pp1a Search Results


96
Vector Biolabs ad cre
Ad Cre, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pm37591875-173-10-12?v=Vector+Biolabs
Average 96 stars, based on 1 article reviews
ad cre - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

92
Rockland Immunochemicals antibody against non structural protein 3
Antibody Against Non Structural Protein 3, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc07431179__mmc1-32-27-33?v=Rockland+Immunochemicals
Average 92 stars, based on 1 article reviews
antibody against non structural protein 3 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

90
OriGene human pp1α pcmv6 entry
Human Pp1α Pcmv6 Entry, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc07402523-148-0-17?v=OriGene
Average 90 stars, based on 1 article reviews
human pp1α pcmv6 entry - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Proteintech ppp1ca santa cruz biotech
Ppp1ca Santa Cruz Biotech, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc12296510__mmc6-564-103-114?v=Proteintech
Average 93 stars, based on 1 article reviews
ppp1ca santa cruz biotech - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
OriGene un tagged pp1a plasmid
Un Tagged Pp1a Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pm26847655-75-1-6?v=OriGene
Average 90 stars, based on 1 article reviews
un tagged pp1a plasmid - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ABclonal Biotechnology anti-pp1a a2184
Anti Pp1a A2184, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc04932730-217-0-4?v=ABclonal+Biotechnology
Average 90 stars, based on 1 article reviews
anti-pp1a a2184 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Merck KGaA kinase inhibitors pp1a
Kinase Inhibitors Pp1a, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/10__1161_slash_atvbaha__111__222745-323-0-15?v=Merck+KGaA
Average 90 stars, based on 1 article reviews
kinase inhibitors pp1a - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma pp1a sirna
Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
Pp1a Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc04932730-213-20-29?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
pp1a sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc housekeeping genes pp1a and rpl12
Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
Housekeeping Genes Pp1a And Rpl12, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc05916518-52-11-16?v=PrimerDesign+Inc
Average 90 stars, based on 1 article reviews
housekeeping genes pp1a and rpl12 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biozol Diagnostica Vertrieb GmbH phosphatase (pp1a/pp2) assay
Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
Phosphatase (Pp1a/Pp2) Assay, supplied by Biozol Diagnostica Vertrieb GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pmc05520940-132-0-13?v=Biozol+Diagnostica+Vertrieb+GmbH
Average 90 stars, based on 1 article reviews
phosphatase (pp1a/pp2) assay - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Becton Dickinson monoclonal anti-pp1a
Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
Monoclonal Anti Pp1a, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/pm15917191-58-34-37?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
monoclonal anti-pp1a - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Biomol GmbH antibodies against the catalytic subunits for pp1a, pp2aa, and pp2ab catalogue no. 06–221, lot no. 12641
Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with <t>siRNA</t> for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.
Antibodies Against The Catalytic Subunits For Pp1a, Pp2aa, And Pp2ab Catalogue No. 06–221, Lot No. 12641, supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pp1a/10__1152_slash_ajpheart__1998__274__6__h2123-121-10-24?v=Biomol+GmbH
Average 90 stars, based on 1 article reviews
antibodies against the catalytic subunits for pp1a, pp2aa, and pp2ab catalogue no. 06–221, lot no. 12641 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with siRNA for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 expression affects YAP subcellular translocation in MDCK cells. ( a ) Distribution and co-localization of YAP (red), Par3 (green), a merged image with only YAP and Par3 and a merged image with 4′, 6-diamidino-2-phenylindole (blue) of MDCK II cells at different cell densities. Scale bar: 25 μm. ( b ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different cell densities are shown. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ( c ) Representative images of YAP translocation into the cytoplasm at low cell density when Par3 was knocked down but not at high cell density. MDCK II cells were transfected with siRNA for Par3 at different cell densities. YAP (red), Par3 (green) and a merged image. Scale bar: 25 μm. All pictures were taken with a Leica TCS SP5 microscope. ( d ) The areas representing the cytosolic or nuclear fraction are indicated with bars at the top of each histogram. N: nucleus; C: cytoplasm. The histogram analysis of YAP and Par3 signal intensity in subcellular distributions was performed with the ‘Plot profile’ in ImageJ software. The analyzed area is indicated by the white straight line in the overview. YAP signal intensity distribution (red line), nucleus signal intensity distribution (blue line). ( e , f ) YAP translocated into the nucleus with Par3 overexpression, and YAP nuclear localization was inhibited when Par3 was knocked down. A cell fraction assay was performed after 293T cells were transfected with Flag-Par3 or MDCK II cells were transfected with siRNA for Par3 for 2 days at low cell density. Lamin-B is the nuclear marker and β-actin is the cytoplasmic marker. ( g ) Par3 knockdown reduced YAP translocation to the nucleus in the Ca 2+ off switch system. Representative images of YAP translocation into the nucleus at high cell density when Ca 2+ was depleted are shown. After 2 days, while MDCK II cells were transfected with siRNA for Par3, MDCK II cells were cultured with Ca 2+ -free medium for the indicated time course. YAP (red), Par3 (green) and ZO-1 (purple). Scale bar: 25 μm. ( h ) Ratios of the percentages of nuclear and cytoplasmic YAP and Par3 at different time points. Pictures were analyzed with a Columbus Image Data Storage and Analysis System. ** P <0.01, * P <0.05.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Expressing, Translocation Assay, Transfection, Microscopy, Software, Over Expression, Marker, Knockdown, Cell Culture

