r 2020b Search Results


86
Medicago brouquisse r 2020b medicago truncatula 7 phytoglobin 1 1 controls symbiotic nodulation
Brouquisse R 2020b Medicago Truncatula 7 Phytoglobin 1 1 Controls Symbiotic Nodulation, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/r+2020b/pm42302289-322-14-17?v=Medicago
Average 86 stars, based on 1 article reviews
brouquisse r 2020b medicago truncatula 7 phytoglobin 1 1 controls symbiotic nodulation - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Beijing TransGen Biotech 2×easy taq pcr supermix
2×Easy Taq Pcr Supermix, supplied by Beijing TransGen Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/r+2020b/10__5943_slash_sif_slash_6_slash_1_slash_5-63-28-41?v=Beijing+TransGen+Biotech
Average 90 stars, based on 1 article reviews
2×easy taq pcr supermix - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Kleimann Communication Group thymatron r© system iv
Thymatron R© System Iv, supplied by Kleimann Communication Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/r+2020b/pm36968786-71-17-21?v=Kleimann+Communication+Group
Average 90 stars, based on 1 article reviews
thymatron r© system iv - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

91
European Directorate for the Quality of Medicines and HealthCare moxidectin
Moxidectin, supplied by European Directorate for the Quality of Medicines and HealthCare, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/r+2020b/pm31756443-109-7-10?v=European+Directorate+for+the+Quality+of+Medicines+and+HealthCare
Average 91 stars, based on 1 article reviews
moxidectin - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier


N/A
The ABO, Blood Group A Antigen Antibody (VA4-20B) [Alexa Fluor® 488] from Novus is a ABO, Blood Group A Antigen antibody to ABO, Blood Group A Antigen. This antibody reacts with Human. The ABO, Blood
  Buy from Supplier

N/A
The BORIS Antibody (20B11) [Alexa Fluor® 405] from Novus is a BORIS antibody to BORIS. This antibody reacts with Human. The BORIS antibody has been validated for the following applications: Western Blot, ELISA, Immunohistochemistry, Immunocytochemistry/
  Buy from Supplier

N/A
MicroRNA: hsa-miR-20b-3p Accession Number: MIMAT0004752 Mature Sequence: ACUGUAGUAUGGGCACUUCCAG hsa-miR-20b-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

N/A
SNCG antibody was raised in Mouse using a purified recombinant fragment of SNCG expressed in E. coli as the immunogen. Mouse monoclonal SNCG antibody.
  Buy from Supplier

N/A
Rabbit polyclonal TADA3 antibody (FITC)
  Buy from Supplier

N/A
Recombinant human HDDC3 protein (His tag)
  Buy from Supplier


Image Search Results