therapeutic response in estrogen-receptor-positive breast cancer

doi: 10.1038/s41588-019-0554-0

Figure Lengend Snippet: Model depicting lineage plasticity and endocrine therapy resistance in ER+ breast cancer due to loss of ARID1A compared to ER+ breast cancer with WT ARID1A.

Article Snippet: The primary antibodies used in this study were rabbit anti-vinculin (catalog no. 13901; Cell Signaling Technology); rabbit anti-β-actin (catalog no. 4970; Cell Signaling Technology); rabbit anti-AR (catalog no. SC-816; Santa Cruz Biotechnology); rabbit anti-BRG1 (catalog no. ab110641; Abcam); mouse anti-ARID1A (catalog no. SC-32761; Santa Cruz Biotechnology); rabbit anti-p63-α (catalog no. 13109; Cell Signaling Technology); rabbit anti-CD49F/integrin α6 (catalog no. 3750; Cell Signaling Technology); rabbit anti-GATA3 (catalog no. ab199428; Abcam); mouse anti- Ini1/SMARCB1 (catalog no. SC-166165; Santa Cruz Biotechnology); rabbit anti-SMARCE1/BAF57 (catalog no. 33360; Cell Signaling Technology); rabbit anti-ERα (catalog no. SC-543; Santa Cruz Biotechnology); and mouse anti-TEAD4 (catalog no. ab58310; Abcam).

Techniques:

The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets Arid1a and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.

Journal: PLoS Pathogens

Article Title: Identification of murine gammaherpesvirus 68 miRNA-mRNA hybrids reveals miRNA target conservation among gammaherpesviruses including host translation and protein modification machinery

doi: 10.1371/journal.ppat.1007843

Figure Lengend Snippet: The relative expression of endogenous mRNAs in non-infected versus infected B cells sorted from in vivo samples during chronic infection. Wild-type B6 mice were infected i.n. with 10 4 PFU of MHV68-H2bYFP. At 16 days, splenocytes were harvested and subjected to flow cytometric sorting to isolate both non-infected B cells (CD4-CD8-CD14-CD19+YFP-) and infected B cells (CD4-CD8-CD14-CD19+YFP+). Following sorting, the transcript level of MHV68 miRNA targets Arid1a and Ctsl were determined in each sample using qRT-PCR. Values represent the mean ± SEM of three independent experiments. Significance was determined by a two-tailed, unpaired t-test. ***p< 0.001.

Article Snippet: Approximately 10 μg of total protein was then separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE 10% gel), transferred to a nitrocellulose membrane and probed with antibodies directed to β-actin (Cell Signaling, 8H10D10), ARID1A (Novus Biologicals, NB100-55334), CTSL (R&D Systems, AF1515), EWSR1 (Abcam, EPR4647), IFITM3 antibody (R&D Systems, AF3377), or FOXJ3 antibody (R&D Systems, AF5786).

Techniques: Expressing, Infection, In Vivo, Quantitative RT-PCR, Two Tailed Test