Journal: Oncotarget

Article Title: Crizotinib inhibits NF2-associated schwannoma through inhibition of focal adhesion kinase 1

doi: 10.18632/oncotarget.10248

Figure Lengend Snippet: ( A ) Western blot analysis of total FAK1 and p-FAKY 397 in protein extracts prepared from SC4 and HEI193 cells treated with crizotinib (10 μM for 10′ and 30′). Vinculin was used as a loading control. ( B ) Cell number counts of SC4 cells and western blot analysis of total FAK1 expression in cells treated with 2 independent shRNAs against FAK1 (shFAK-a, shFAK-b) or scrambled control (shCTRL). ( C ) Cell number counts of HEI193 cells and western blot analysis of total FAK1 expression in cells treated with 2 independent shRNAs against FAK1 (siFAK-a, siFAK-b) or scrambled control (siCTRL). ( D ) SC4 or HEI193 cells treated with defactinib at the indicated doses or with DMSO control, daily for 3 days. In all counting experiments cell numbers were scored daily and each time point was done in triplicate. The data shown represent the mean of 3 independent experiments. Error bars = SD.

Article Snippet: Specifically HEI193 cells were transfected with siRNA duplexes targeting FAK1 [ID# SR303877A- GCAAUGGAGCCGAGUAUUA AAGGUCT and SR303877B- AGAAGAUACUUACA CCAUGCCCUCA] as well as a non-targeting siRNA control [ID # SR30004- CGUUAAUCGCGUAUAAUACG CGUAT] (Origene, Rockville, USA) at a concentration of 30 nM.

Techniques: Western Blot, Expressing

Journal: Oncotarget

Article Title: Crizotinib inhibits NF2-associated schwannoma through inhibition of focal adhesion kinase 1

doi: 10.18632/oncotarget.10248

Figure Lengend Snippet: ( A ) Superimposition of the FAK1 (orange) and ALK (gray) kinase domains with crizotinib (ball and stick). Residues Glycine 509 (G509) and Serine 563 (S563) are highlighted (ball and stick). ( B ) Western blot analysis of the different FAK1 mutant expression in stably transfected SC4 cells. Vinculin was used as a loading control ( C ) 10-point dose response curves assessing EC50 of crizotinib in SC4 cells stably expressing crizotinib resistant FAK1 mutants. Calculated EC50 for each clone is indicated to the right. The data shown represents the mean of 3 independent experiments, each done in quadruplicate. Error bars = SD.

Article Snippet: Specifically HEI193 cells were transfected with siRNA duplexes targeting FAK1 [ID# SR303877A- GCAAUGGAGCCGAGUAUUA AAGGUCT and SR303877B- AGAAGAUACUUACA CCAUGCCCUCA] as well as a non-targeting siRNA control [ID # SR30004- CGUUAAUCGCGUAUAAUACG CGUAT] (Origene, Rockville, USA) at a concentration of 30 nM.

Techniques: Western Blot, Mutagenesis, Expressing, Stable Transfection, Transfection

Journal: iScience

Article Title: Preadipocyte-induced upregulation of IGFBP5 enhances ovarian cancer tumorigenesis via CREB signaling

doi: 10.1016/j.isci.2025.113034

Figure Lengend Snippet: Overexpression of IGFBP5 enables survival during cellular stress (A) Immunoblot demonstrating ectopic expression of IGFBP5 in SKOV3 transfected with pcDNA3-IGFBP5-V5 compared to parental cells (left) and ELISA quantification of IGFBP5 in supernatants, unpaired t test (right, n = 3). (B) Cell viability via CellTiter-GLO in SKOV3 and SKOV3 overexpressing IGFBP5 (SKOV3-BP5) in complete media or serum free media after 3 and 6 days, two-way ANOVA with Sidak’s multiple comparisons ( n = 3). (C) Cell viability via CellTiter-GLO in wild-type (WT) vs. IGFBP5-knockdown (BP5-KD) in ACI-23 after 3 and 7 days of growth in complete media, two-way ANOVA with Sidak’s multiple comparisons ( n = 3). (D) Colony formation assay using SKOV3 and SKOV3-BP5 cells stained with crystal violet after 7 days of growth in complete media, unpaired t test ( n = 4). Scale bars are 5 mm. (E) Representative images of SKOV3 and SKOV3-BP5 grown in SFM, 24 and 48 h after plating. Scale bars are 100 μm. (F) Adhesion assay showing a time course (24, 48, and 72 hr) for attachment to TC treated plastic in complete media (10% FBS) or serum free media (SFM). Adherent cells are stained with Hoechst (nuclei, blue) and phalloidin (cytoskeleton, red). SKOV3-BP5 grown in either medium is relativized to separate media controls, two-way ANOVA with Sidak’s multiple comparisons ( n = 3). Scale bars are 40 μm. (G) Proliferation assay after 72 h via EdU incorporation (pink) in complete media. Scale bars are 40 μm (10% FBS) or serum free media (SFM). All groups are relativized to SKOV3-10% FBS, two-way ANOVA with Sidak’s multiple comparisons, ( n = 3). (H) qRT-PCR for mRNA expression of IGFBP and metastasis-associated genes CDH1 (E-cadherin), CDH2 (N-cadherin), VIM (vimentin), and PTK2 (focal adhesion kinase/FAK), multiple t tests ( n = 3). Data are represented as individual replicates with mean ± SD. ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05.

Article Snippet: RNA generally comprising of 200–1000 ng was converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). qRT-PCR was performed using TaqMan Assays (ThermoFisher) for IGFBP5 (Hs00181213_m1), SOX2 (Hs01053049_s1), OCT4 (Hs04260367_gH), NANOG (Hs02387400_g1), CDH1 (Hs01023895_m1), CDH2 (Hs00983056_m1), VIM (Hs00185584_m1), and PTK2 (Hs01056457_m1), and GAPDH (402869) using TaqMan Fast Advanced Master Mix.

Techniques: Over Expression, Western Blot, Expressing, Transfection, Enzyme-linked Immunosorbent Assay, Knockdown, Colony Assay, Staining, Cell Adhesion Assay, Proliferation Assay, Quantitative RT-PCR