Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 4. SM-induced hCSF ferroptosis activates p38 MAPK signaling. The hCSF exposed to mustard gas were accessed using qRT-PCR for p38 MAPK signaling. A significant increase in p38 MAPK mRNA transcription (A) was detected at eight hours (P < 0.01) and 24 hours (P < 0.001). MAP2Ks (B) that phosphorylate p38 MAPK increased at eight hours (P < 0.001) and 24 hours (P < 0.001). CHOP (C) a target of p38 MAPK increased at eight hours (P < 0.01) and 24 hours (P < 0.0001). An increase in caspase 9 (D) was detected at eight hours (P < 0.0001) and 24 hours (P < 0.0001) with a corresponding increase in caspase 3 (E) at 30 minutes (P < 0.05), eight hours (P < 0.001), and 24 hours (P < 0.0001). Finally, p53 (F) increased at 30 minutes (P < 0.001) and 24 hours (P < 0.0001). Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05; ** P < 0.05; *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Quantitative RT-PCR, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 6. Inhibiting p38 MAPK prevented mustard gas induced hCSF ferroptosis. The hCSF were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas. (A) Representative Western blot images. SB202190 significantly inhibited p38 MAPK phosphorylation (B) at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The inhibi- tion of pp38 MAPK in hCSF significantly promoted cell viability (C) after mustard gas exposure at eight hours (P < 0.01) and 24 hours (P < 0.01). The addition of (+) shows treatment added to culture media. Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. (Blue Bars = addition of SB202190 and Red = without SB202190.) (** P < 0.05; *** P < 0.001; **** P < 0.0001)

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activity Assay, Western Blot, Phospho-proteomics, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 5. The p38 MAPK activation correlates with mustard gas induced ferroptosis. hCSFs exposed to mustard gas were subjected to live/dead assay for cell death and to western blotting to test phos- phorylated p38 MAPK to p38 MAPK ratio (pp38/p38). Cell death (A) significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). Panel B shows represen- tative Western blot images. The pp38/p38 MAPK ratio significantly increased at 30 minutes (P < 0.001), eight hours (P < 0.0001), and 24 hours (P < 0.0001). The p38 MAPK activation had a direct time- dependent increase with ferroptosis in hCSF. Data shown is from six primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. *** P < 0.001; **** P < 0.0001

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Activation Assay, Live Dead Assay, Western Blot, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Mustard Gas Induced Corneal Injury Involves Ferroptosis and p38 MAPK Signaling.

doi: 10.1167/iovs.66.1.23

Figure Lengend Snippet: FIGURE 7. Inhibition of p38 MAPK in hCSF significantly reduced mustard gas–induced ROS production. The hCSFs were pretreated with or without SB202190 to inhibit p38 MAPK activity then exposed to mustard gas for 24 hours. The inhibition of pp38 MAPK in hCSF significantly reduced ROS production after mustard gas exposure (P < 0.05). Data shown is from three primary cultures per group with samples tested in triplicates. Error bars depict standard deviation. * P < 0.05

Article Snippet: 5 p53 NM_001276761 AGGTTGGCTCTGACTGTA GTGTGATGATGGTGAGGATG 6 MAP2Ks NM_030662.4 GAAAGAGGCCAAGAGGATTC AAGCACCAGATCATGCAC 7 CHOP NM_001195054.1 ACTCTTGACCCTGCTTCT TCTGACTGGAATCTGGAGAG 8 p38 XM_002717471.3 CACGATCCTGATGATGAACC CCCTGCTTTCAAAGGACT 9 CAS3 NM_004346 CCACAGCACCTGGTTATT AAGCTTGTCGGCATACTG 10 CAS9 NM_001229 CGAACTAACAGGCAAGCA GTCTGAGAACCTCTGGTTTG Downloaded from iovs.arvojournals.org on 01/12/2025 quantified using Bradford assay (Cat no. 500006; Bio Rad Labs, Hercules, CA, USA) following reported methods.13 Western blotting was performed using antibodies specific for ɑSMA (Cat no. M0851; DAKO-Agilent, Santa Clara, CA, USA), p38 MAPK (Cat no. Sc-271120; Santa Cruz Biotechnology), and pp38 MAPK (Cat no. Sc-7973; Santa Cruz Biotechnology) as published previously.14 In brief, primary and secondary antibodies were used at 1:100 and 1:500 dilutions, respectively.

Techniques: Inhibition, Activity Assay, Standard Deviation

Journal: Oncotarget

Article Title: The immunomodulatory effects of TNF-α inhibitors on human Th17 cells via RORγt histone acetylation

doi: 10.18632/oncotarget.13791

Figure Lengend Snippet: ( A ) Human Th17-polarized cells were induced from purified CD4 + T cells from healthy subjects. Pretreatment with SB203580 (a p38 inhibitor, 10 −6 –10 −5 M), SP600125 (a JNK inhibitor, 10 -5 M) or PD98059 (an ERK inhibitor, 10 −5 M) significantly suppressed IL-17A expression in Th17-polarized cells. ( B ) SB203580 (10 -6 M) and SP600125 (10 −5 M) significantly suppressed IL-17F expression in human Th17-polarized cells. ( C ) Pretreatment with SB203580 (10 −5 M), SP600125 (10 −6 –10 −5 M) and PD98059 (10 −6 –10 −5 M) could significantly suppress IL-22 expression in Th17-polarized cells. # P < 0.05 for the comparison of Th17-polarized conditions with and without MAPK inhibitor pretreatment. ( D ) Etanercept (0.1 and 1 μg/ml) and ( E ) adalimumab (1 and 10 μg/ml) decreased pp38 levels in human Th17-polarized cells. ( F ) Etanercept (0.1 and 1 μg/ml) but not ( G ) adalimumab decreased pERK levels in human Th17-polarized cells. For western blot analysis, the standard deviations of the optical density data were calculated for three independent experiments, and one experiment representative of the set of three is shown. * P < 0.05 for the comparison of Th17-polarized conditions with and without etanercept or adalimumab pretreatment.