Par3 promotes YAP dephosphorylation and activation, regulating YAP target gene expression and cell proliferation. ( a ) Par3 reduced YAP phosphorylation at Ser127. 293T cells were transfected with FLAG-Par3 and HA-YAP, and the pYAP Ser127 site was detected. The data are representative of three independent experiments, *** P <0.001. ( b ) Par3 knockdown increased YAP phosphorylation at low cell density but not at high cell density. MDCK II cells were transfected with two different siRNAs for Par3 at low and high cell densities, and total YAP and pYAP Ser127 sites were detected. The data are representative of three independent experiments, *** P <0.001, ** P <0.01. ( c ) Par3 knockdown inhibited YAP target genes Ankrd1, Ctgf, Cyr61 and Inhba at low cell density but not at high cell density. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low and high cell densities. ( d ) Par3 knockdown inhibited cell proliferation, whereas overexpression of YAP active forms and YAP S127A rescued the inhibition by Par3 knockdown in MDCK II cells. An MTT assay was performed in MDCK II cells, and Par3 and HA-YAP and YAP/S127A expression levels were determined by western blotting. ( e , f ) Deleted PDZ3 domain of Par3 could not reduce YAP phosphorylation and deleted PDZ motif of YAP could not be regulated by Par3. 293T cells were transfected with indicated plasmids. ( g ) The inhibition of YAP target genes ( Ankrd1, Ctgf, Cyr61, Diaph1 and Inhba ) by Par3 knockdown at low density could be partially rescued by Par3, but not by Par3 ΔPDZ3. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low density.

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 promotes YAP dephosphorylation and activation, regulating YAP target gene expression and cell proliferation. ( a ) Par3 reduced YAP phosphorylation at Ser127. 293T cells were transfected with FLAG-Par3 and HA-YAP, and the pYAP Ser127 site was detected. The data are representative of three independent experiments, *** P <0.001. ( b ) Par3 knockdown increased YAP phosphorylation at low cell density but not at high cell density. MDCK II cells were transfected with two different siRNAs for Par3 at low and high cell densities, and total YAP and pYAP Ser127 sites were detected. The data are representative of three independent experiments, *** P <0.001, ** P <0.01. ( c ) Par3 knockdown inhibited YAP target genes Ankrd1, Ctgf, Cyr61 and Inhba at low cell density but not at high cell density. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low and high cell densities. ( d ) Par3 knockdown inhibited cell proliferation, whereas overexpression of YAP active forms and YAP S127A rescued the inhibition by Par3 knockdown in MDCK II cells. An MTT assay was performed in MDCK II cells, and Par3 and HA-YAP and YAP/S127A expression levels were determined by western blotting. ( e , f ) Deleted PDZ3 domain of Par3 could not reduce YAP phosphorylation and deleted PDZ motif of YAP could not be regulated by Par3. 293T cells were transfected with indicated plasmids. ( g ) The inhibition of YAP target genes ( Ankrd1, Ctgf, Cyr61, Diaph1 and Inhba ) by Par3 knockdown at low density could be partially rescued by Par3, but not by Par3 ΔPDZ3. RT-qPCR was performed in MDCK II cells transfected with siRNA for Par3 at low density.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: De-Phosphorylation Assay, Activation Assay, Targeted Gene Expression, Phospho-proteomics, Transfection, Knockdown, Quantitative RT-PCR, Over Expression, Inhibition, MTT Assay, Expressing, Western Blot

