|
Addgene inc
plko 1 vector ![]() Plko 1 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc05126274-69-17-19?v=Addgene+inc Average 93 stars, based on 1 article reviews
plko 1 vector - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cd511b 1 plko 1 gfp vector addgene76 ![]() Cd511b 1 Plko 1 Gfp Vector Addgene76, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pm39321806-233-159-167?v=Addgene+inc Average 95 stars, based on 1 article reviews
cd511b 1 plko 1 gfp vector addgene76 - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Addgene inc
fasn shrna1 plasmid ![]() Fasn Shrna1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/elahi_lubayna__2023__epigenome_and_the_lipidome_rewiring_for_targeting_idh_mutant_gliomas-759-64-68?v=Addgene+inc Average 93 stars, based on 1 article reviews
fasn shrna1 plasmid - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
p53 5 targeting plko p53 shrna 941 ![]() P53 5 Targeting Plko P53 Shrna 941, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc06158291__41467_2018_5805_MOESM1_ESM-51-20-23?v=Addgene+inc Average 93 stars, based on 1 article reviews
p53 5 targeting plko p53 shrna 941 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cctcatcgtcaagtccttcaa mouse raptor 2 addgene ![]() Cctcatcgtcaagtccttcaa Mouse Raptor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc06717289__pnas__1901765116__sapp-192-203-207?v=Addgene+inc Average 92 stars, based on 1 article reviews
cctcatcgtcaagtccttcaa mouse raptor 2 addgene - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pka cα ![]() Pka Cα, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc06824261-73-25-14?v=Addgene+inc Average 92 stars, based on 1 article reviews
pka cα - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid id ![]() Plasmid Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc11039321-291-12-11?v=Addgene+inc Average 92 stars, based on 1 article reviews
plasmid id - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Addgene inc
bob weinberg ![]() Bob Weinberg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pm39408703-266-9-11?v=Addgene+inc Average 94 stars, based on 1 article reviews
bob weinberg - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna gfp t1 ![]() Sgrna Gfp T1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/10__7554_slash_elife__66998-261-94-104?v=Addgene+inc Average 93 stars, based on 1 article reviews
sgrna gfp t1 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene 30319 ![]() Addgene 30319, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc06255761__41467_2018_7444_MOESM1_ESM-136-8-8?v=Addgene+inc Average 93 stars, based on 1 article reviews
addgene 30319 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
megfp ![]() Megfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/pmc03980114-150-11-23?v=Addgene+inc Average 92 stars, based on 1 article reviews
megfp - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Addgene inc
shctnnb1 ![]() Shctnnb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plko+shrna/laks_dan_richard__2015__the_assessment_of_glioblastoma_tumorspheres_reveals_molecular_determinants_of_proliferation_and-1630-35-36?v=Addgene+inc Average 93 stars, based on 1 article reviews
shctnnb1 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: American Journal of Cancer Research
Article Title: MiR-101 targets USP22 to inhibit the tumorigenesis of papillary thyroid carcinoma
doi:
Figure Lengend Snippet: MiR-101 overexpression or USP22 knockdown suppressed tumor growth and metastasis and promoted apoptosis of PTC cells in vivo. SCID mice were injected subcutaneously or via their tail veins with K1-luc cells infected with a control lentivirus (Lenti-pGCsi or Lenti-pLKO.1) or a recombinant lentivirus expressing a miR-101 precursor (Lenti-pGCsi-miR-101) or shUSP22 (Lenti-shUSP22). A. In vivo luciferase imaging of the xenografts at 5 weeks after implanted with K1-luc cells. B. Representative gross photos of tumors after 12 weeks of implantation. C. Tumor volume was measured and calculated every two weeks. D. The numbers of metastatic foci in the lungs of mice from various groups at 8 weeks after tail vein injection. E. TUNEL assay was performed to detect the percentage of apoptotic cells. F. Representative results of western blot analyses of USP22, cyclin D2, Rb, E-cadherin, snail, cl-caspase-3, and caspase-3 in tumor tissues. β-actin was used as endogenous control. All data are shown as means ± SD of three separate experiments. *P < 0.05.