Article Snippet: After centrifugation at 13,000 × g for 15 min, cell lysates were analysed by western blot with anti-MAPK (p38 and ERK), anti-phospho-MAPK (pp38 and pERK), anti-p65, anti-phospho-p65, anti-STAT3, anti-phospho-STAT3, and anti-RORγt antibodies (Santa Cruz Biotechnology, Santa Cruz, California, USA).

Techniques: Purification, Expressing, Comparison, Western Blot

Journal: Journal of Neuroimmune Pharmacology

Article Title: Minocycline Abrogates Individual Differences in Nerve Injury-Evoked Affective Disturbances in Male Rats and Prevents Associated Supraspinal Neuroinflammation

doi: 10.1007/s11481-024-10132-y

Figure Lengend Snippet: Mean immunofluorescent intensity results for glial markers. ( A ) CD206 expression on IBA1 + microglia in combined bilateral hippocampal subfields and ( B ) in the ventroposterior lateral (VPL) thalamus in the contralateral (left) side as a percentage of the ipsilateral side. ( C ) CD206 expression on IBA1 + microglia in the ipsilateral and contralateral dorsolateral VPL thalamus. ( D ) Representative photomicrographs of the ventromedial VPL thalamus contralateral to the surgery site. ( E ) Representative photomicrographs (contralateral ventral pole CA1 of an affected rat) and fluorescent intensity values for BDNF staining on GFAP-positive cells, ( F ) IL-1β on IBA1 + cells, and ( G ) phospho-p38 MAPK on IBA1 + cells. Column graphs show group means ± standard error, with individual data points showing the expression value for one rat. Immunofluorescent intensity values are expressed in arbitrary units for mPFC and hippocampus, and as a percentage of the ipsilateral side for the aggregated VPL thalamus. CCI: chronic constriction injury; LD: unaffected ; HD: affected ; mPFC: medial prefrontal cortex; CD206: cluster of differentiation 206 (mannose receptor); BDNF: brain-derived neurotrophic factor; IL-1β: interleukin-1 beta; p38 MAPK: p38 mitogen-activated protein kinase. * P adj < 0.05; ** P adj < 0.01

Article Snippet: Sections were incubated with biotin- or Alexa series fluorophore-conjugated fab fragment secondary antibodies produced in donkey (Jackson ImmunoResearch) in 2% NHS in PBS for 3 h. FosB and pp38 MAPK underwent fluorophore-conjugated streptavidin amplification in PBS for 2 h. The primary antibody was then further incubated in 1:100 unconjugated fab fragments (Jackson ImmunoResearch, cat no. 711-007-003, RRID: AB_2340587) to block crossreactivity with the second primary antibody raised in the same species.

Techniques: Expressing, Staining, Derivative Assay

Journal: Scientific Reports

Article Title: HIF-PHD inhibitor regulates the function of group2 innate lymphoid cells and polarization of M2 macrophages

doi: 10.1038/s41598-023-29161-3

Figure Lengend Snippet: IL-33-ST2L-p38 MAPK signaling was impeded in kidney ILC2s treated with HIF-PHD inhibitors. ( A ) ILC2s were sorted from kidneys of pooled 6 mice, and cultured with IL-2 and IL-7 for 3 days. Then IL-33 was added to stimulate ILC2s for further 3 days, and HIF-PHD inhibitors were added for the last 24 h. Relative levels of mRNA expression for ST2L in kidney ILC2s treated with DMSO, GSK360A, and FG-4592. ( B ) Sorted kidney ILC2s were stimulated by 50 ng/ml recombinant murine IL-33 or 50 ng/ml PMA and 500 ng/ml ionomycin for 3 h in the presence of brefeldin A. ST2L MFI was analyzed by FACS. ( C ) Sorted kidney ILC2s were cultured with IL-2 and IL-7 for 3 days, and half of the media was changed with fresh media containing IL-2 and IL-7. After a further 3 days, ILC2s were cultured in cytokine-free conditions for 4 h in the presence of HIF-PHD inhibitors, and then ILC2s were stimulated with 10 ng/ml recombinant murine IL-33 for 15 min. Phosphorylated p38 MAPK (Thr180/Tyr182) was assessed by FACS. Representative histograms are shown for phosphorylated p38 MAPK in kidney ILC2s treated with DMSO (gray area), GSK360A (dashed line), FG-4592 (long-dashed line), IL-33 non-stimulated (solid line), and isotype control (black area). ( D ) The graph shows the frequency of phosphorylated p38 MAPK. We used the pooled kidney from 6 mice as n = 1, and data shown are pooled from two (A,B) (n = 6) or three (D) (n = 9) independent experiments. Error bars show SEM. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: To detect phosphorylated-p38 MAPK, ILC2s were cultured with cytokine free condition for 4 h, and stimulated with 10 ng/ml IL-33 for 15 min, and immediately fixed/permeabilized by pre-chilled methanol, and stained with anti-p38 MAPK Phospho (Thr180/Tyr182) antibody (Biolegend).

Techniques: Cell Culture, Expressing, Recombinant, Control