Par3 interacts with LATS1/2, YAP and PP1A and promotes dephosphorylation of LATS1 and YAP. ( a ) Overexpression of Par3 and PDZ deletion mutants decreased LATS1 phosphorylation at Ser909. 293T cells were transfected with the indicated plasmids, and pLATS Ser909 was determined by western blotting. ( b ) The reduction of YAP phosphorylation by Par3 overexpression was weakened when LATS1/2 was knocked down. 293T cells were transfected with FLAG-Par3 and siRNA for LATS1/2; western blot analysis was performed as indicated. ( c ) The increment of YAP phosphorylation by Par3 knockdown was attenuated by LATS1/2 knockdown. MDCK II cells were transfected with siRNA for Par3 or LATS1/2; western blot analysis was performed as indicated. ( d ) Par3 interacted with LATS1 and PP1A. Co-immunoprecipitation was conducted with anti-FLAG antibodies in 293T cells, which were transfected with GFP-Par3, FLAG-LATS1 and FLAG-PP1A. ( e ) Par3 promoted the interaction of YAP and PP1A. IP was conducted with anti-YAP antibodies in 293T cells transfected with FLAG-Par3, and endogenous PP1A was subjected to western blot analysis. ( f ) Par3 knockdown reduced the interaction of LATS1 and PP1A. IP was performed with anti-LATS1 antibodies in 293T cells transfected with siPar3, and western blot analysis was performed as indicated. All experiments were performed at low cell density. ( g ) LATS1 and PP1A mainly localized in the nucleus at a low cell density. Cell fractionations were performed with MDCK II cells at low cell density. Western blot analysis was performed as indicated. ( h ) YAP interacts with Par3, LATS1 and PP1A in the nucleus and cytoplasm. IP with anti-YAP antibodies was conducted with the nuclear and cytoplasmic fractions of MDCK II cells at low cell density. Western blot analysis was performed as indicated.

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Par3 interacts with LATS1/2, YAP and PP1A and promotes dephosphorylation of LATS1 and YAP. ( a ) Overexpression of Par3 and PDZ deletion mutants decreased LATS1 phosphorylation at Ser909. 293T cells were transfected with the indicated plasmids, and pLATS Ser909 was determined by western blotting. ( b ) The reduction of YAP phosphorylation by Par3 overexpression was weakened when LATS1/2 was knocked down. 293T cells were transfected with FLAG-Par3 and siRNA for LATS1/2; western blot analysis was performed as indicated. ( c ) The increment of YAP phosphorylation by Par3 knockdown was attenuated by LATS1/2 knockdown. MDCK II cells were transfected with siRNA for Par3 or LATS1/2; western blot analysis was performed as indicated. ( d ) Par3 interacted with LATS1 and PP1A. Co-immunoprecipitation was conducted with anti-FLAG antibodies in 293T cells, which were transfected with GFP-Par3, FLAG-LATS1 and FLAG-PP1A. ( e ) Par3 promoted the interaction of YAP and PP1A. IP was conducted with anti-YAP antibodies in 293T cells transfected with FLAG-Par3, and endogenous PP1A was subjected to western blot analysis. ( f ) Par3 knockdown reduced the interaction of LATS1 and PP1A. IP was performed with anti-LATS1 antibodies in 293T cells transfected with siPar3, and western blot analysis was performed as indicated. All experiments were performed at low cell density. ( g ) LATS1 and PP1A mainly localized in the nucleus at a low cell density. Cell fractionations were performed with MDCK II cells at low cell density. Western blot analysis was performed as indicated. ( h ) YAP interacts with Par3, LATS1 and PP1A in the nucleus and cytoplasm. IP with anti-YAP antibodies was conducted with the nuclear and cytoplasmic fractions of MDCK II cells at low cell density. Western blot analysis was performed as indicated.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: De-Phosphorylation Assay, Over Expression, Phospho-proteomics, Transfection, Western Blot, Knockdown, Immunoprecipitation