Article Snippet: Paired deoxyribonucleotide oligos encoding the shRNAs were synthesized, annealed, and cloned into the EcoRI/NcoI sites of the
Techniques: Over Expression, In Vivo, Injection, Infection, Recombinant, Expressing, Luciferase, Imaging, TUNEL Assay, Western Blot
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: Deletion of PKA Cα enhances TXNIP level in β-cells. (A) Three designed sgRNAs were inserted into LentiV2 plasmid. These plasmids were transfected into INS-1 cells, and the TXNIP protein level was detected using WB (n = 3). (B) Single PKA Cα-KO β-cell was screened out using 96-well plate and the PKA Cα gene was sequenced in WT and PKA Cα-KO cells. Red sequence indicates GGG in the CRISPR -Cas9 sgRNA design and the green sequence indicates the whole sgRNA sequence. (C) EYFP vector or EYFP- PKA Cα plasmids were transfected into WT or PKA Cα-KO INS-1 cells separately for 24 h. THAP was added to the indicated cells. TXNIP and PKA Cα were analyzed using WB (n = 3). (D) WT or PKA Cα-KO INS-1 cells were treated with THAP, FSK or H89 for 2 h. TXNIP and PKA Cα were analyzed using WB (n = 3). (E) WT or PKA Cα-KO INS-1 cells were treated with THAP, and GSIS assay was performed as described in materials and methods (n = 3). (F) The mRNA level of IL-1β and IL-6 were analyzed in WT or PKA Cα-KO INS-1 cells by qRT-PCR (n = 3). Bars represent the mean ± SEM of independent samples. Significant difference in expression between groups as labeled was analyzed by one-way ANOVA, corrected for multiple comparisons with the Bonferroni test. (ns indicates no statistically significant, ** indicates P value < 0.01, *** indicates P value < 0.001).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Plasmid Preparation, Transfection, Sequencing, CRISPR, Quantitative RT-PCR, Expressing, Labeling
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: FSK treatment reduces TXNIP level. (A) INS-1 cells were incubated with THAP (0.5 µM), and TXNIP protein was detected using WB (n = 3). (B) INS-1 cells were incubated with THAP (0.5 µM) and FSK (10 µM) at the same time, and then TXNIP protein was detected using WB (n = 3). (C) INS-1 cells were incubated with THAP (0.5 µM) and FSK (10 µM) together, then mRNA level of TXNIP was detected by qRT-PCR (n = 3). (D) INS-1 cells were incubated with MG132 (1 µM) or Bortezomib (0.5 µM) for 1 h, and then THAP (0.5 µM) and FSK (10 µM) was added for 2 h, then TXNIP was detected using WB (n = 3). (E) INS-1 cells were incubated with indicated inhibitors for 1 h, and then THAP (0.5 µM) and FSK (10 µM) was added for 8 h, then TXNIP and PKA Cα were detected using WB (n = 3). (F) INS-1 cells were incubated with indicated inhibitors for 8 h, and then TXNIP and PKA Cα were detected using WB (n = 3). Bars represent the mean ± SEM of independent samples. Significant difference in expression between un-treated group and the drug treatment group as labeled was analyzed by one-way ANOVA, corrected for multiple comparisons with the Bonferroni test. (* indicates P value < 0.05, ** indicates P value < 0.01, *** indicates P value < 0.001).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Incubation, Quantitative RT-PCR, Expressing, Labeling
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: PKA Cα directly interacts with TXNIP. (A) TXNIP-VC155 (0.5 µg/ml) and PKA Cα-VN173 (0.5 µg/ml) plasmids were transfected into INS-1 cells, with or without MG132. The FRET signal (Ex/Em: 515/528 nm) was observed using confocal microscope after 24 h. Nucleus was stained with DAPI (n = 3). (B) ECFP-TXNIP or EYFP- PKA Cα plasmids were transfected into INS-1 cells separately or together for 24 h. EYFP (red) or ECFP (green) signal was observed using confocal microscope (n = 3). INS-1 cells were incubated with THAP (0.5 µM) or FSK (10 µM) for 2 h, followed by lysis, anti- PKA Cα (C) or anti-TXNIP (D) antibody was used for Co-IP assay (n = 3). HEK-293 cells were transfected with PKA Cα or TXNIP (3.1a) plasmid and then cells were lysed. PKA Cα (E) or TXNIP (F) antibody was used for Co-IP assay (n = 3).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Transfection, Microscopy, Staining, Incubation, Lysis, Co-Immunoprecipitation Assay, Plasmid Preparation
