|
Polymorphic Dna Technologies Inc
poly-t length determination Poly T Length Determination, supplied by Polymorphic Dna Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc04550703-129-0-7?v=Polymorphic+Dna+Technologies+Inc Average 90 stars, based on 1 article reviews
poly-t length determination - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
poly-t primer Poly T Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc03178182-89-9-11?v=Promega Average 90 stars, based on 1 article reviews
poly-t primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
poly-t affinity chromatography polyatract system Poly T Affinity Chromatography Polyatract System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc07370818-87-15-20?v=Promega Average 90 stars, based on 1 article reviews
poly-t affinity chromatography polyatract system - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Operon Technologies Inc
15 pmol of poly t primer 15 Pmol Of Poly T Primer, supplied by Operon Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pm12736433-59-28-42?v=Operon+Technologies+Inc Average 90 stars, based on 1 article reviews
15 pmol of poly t primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Oxford Nanopore
poly(t) adaptors Poly(t) Adaptors, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/bio_rxiv__2020__03__05__976167-22-8-18?v=Oxford+Nanopore Average 90 stars, based on 1 article reviews
poly(t) adaptors - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Celera
snp and variation in the length of a poly-t tract ![]() Snp And Variation In The Length Of A Poly T Tract, supplied by Celera, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc01192798-99-4-29?v=Celera Average 90 stars, based on 1 article reviews
snp and variation in the length of a poly-t tract - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
poly(t) affinity chromatography polyattract® system ![]() Poly(t) Affinity Chromatography Polyattract® System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pm12813038-55-9-14?v=Promega Average 90 stars, based on 1 article reviews
poly(t) affinity chromatography polyattract® system - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
poly-(t)20 primers ![]() Poly (T)20 Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/bio_rxiv__177881-164-16-21?v=Promega Average 90 stars, based on 1 article reviews
poly-(t)20 primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
poly(t) cds-primer ![]() Poly(t) Cds Primer, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc02223640-133-15-20?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
poly(t) cds-primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Zinfandel Pharmaceuticals Inc
523 variable length poly-t diagnostic ![]() 523 Variable Length Poly T Diagnostic, supplied by Zinfandel Pharmaceuticals Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc02874876-119-20-0?v=Zinfandel+Pharmaceuticals+Inc Average 90 stars, based on 1 article reviews
523 variable length poly-t diagnostic - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Tri-I Biotech Inc
poly(t ![]() Poly(t, supplied by Tri-I Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/pmc02753136-77-2-6?v=Tri-I+Biotech+Inc Average 90 stars, based on 1 article reviews
poly(t - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
GeneTag Technology
modified poly-t primers first-red linker version r-gt-rtp 5’ctacgatacgatagggcctaagagtag-ttttttttttttttt ![]() Modified Poly T Primers First Red Linker Version R Gt Rtp 5’ctacgatacgatagggcctaagagtag Ttttttttttttttt, supplied by GeneTag Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/poly%28t/us07482443-651-5-0?v=GeneTag+Technology Average 90 stars, based on 1 article reviews
modified poly-t primers first-red linker version r-gt-rtp 5’ctacgatacgatagggcctaagagtag-ttttttttttttttt - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Genomics
Article Title: Reverse transcriptional profiling: non-correspondence of transcript level variation and proximal promoter polymorphism
doi: 10.1186/1471-2164-6-110
Figure Lengend Snippet: Schematics of proximal promoters. At least one kb of the proximal promoters of 34 candidate genes whose transcripts vary (left and center columns) or do not vary (right column) in expression between D. melanogaster strains. Genes whose expression is greater in the Russian 2b (R2b) strain are shown in the left column and those whose expression is greater in the Oregon R (OrR) strain in the center column. Genes with fewer polymorphisms are shown in Figure 1 and those with seven or more are shown in Figure 2. The long horizontal lines for each gene designate the sequence of the proximal promoter with changes in the R2b strain shown above the line and those in the OrR strain below the line. The large, bent arrows indicate transcriptional start sites. Single Nucleotide Polymorphisms (SNPs) are shown as small vertical lines and indels as triangles, with the sequence or length in nucleotides (nt). The numbers of SNPs are listed where there are too many to illustrate clearly. Putative transcription factor binding sites created or removed by the SNP or indel are shown above or below the polymorphisms, with short horizontal lines or arrows designating the included polymorphisms. Because there are too many to illustrate clearly, putative transcription factor binding sites are not shown for CYP9C1 (CG3616), Fkbp13 (CG9847), qkr58E-3 (CG3584), bin (CG18647), tensin (CG9379), Cry (CG16963), KP78a (CG6715), Cng (CG7779), Fer2 (CG5952), Mt2 (CG10692). Shaded boxes designate introns in the 5'untranslated regions (UTRs).
Article Snippet: In qkr58E-3 (CG3584), a
Techniques: Expressing, Sequencing, Binding Assay
Journal: BMC Genomics
Article Title: Reverse transcriptional profiling: non-correspondence of transcript level variation and proximal promoter polymorphism
doi: 10.1186/1471-2164-6-110
Figure Lengend Snippet: Schematics of proximal promoters. At least one kb of the proximal promoters of 34 candidate genes whose transcripts vary (left and center columns) or do not vary (right column) in expression between D. melanogaster strains. Genes whose expression is greater in the Russian 2b (R2b) strain are shown in the left column and those whose expression is greater in the Oregon R (OrR) strain in the center column. Genes with fewer polymorphisms are shown in Figure 1 and those with seven or more are shown in Figure 2. The long horizontal lines for each gene designate the sequence of the proximal promoter with changes in the R2b strain shown above the line and those in the OrR strain below the line. The large, bent arrows indicate transcriptional start sites. Single Nucleotide Polymorphisms (SNPs) are shown as small vertical lines and indels as triangles, with the sequence or length in nucleotides (nt). The numbers of SNPs are listed where there are too many to illustrate clearly. Putative transcription factor binding sites created or removed by the SNP or indel are shown above or below the polymorphisms, with short horizontal lines or arrows designating the included polymorphisms. Because there are too many to illustrate clearly, putative transcription factor binding sites are not shown for CYP9C1 (CG3616), Fkbp13 (CG9847), qkr58E-3 (CG3584), bin (CG18647), tensin (CG9379), Cry (CG16963), KP78a (CG6715), Cng (CG7779), Fer2 (CG5952), Mt2 (CG10692). Shaded boxes designate introns in the 5'untranslated regions (UTRs).
Article Snippet: In qkr58E-3 (CG3584), a
Techniques: Expressing, Sequencing, Binding Assay