Dual function of Par3 in regulating YAP phosphorylation and activation . ( a ) PP1A knockdown alone increased YAP and LATS1 phosphorylation, and PP1A knockdown plus Par3 overexpression promoted more the increased phosphorylation of YAP and LATS1. 293T cells were transfected with two different siRNAs for PP1A and FLAG-Par3 plasmids. Western blot analysis was performed as indicated. ( b ) PP1A knockdown inhibited YAP target genes Anln, Ankrd1, Ctgf and Diaph1 , and Par3 overexpression enhanced the inhibition of YAP target genes by PP1A knockdown. RT-qPCR was performed in 293T cells transfected with siRNA for PP1A and FLAG-Par3 at low cell density. ( c ) PP1A knockdown inhibited cell proliferation, and Par3 overexpression enhanced the inhibition of cell proliferation by PP1A knockdown, as assessed by an EdU assay. Total cell number was measured by 4′, 6-diamidino-2-phenylindole (blue), and cells in mitosis were labeled by EdU (green). Scale bar: 100 um. MDCK II cells were transfected with siRNA for PP1A and FLAG-Par3 plasmids for 2 days and were then cultured with normal medium containing 10 μ M EdU for 30 min. Cells were then stained according to the Click-iT EdU Alexa Fluor 488 Imaging Kit (C10337) protocol from Invitrogen. ( d ) The ratio of EdU-positive cells/total cells was determined.

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: Dual function of Par3 in regulating YAP phosphorylation and activation . ( a ) PP1A knockdown alone increased YAP and LATS1 phosphorylation, and PP1A knockdown plus Par3 overexpression promoted more the increased phosphorylation of YAP and LATS1. 293T cells were transfected with two different siRNAs for PP1A and FLAG-Par3 plasmids. Western blot analysis was performed as indicated. ( b ) PP1A knockdown inhibited YAP target genes Anln, Ankrd1, Ctgf and Diaph1 , and Par3 overexpression enhanced the inhibition of YAP target genes by PP1A knockdown. RT-qPCR was performed in 293T cells transfected with siRNA for PP1A and FLAG-Par3 at low cell density. ( c ) PP1A knockdown inhibited cell proliferation, and Par3 overexpression enhanced the inhibition of cell proliferation by PP1A knockdown, as assessed by an EdU assay. Total cell number was measured by 4′, 6-diamidino-2-phenylindole (blue), and cells in mitosis were labeled by EdU (green). Scale bar: 100 um. MDCK II cells were transfected with siRNA for PP1A and FLAG-Par3 plasmids for 2 days and were then cultured with normal medium containing 10 μ M EdU for 30 min. Cells were then stained according to the Click-iT EdU Alexa Fluor 488 Imaging Kit (C10337) protocol from Invitrogen. ( d ) The ratio of EdU-positive cells/total cells was determined.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Phospho-proteomics, Activation Assay, Knockdown, Over Expression, Transfection, Western Blot, Inhibition, Quantitative RT-PCR, EdU Assay, Labeling, Cell Culture, Staining, Imaging

YAP activation by Par3 is differentially regulated in tumor cell lines . ( a ) Par3, YAP and PP1A expression patterns were different in different cell lines. The lung cell lines A549, 5810, 5844, 5883, 5928 and HepG2 were harvested for western blotting, and analyses were performed as indicated. ( b ) In the 5928 cell line, Par3 decreases YAP phosphorylation, as in 293T cells. 5928 cells were transfected with FLAG-Par3, and pYAP Ser127 was detected. ( c ) The YAP target genes Anln, Ankrd1, Ctgf and Cyr61 were upregulated when Par3 was overexpressed. RT-qPCR was performed in 5928 cells transfected with FLAG-Par3 at low cell density. ( d ) In the 5803 cell line, Par3 increased YAP phosphorylation and reduced YAP protein levels. 5803 cells were transfected with FLAG-Par3, and pYAP Ser127 and YAP were detected. ( e ) The YAP target genes Ankrd1, Cyr61, Diaph1 and Inhba were reduced when Par3 was overexpressed in the 5803 cell line. RT-qPCR was performed in 5803 cells transfected with FLAG-Par3 at low cell density.