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: PKA Cα overexpression alleviates TXNIP-induced β-cell dysfunctions. TXNIP and PKA Cα plasmids were transfected into INS-1 cells (A) or PKA Cα-KO INS-1 cells (B) , and GSIS assay was performed as described in materials and methods (n = 3). (C) TXNIP plasmid was transfected into WT or PKA Cα-KO INS-1 cells, with or without EYFP- PKA Cα plasmids. Then the mRNA level of IL-1β and IL-6 were analyzed using qRT-PCR (n = 3). (D) The mRNA level of IL-1β and IL-6 were analyzed by qRT-PCR in PKA Cα-KO INS-1 cell, with or without PKA Cα transfection (n = 3). Bars represent the mean ± SEM of independent samples. Significant difference in expression between groups as labeled was analyzed by one-way ANOVA, corrected for multiple comparisons with the Bonferroni test. (* indicates P value < 0.05, ** indicates P value < 0.01, *** indicates P value < 0.001).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Over Expression, Transfection, Plasmid Preparation, Quantitative RT-PCR, Expressing, Labeling
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: TXNIP (S308A) mutant resists the degradation effects of PKA Cα. (A) TXNIP phosphorylation site prediction by pkaPS software (n = 3). (B) TXNIP, TXNIP (S308A) and TXNIP (S307/308A) were transfected into INS-1 cells separately, then the TXNIP protein level was detected using WB after FSK treatment for 2 h (n = 3). (C) TXNIP, TXNIP (S308A), TXNIP (S307/308A) and EYFP- PKA Cα plasmids were transfected into INS-1 cells for 24 h and TXNIP level was detected using WB (n = 3). (D) TXNIP-VC155 (0.5 µg/ml), TXNIP (S307/308A)-VC155 (0.5 µg/ml), TXNIP (S308A)-VC155 (0.5 µg/ml) and PKA Cα-VN173 (0.5 µg/ml) plasmids were transfected separately into INS-1 cells, and the FRET signal (Ex/Em: 515/528 nm) was observed using confocal microscope after 24 h. Nucleus was stained with DAPI (n = 3). Bars represent the mean ± SEM of independent samples. Significant difference in expression between groups as labeled was analyzed by one-way ANOVA, corrected for multiple comparisons with the Bonferroni test. (ns indicates no statistically significant, * indicates P value < 0.05, *** indicates P value < 0.001).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Mutagenesis, Phospho-proteomics, Software, Transfection, Microscopy, Staining, Expressing, Labeling
Journal: Frontiers in Pharmacology
Article Title: GLP-1 Receptor Activation Abrogates β-Cell Dysfunction by PKA Cα-Mediated Degradation of Thioredoxin Interacting Protein
doi: 10.3389/fphar.2019.01230
Figure Lengend Snippet: Exendin-4 mediated β-cell protective effects are dependent on PKA Cα/TXNIP pathway. (B) (A) WT and PKA Cα-KO pancreatic β-cells were treated with exendin-4 for 2 h and TXNIP level was detected using WB (n = 3). (B) TXNIP, TXNIP (S308A) and TXNIP (S307/308A) plasmids were transfected separately into INS-1 cells for 24 h, followed by treatment with exendin-4 for 2h. TXNIP level was detected using WB (n = 3). (C) The quantification of (B) . (D) WT and PKA Cα-KO pancreatic β-cells were treated with THAP or exendin-4 for 2 h and TXNIP level was detected using WB (n = 3). (E) TXNIP and TXNIP (S307/308A) mutant plasmids were transfected separately into INS-1 cells for 24 h. The mRNA level of IL-1β and IL-6 were detected using qRT-PCR (n = 3). (F) The graphic model of PKA Cα/TXNIP pathway in pancreatic β-cells. Red arrow indicated the negative effect, Green arrow indicated the positive effect. Bars represent the mean ± SEM of independent samples. Significant difference in expression between groups as labeled was analyzed by one-way ANOVA, corrected for multiple comparisons with the Bonferroni test. (ns indicates no statistically significant, * indicates P value < 0.05, ** indicates P value < 0.01, *** indicates P value < 0.001).
Article Snippet: INS-1cells were transfected with the lentiCRISPRv2 [lentiCRISPRv2 puro was a gift from Brett Stringer (
Techniques: Transfection, Mutagenesis, Quantitative RT-PCR, Expressing, Labeling