86
|
Medicago
brouquisse r 2020b medicago truncatula 7 phytoglobin 1 1 controls symbiotic nodulation Brouquisse R 2020b Medicago Truncatula 7 Phytoglobin 1 1 Controls Symbiotic Nodulation, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/r+2020b/pm42302289-322-14-17?v=Medicago Average 86 stars, based on 1 article reviews
brouquisse r 2020b medicago truncatula 7 phytoglobin 1 1 controls symbiotic nodulation - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
90
|
Beijing TransGen Biotech
2×easy taq pcr supermix 2×Easy Taq Pcr Supermix, supplied by Beijing TransGen Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/r+2020b/10__5943_slash_sif_slash_6_slash_1_slash_5-63-28-41?v=Beijing+TransGen+Biotech Average 90 stars, based on 1 article reviews
2×easy taq pcr supermix - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Kleimann Communication Group
thymatron r© system iv Thymatron R© System Iv, supplied by Kleimann Communication Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/r+2020b/pm36968786-71-17-21?v=Kleimann+Communication+Group Average 90 stars, based on 1 article reviews
thymatron r© system iv - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
91
|
European Directorate for the Quality of Medicines and HealthCare
moxidectin Moxidectin, supplied by European Directorate for the Quality of Medicines and HealthCare, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/r+2020b/pm31756443-109-7-10?v=European+Directorate+for+the+Quality+of+Medicines+and+HealthCare Average 91 stars, based on 1 article reviews
moxidectin - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
N/A
|
Moxidectin for system suitability CRS
|
Buy from Supplier |
N/A
|
The ABO, Blood Group A Antigen Antibody (VA4-20B) [Alexa Fluor® 488] from Novus is a ABO, Blood Group A Antigen antibody to ABO, Blood Group A Antigen. This antibody reacts with Human. The ABO, Blood
|
Buy from Supplier |
N/A
|
The BORIS Antibody (20B11) [Alexa Fluor® 405] from Novus is a BORIS antibody to BORIS. This antibody reacts with Human. The BORIS antibody has been validated for the following applications: Western Blot, ELISA, Immunohistochemistry, Immunocytochemistry/
|
Buy from Supplier |
N/A
|
MicroRNA: hsa-miR-20b-3p Accession Number: MIMAT0004752 Mature Sequence: ACUGUAGUAUGGGCACUUCCAG hsa-miR-20b-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
SNCG antibody was raised in Mouse using a purified recombinant fragment of SNCG expressed in E. coli as the immunogen. Mouse monoclonal SNCG antibody.
|
Buy from Supplier |