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: YAP activation by Par3 is differentially regulated in tumor cell lines . ( a ) Par3, YAP and PP1A expression patterns were different in different cell lines. The lung cell lines A549, 5810, 5844, 5883, 5928 and HepG2 were harvested for western blotting, and analyses were performed as indicated. ( b ) In the 5928 cell line, Par3 decreases YAP phosphorylation, as in 293T cells. 5928 cells were transfected with FLAG-Par3, and pYAP Ser127 was detected. ( c ) The YAP target genes Anln, Ankrd1, Ctgf and Cyr61 were upregulated when Par3 was overexpressed. RT-qPCR was performed in 5928 cells transfected with FLAG-Par3 at low cell density. ( d ) In the 5803 cell line, Par3 increased YAP phosphorylation and reduced YAP protein levels. 5803 cells were transfected with FLAG-Par3, and pYAP Ser127 and YAP were detected. ( e ) The YAP target genes Ankrd1, Cyr61, Diaph1 and Inhba were reduced when Par3 was overexpressed in the 5803 cell line. RT-qPCR was performed in 5803 cells transfected with FLAG-Par3 at low cell density.

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Activation Assay, Expressing, Western Blot, Phospho-proteomics, Transfection, Quantitative RT-PCR

The hypothetical model for the dual function of Par3 in regulating YAP phosphorylation and activation. At high cell density, Par3 and YAP co-localize in the TJs at the cell–cell contact and Par3 has no effect on YAP phosphorylation (left panel). At low cell density, or calcium depletion, HGF stimulation/γ-irradiation, phosphorylated Par3 by Par1 translocates from membrane to the cytoplasm(①) or the nucleus (②). Cytoplasmic or nuclear Par3 recruits PP1A to dephosphorylate LATS1, promoting YAP activity (right panel). When PP1A is knocked down or Par3’s spatial localization is disordered, Par3 expression induces YAP hyperphosphorylation and degradation (③).

Journal: Cell Discovery

Article Title: Dual function of partitioning-defective 3 in the regulation of YAP phosphorylation and activation

doi: 10.1038/celldisc.2016.21

Figure Lengend Snippet: The hypothetical model for the dual function of Par3 in regulating YAP phosphorylation and activation. At high cell density, Par3 and YAP co-localize in the TJs at the cell–cell contact and Par3 has no effect on YAP phosphorylation (left panel). At low cell density, or calcium depletion, HGF stimulation/γ-irradiation, phosphorylated Par3 by Par1 translocates from membrane to the cytoplasm(①) or the nucleus (②). Cytoplasmic or nuclear Par3 recruits PP1A to dephosphorylate LATS1, promoting YAP activity (right panel). When PP1A is knocked down or Par3’s spatial localization is disordered, Par3 expression induces YAP hyperphosphorylation and degradation (③).

Article Snippet: The sequences of the Par3 siRNA duplexes (siRNA1: GACAGACUGGUAGCAGUGU, siRNA2: CAUGGAGAUGGAGGAAUAC), LATS1/2 siRNA (LATS1 siRNA: CAUACGAGUCAAUCAGUAA, LATS2 siRNA: AAAGGCGUAUGGCGAGUAG) and PP1A siRNA (siRNA1: AAAACCTTCACTGACTGCTTC, siRNA2: CCATTCTTCTGGAGCTGGA) were synthesized by Genepharma (Shanghai, China).

Techniques: Phospho-proteomics, Activation Assay, Irradiation, Membrane, Activity Assay, Expressing